HBVdb

Dataset for nucleotide sequence C of genotype D

[Download (right click)] [Alignment] [Repertoires]

1962 sequence(s)

>gnl|hbvcds|AB048701_C_P-D Feature FT:CDS AB048701_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagacaccgcaacagctctgtatcgggatgccttagagtctcctgaacactgtacacctcaccatactg
cactcaggcacgtatgtctttgctggggagacctaatgaacctagctacctgggtgggcaccaatttagaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagatttggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcctatcaacacttccggaaactactgttgttagacaacgaggcaggaccattagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB078031_C_P-D Feature FT:CDS AB078031_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FH1-YS). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcgct
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB078032_C_P-D Feature FT:CDS AB078032_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AH1-SY). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcgct
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB078033_C_P-D Feature FT:CDS AB078033_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IS1-OY). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcgct
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB090268_C_P-D Feature FT:CDS AB090268_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB090269_C_P-D Feature FT:CDS AB090269_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB090270_C_P-D Feature FT:CDS AB090270_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB104709_C_P-D Feature FT:CDS AB104709_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG64). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgttcttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB104710_C_P-D Feature FT:CDS AB104710_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG105). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctgctgt
acgagatctgctagataccgcctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcaccataccg
cactcaggcaagcaattctatgctggggagaattaatgactctggccacctgggtgggtggtaatttgcaagatccaaca
tctagggacctagtagtcacttatgttaacactcatatgggcttaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB104711_C_P-D Feature FT:CDS AB104711_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG104). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgttcttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB104712_C_P-D Feature FT:CDS AB104712_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG75). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactaaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggaaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB109475_C_P-D Feature FT:CDS AB109475_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB109476_C_P-D Feature FT:CDS AB109476_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB109477_C_P-D Feature FT:CDS AB109477_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB109478_C_P-D Feature FT:CDS AB109478_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcagctcatcatactg
cactcaggcaagctatcctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagggaccaagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactccaccaccttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB109479_C_P-D Feature FT:CDS AB109479_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
caatcaggcaagctatcctttgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB110075_C_P-D Feature FT:CDS AB110075_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116266_C_P-D Feature FT:CDS AB116266_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB119251_C_P-D Feature FT:CDS AB119251_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcaagacttctttccttcagt
acgcgatcttcttgataccgcctcagctctgtatcggcaagccttagagtctcctgagcattgttcagctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtactaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB119252_C_P-D Feature FT:CDS AB119252_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcatcatactg
cactcaggcaagctatcctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcctagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB119253_C_P-D Feature FT:CDS AB119253_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcaagacttctttcctgccgt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacatatcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgtctctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB119254_C_P-D Feature FT:CDS AB119254_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcatatcatcatactg
cactcaggcaagctatcctttgctggggggagttaatgactctagctacctgggtgggtggtaatttggacgatccaaca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB119255_C_P-D Feature FT:CDS AB119255_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttcttgatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
caatcaggcaagctatcctttgctggggggatttaatgtctctagctacctgggtgggtggtaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagatcaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB119256_C_P-D Feature FT:CDS AB119256_C_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggatttaatgactctagctacctgggggggtgttaacttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcatcacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB120308_C_P-D Feature FT:CDS AB120308_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcatcatactg
cactcaggcaagctatcctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcctagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB126581_C_P-D Feature FT:CDS AB126581_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU301). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttctgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB188241_C_P-D Feature FT:CDS AB188241_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctmtatcgggaagccttagagtctcctgagcattgttcacntcaccatactg
cactcaggcaagcaattctttgttggggggaattaatgactctagctacctgggtgggtgctaatttggaagatccaaca
tctagggacgcagtagttagttatgtcaacactaatatgggcctaaagtttaggcaacttttgtggttccacatttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacccaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB188242_C_P-D Feature FT:CDS AB188242_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA38). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagctacctgggtgggagctaatttggaagatcaacca
tctagggacctagtagttagttatgtcaacactaatgtgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB188244_C_P-D Feature FT:CDS AB188244_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZ24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggwcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205126_C_P-D Feature FT:CDS AB205126_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-IF714-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205127_C_P-D Feature FT:CDS AB205127_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU313-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctgaagttcaggcaactattatggtttcacatttcttg
tctcacttttggaagagaaacggtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205128_C_P-D Feature FT:CDS AB205128_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU316-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctaggggcctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttagtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB210820_C_P-D Feature FT:CDS AB210820_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaattaatgactctagctacttgggtgggtgttaatttggaagatcaacca
tctagggacctagtagttagctatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tatcacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaagacgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB210821_C_P-D Feature FT:CDS AB210821_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB210822_C_P-D Feature FT:CDS AB210822_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB222709_C_P-D Feature FT:CDS AB222709_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacttgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB222710_C_P-D Feature FT:CDS AB222710_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6M). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagacacacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB222711_C_P-D Feature FT:CDS AB222711_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNV24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB222712_C_P-D Feature FT:CDS AB222712_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV61). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagcactatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB222713_C_P-D Feature FT:CDS AB222713_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246347_C_P-D Feature FT:CDS AB246347_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246348_C_P-D Feature FT:CDS AB246348_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB267090_C_P-D Feature FT:CDS AB267090_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ehime 22-HS). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcgct
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270537_C_P-D Feature FT:CDS AB270537_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL22F). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttgcaagatccagca
tctagagaccaggtagtcagttatgtcaacactaatatgggcctaaagttcaggcagctcttgtggtttcacgtttcttg
tcttacttttggaagagaaacagttctagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB270539_C_P-D Feature FT:CDS AB270539_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL200F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtactaatttggaagatccggca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270540_C_P-D Feature FT:CDS AB270540_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL241F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcggctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgtctctagccacctgggtgggtggtaatttagaagatccagta
tccagggacctagtagtcggttatgttaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcactttcggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB270541_C_P-D Feature FT:CDS AB270541_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL47F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cgctcaggcaagcaattctttgctggggggatctaatcaatctatccacctgggtgggtggtaatttagaagatcaaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcactttcggaagagatacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttga
>gnl|hbvcds|AB270542_C_P-D Feature FT:CDS AB270542_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL12F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccatataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcatggttcagctcaccatactg
cactcaggcaagcaattctatgctggggggacttaatgactctagccacctgggtgggtggtaatttagaagatccaaca
tctagggacctngtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB270543_C_P-D Feature FT:CDS AB270543_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL209F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270546_C_P-D Feature FT:CDS AB270546_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL88F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagacaccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcgcctcaccataccg
cactcaggcaagcaactatttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagcaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270547_C_P-D Feature FT:CDS AB270547_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL295F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggggatctaataactctatccacctgggtgggtggtaatttagaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270548_C_P-D Feature FT:CDS AB270548_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL207F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270549_C_P-D Feature FT:CDS AB270549_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL79F). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgattcttataaagaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtcgttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggacccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB270550_C_P-D Feature FT:CDS AB270550_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL247F). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctctgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttggttatgttaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttataggc
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccaactgttag
>gnl|hbvcds|AB330367_C_P-D Feature FT:CDS AB330367_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ14HBV). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagc
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcttctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacacacttgatctagccacctgggtgggtggtaatttggaagatcaagca
tccagggacctagtagtcaattatgttaacactaagatgggcctaaagttcaggcaactattatggtttcacgtttcttg
tctcacttttggaagacaaattgtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaatgcttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB330369_C_P-D Feature FT:CDS AB330369_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ5HBV). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB330370_C_P-D Feature FT:CDS AB330370_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ6HBV). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB355452_C_P-D Feature FT:CDS AB355452_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcatttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
ccctcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggagttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactcttgtggtttcacatttcttg
cctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaacgttag
>gnl|hbvcds|AB355456_C_P-D Feature FT:CDS AB355456_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 07UC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggagttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactcttgtggtttcacatttcttg
cctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaacgttag
>gnl|hbvcds|AB471856_C_P-D Feature FT:CDS AB471856_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471857_C_P-D Feature FT:CDS AB471857_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB493846_C_P-D Feature FT:CDS AB493846_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17UC). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcatttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggagttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactcttgtggtttcacatttcttg
cctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB555496_C_P-D Feature FT:CDS AB555496_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactcatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tcttacttttggaagagaaacggttatagagaacatggtgtctttcggagtgtggattcgctctcctccagctaatagac
caccaaatgcccctatcttatcaacacttctggagactgctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctgtatgttag
>gnl|hbvcds|AB555497_C_P-D Feature FT:CDS AB555497_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctggtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
cctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgctctcctcaagcttatagac
caccaaatgcccctatcttatcaacacttctggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB555500_C_P-D Feature FT:CDS AB555500_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA64). Complete genome. [Hepadnaviridae] (length=552 residues).
aaggaccttgacccttataaagaatttggagctagtgtgactttactctcgtttttgcctgcttacttcttcccttccgt
accagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcatgtttcagctcaccacactg
cactcaggcaagcaattctttgctggggggacttaatgaatctagctacctgggtgggtactaatttggacgatcccgca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacctttcttg
tctcacrtttggaagaccaacggtcatggagtttttggtgtctttcggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttattagacaasgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgtgtcgcagaagatctcaatctcgggacgcccaatgctag
>gnl|hbvcds|AB555501_C_P-D Feature FT:CDS AB555501_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA65). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttatataagaattggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgtacacctcaccataccg
cactcaggcaagcaattctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccatca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcagttattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatatggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|AB583680_C_P-D Feature FT:CDS AB583680_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pkst7912). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674403_C_P-D Feature FT:CDS AB674403_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD87). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacgcctcaccatactg
cactcaggcaagcaattctttgctggggggacctaacaactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagtttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcgggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674404_C_P-D Feature FT:CDS AB674404_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE39). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcactgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtggtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggycccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674405_C_P-D Feature FT:CDS AB674405_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraHCCA12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AB674406_C_P-D Feature FT:CDS AB674406_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB23). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagta
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674407_C_P-D Feature FT:CDS AB674407_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674408_C_P-D Feature FT:CDS AB674408_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD83). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctttatatcggcaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674410_C_P-D Feature FT:CDS AB674410_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD27). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcatgtatttctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagatacggtccttgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674411_C_P-D Feature FT:CDS AB674411_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD84). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
aagagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|AB674413_C_P-D Feature FT:CDS AB674413_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccctagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactatgctggggggacctaatgaacttagctacctgggtgggtggtaatttgcaagatccagta
tccagggaccaagtagttggttatgtcaacactactgtgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|AB674415_C_P-D Feature FT:CDS AB674415_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC24). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactgtcttttttgcctgagaacttctatccttcaat
acgagatcttctagataccgcctcagccctatatcgggatgccttggaatctcctgagcactgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagctacctgggtgggtggtaatttacaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacayttcttg
tctcacttttggaagagacacggttttagaatatttggtgtctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB674416_C_P-D Feature FT:CDS AB674416_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtcgagttactctcttttttgcctgatgacttctttccttctgc
acgagatctgcttgataccgccacagctctatatcgggaagccttagagtctcaggagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgtctttagccacctgggtgggtggtaatttggaagatcaaaga
tccagggacctagtagtcacttatgttaacgctaatatgggcataaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtgatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagagtactgttattagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB674417_C_P-D Feature FT:CDS AB674417_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraLCE1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctgcagt
acgagatcttctagataccgcctcagctytatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcatgtctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaga
tccagggacctagtagtcagttatgttaacactaatatgggcctcaagttcaggcaactattgtggtttcacatttcttg
tctcacgtttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaccaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674418_C_P-D Feature FT:CDS AB674418_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctgcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggatctaatgactttagccacctgggtgggtggtaatttggaagatccaaga
tccagggacctagtagtcagttatgttaacactaatatgggcctcaagttcaggcaactattgtggtttcacatttcttg
tctcacgtttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaccaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674419_C_P-D Feature FT:CDS AB674419_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaatactatgctggggggaattaatgtctctagccacctgggtgggtggcaatttagacgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB674420_C_P-D Feature FT:CDS AB674420_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunLCD2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagctttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcgtg
tctcacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB674423_C_P-D Feature FT:CDS AB674423_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgtcgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctgggggaaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttccggcaattattgtggtttcacacttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caacaaatgcccctatcttatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB674424_C_P-D Feature FT:CDS AB674424_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgagatgccttagactctcctgaacattgtactcctcaccatactg
cactcaggcaagcaattttgtgctggggggaactaatgactctagctacctgggtgggtggtaatttgcaagatccaaca
tccagggacctagtagtcacttatgtcaacaccaatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaactcttccggagacttctgttattagatccagaagcagggcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674425_C_P-D Feature FT:CDS AB674425_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctctggcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtcycaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674426_C_P-D Feature FT:CDS AB674426_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD50). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttacagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgwctctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674427_C_P-D Feature FT:CDS AB674427_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD54). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacmttgatccttataaagaatttggagctwctgtggagttactctcgtttttgcctcttgacttctatccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcaccacatcatactg
cactcaggcaagcaattctatgctggggggacttaatgaatctagctacctgggtgggtagtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaaaagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttaa
>gnl|hbvcds|AB674428_C_P-D Feature FT:CDS AB674428_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcagttctgtgctggggggaattaataactctatctacttgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctgaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagggaagtagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacccagatgttag
>gnl|hbvcds|AB674429_C_P-D Feature FT:CDS AB674429_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD89). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtggtaatttgcaagatccagta
tccagggacctagtagtcaggtatgtcaacactaatatgggcctaaagtttcggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674430_C_P-D Feature FT:CDS AB674430_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC2). Partial genome (Contains: HBe, HBc, HBx). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgagatgctttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattttgtgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtaagttatgtcaacactactgcgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB674431_C_P-D Feature FT:CDS AB674431_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctgtatcgggaagctttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattttgtgctggggggaactaatgactctagctacctgggtgggtggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcatcacttccggagacttgtgttgttagacgacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB674435_C_P-D Feature FT:CDS AB674435_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB24). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagaccttctagacaccgcctcagctctgtatcgggaagccttggagtctcctgagcattgttcacctcaccatactg
cactcaggcatgtaattttgtgctggggggacctaacgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AB716760_C_P-D Feature FT:CDS AB716760_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 11999_C). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
ttggtcatgggccatcataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagstcttctagataccgcctcagctatatatcgggaagccttagartctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactratatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF043593_C_P-D Feature FT:CDS AF043593_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6/89). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagctaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcctatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF043594_C_P-D Feature FT:CDS AF043594_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1/91). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcttttttgcctcatgacttctttccttcagt
acgagatcttctagataccgcctcagctctctttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagctaatttgcaagatccagca
tctagggagctagttgttacttatgtcaacattaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcctatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121239_C_P-D Feature FT:CDS AF121239_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1303). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caacaaatgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AF121240_C_C-D Feature FT:CDS AF121240_C_C-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/11066). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AF121241_C_P-D Feature FT:CDS AF121241_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1758). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AF121242_C_P-D Feature FT:CDS AF121242_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1218). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataggc
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AF151735_C_P-D Feature FT:CDS AF151735_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF280817_C_P-D Feature FT:CDS AF280817_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-D1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggccacctgggtgggtggtaatttagaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324108_C_P-D Feature FT:CDS AF324108_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0052). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcgcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaaatttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcaggcgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324109_C_P-D Feature FT:CDS AF324109_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0062). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcgcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaaattaaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324110_C_P-D Feature FT:CDS AF324110_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0076). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcgcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttggtggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaaatttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtcacaatcgccgggtcgcagaagatctcaatctcgggcatctcaatgttag
>gnl|hbvcds|AF324111_C_P-D Feature FT:CDS AF324111_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0081). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaaccctttgctggggggagctaatgactctagctacctgggtgggtgctaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacaataatatgggcctaaagttcaggcaactattgtggtttcacatttcgtg
tctcacttttggaagagacacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
cacctaatgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AF324113_C_P-D Feature FT:CDS AF324113_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0094). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcgcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tcaaggaccctagtggtcagttatgttaacactaatatgggcctaaaatttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324114_C_P-D Feature FT:CDS AF324114_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0018). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcgcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaaatttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324115_C_P-D Feature FT:CDS AF324115_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0098). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacttagtggtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324116_C_P-D Feature FT:CDS AF324116_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 0123). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttcttccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcgcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaaatttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324132_C_P-D Feature FT:CDS AF324132_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8.25). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatc
tccagggacctagtagtcagttatgttaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatctggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324138_C_P-D Feature FT:CDS AF324138_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I39). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcctaaagttcagacaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324141_C_P-D Feature FT:CDS AF324141_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I55). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419512_C_P-D Feature FT:CDS AF419512_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I10-Fam C). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaactctttgctggggggaactaatgactctggctacctgggtgggagctaatttggaagatcaagca
tctagggacctagttgttagttatgtcaacactcatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419516_C_P-D Feature FT:CDS AF419516_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I1-Fam A). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaataactctatccacctgggtgggtggtaatttggaagatccaaca
tcccgggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419521_C_P-D Feature FT:CDS AF419521_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I28-fam F). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattatttgctggggggaactgatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcacttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaattcccctatcctatcaacgcttccggagactgctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419522_C_P-D Feature FT:CDS AF419522_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I2-Fam A). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgtctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcgattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tcccgggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacctttcttg
tctcacttttggaagagacacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaatacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419523_C_P-D Feature FT:CDS AF419523_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I31-Fam F). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtttctgcaagccttagagtctcctgagcactgttcacctcaccatactg
caatcaggcaagcagttctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccatca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaatagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaattcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419524_C_P-D Feature FT:CDS AF419524_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I3-Fam A). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcgattctttgctggggggacttaataactctatccacctgggtgggtggtaatttggatgatccaaca
tcccgggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagacaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419526_C_P-D Feature FT:CDS AF419526_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I44-Fam G). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactc
gactcaggcaagcaatactttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419527_C_P-D Feature FT:CDS AF419527_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I45-Fam G). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttccgtggagttactctcctttttgccttctgacttctttccttcggt
acgagatctcttagataccgcctcagctctgtatcgggaagccttagagcctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactgatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtaggcagctatgtcaacactcatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacagttgtacagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaatgcttccggagacttgtgttgttagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419528_C_P-D Feature FT:CDS AF419528_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I47-Fam G). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatctcctagataccgccaaagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatacgg
cagtcaggcaagcaattctctgctggggggaattaatgaatctagctacctgggtgggtgttaatttggaagatcaatca
tctagagacctcgtagtcagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419529_C_P-D Feature FT:CDS AF419529_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I49-Fam H). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcagtactatgctggggggacctaatgactctagctacctgggtgggtgctaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaagcagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419530_C_P-D Feature FT:CDS AF419530_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I4-Fam A). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatctgctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatcctaca
tcccgggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419532_C_P-D Feature FT:CDS AF419532_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I51-Fam H). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggatattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaatactttgctggggggaactaatgactctagctacctgggtgggtgctaatttggacgatccagca
tctagggacctagtagtcagttatgtcaacaataatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419537_C_P-D Feature FT:CDS AF419537_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I8-Fam C). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagctacctgggtgggagctaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactcatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419538_C_P-D Feature FT:CDS AF419538_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I9-Fam C). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagctaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactcatatgggcctaaagatcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagagtatttcgtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatccacacttccggagactactgttattagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419539_C_P-D Feature FT:CDS AF419539_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I62-Fam I). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacgttgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactttgctggggggacttaatgaatctagctacctgggtaggtgttaatttgcaagatcaagca
tctagggaactagtagtcaattatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagagacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagagggcgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419540_C_P-D Feature FT:CDS AF419540_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I75-Fam M). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttcggcaactcttgtggtttcacatttcttg
tctcacttttggaagagacacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419542_C_P-D Feature FT:CDS AF419542_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I77-Fam I). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttcggcaactcttgtggtttcacatttcttg
tctcacttttggaagagacacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ131956_C_P-D Feature FT:CDS AJ131956_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tccagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ344116_C_P-D Feature FT:CDS AJ344116_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBsAg negative patient GX27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttgctctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagaggaacggtcattgagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627215_C_P-D Feature FT:CDS AJ627215_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 06115). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgcttctgtggagttactctcgtttttgccttctgacttttttccttccgt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtcttctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgtccctaggtacctgggtgggtggtaatttggaagatcaagca
tctagggacctagtagtcaattatgtcaactctaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccatcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|AJ627216_C_P-D Feature FT:CDS AJ627216_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17707). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgcttctgtggagttactctcgtttttgccttctgacttttttccttccgt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtcttctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgtccctaggtacctgggtgggtggtaatttggaagatcaagca
tctagggacctagtagtcaattatgtcaactctaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccatcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|AJ627218_C_P-D Feature FT:CDS AJ627218_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 21116). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgcttctgtggagttactctcgtttttgccttctgacttttttccttccgt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtcttctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgtccctaggtacctgggtgggtggtaatttggaagatcaagca
tctagggacctagtagtcaattatgtcaactctaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccatcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|AJ627219_C_P-D Feature FT:CDS AJ627219_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 24039). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttccgt
acgagatcttctagataccgccacagctctgtatcggaatgccttagagtctcctgagcattgttcasctcaccatactg
cactcaggcaagcaattctttgctggggagatctaataaatctatctacctgggtgggtactaatttagaagatccggca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaagytgtactagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627220_C_P-D Feature FT:CDS AJ627220_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 29234). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtgagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627222_C_P-D Feature FT:CDS AJ627222_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 31228). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatygacccttataaagaatttggagcttctgtgcagttactctcgtttttgcctgccgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacatcaccatacgg
cactcaggcaagcaattctttgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcgtagagtatttggtgtcwttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgmagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627223_C_P-D Feature FT:CDS AJ627223_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33720). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtaagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627224_C_P-D Feature FT:CDS AJ627224_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33852). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctagtgtcgagttactctcgtttttgccttctgacttctttcctaacgt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcgcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggacgatcaaaca
tccagggacctagtagttagttatgttaacaccaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM422939_C_P-D Feature FT:CDS AM422939_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgaggtcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagggaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY090452_C_P-D Feature FT:CDS AY090452_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgc
acgagatcttctagataccgccgcagctctctatcgggaagccttagagtctcctgaacattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggcgaactaatgactctagctacctgggtgggtggtaatttggaagatcaagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaaatgttgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagtgtactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaactcaatgttag
>gnl|hbvcds|AY090453_C_P-D Feature FT:CDS AY090453_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcagctcatcatacag
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161150_C_P-D Feature FT:CDS AY161150_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161151_C_P-D Feature FT:CDS AY161151_C_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161152_C_P-D Feature FT:CDS AY161152_C_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161153_C_P-D Feature FT:CDS AY161153_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161154_C_P-D Feature FT:CDS AY161154_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161155_C_P-D Feature FT:CDS AY161155_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161156_C_P-D Feature FT:CDS AY161156_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161157_C_P-D Feature FT:CDS AY161157_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacactgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagaccactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161158_C_P-D Feature FT:CDS AY161158_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctatatcgggaagctttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cgccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagagctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161159_C_P-D Feature FT:CDS AY161159_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaataactctatctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161160_C_P-D Feature FT:CDS AY161160_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaataactctatctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY230112_C_P-D Feature FT:CDS AY230112_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY230114_C_P-D Feature FT:CDS AY230114_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233291_C_P-D Feature FT:CDS AY233291_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 179). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgaccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233292_C_P-D Feature FT:CDS AY233292_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 184). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcggt
ccgtggccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatacag
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagtttaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233294_C_P-D Feature FT:CDS AY233294_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 305). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtggccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagtttaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233296_C_P-D Feature FT:CDS AY233296_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 185). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcatttttgccttctgacttctttccttcagt
acgtggccttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagatctagtagtcagttatgtcaacactaatatgggcctaaagtttaggcaactcttgtggtttcatatttcttg
tctcacttttggaagagaaacagttattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY236160_C_P-D Feature FT:CDS AY236160_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1A). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtgtcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY236162_C_P-D Feature FT:CDS AY236162_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 23A). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactg
cactcaagcaagcaattctttgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcccccagcttatagac
cgccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY236164_C_P-D Feature FT:CDS AY236164_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 30). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgaattctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ctctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY350614_C_P-D Feature FT:CDS AY350614_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR38). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371901_C_P-D Feature FT:CDS AY371901_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:48). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371902_C_P-D Feature FT:CDS AY371902_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:15). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371904_C_P-D Feature FT:CDS AY371904_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:14). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcacgcaagcaattctttgctggggggacctaatgacccttgccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaaattcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgttgattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY371905_C_P-D Feature FT:CDS AY371905_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:35). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371906_C_P-D Feature FT:CDS AY371906_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:28). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcgcctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaataactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctaatggtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagacacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371907_C_P-D Feature FT:CDS AY371907_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:56). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY371908_C_P-D Feature FT:CDS AY371908_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:18). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaataactctatctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371909_C_P-D Feature FT:CDS AY371909_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:13). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cagtcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggcaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaaatattgtggtttcacatttcttg
tctcacgtttggaagagaaacggtcttagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagaccccgaagcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY371910_C_P-D Feature FT:CDS AY371910_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:59). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatttcggcaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgtctttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371911_C_P-D Feature FT:CDS AY371911_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:23). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttatgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctatctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371912_C_P-D Feature FT:CDS AY371912_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:45). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctaaaagaaaaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY371913_C_P-D Feature FT:CDS AY371913_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:8). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtcgagttagtctcttttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcactgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttggccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY371914_C_P-D Feature FT:CDS AY371914_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:19). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371915_C_P-D Feature FT:CDS AY371915_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:12). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcttctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaattactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacacttcttg
tctcacttttggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcttatcaacacttccggagactgctgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371916_C_P-D Feature FT:CDS AY371916_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:51). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcatttctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY371917_C_P-D Feature FT:CDS AY371917_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:53). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggaccttgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caacaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371918_C_P-D Feature FT:CDS AY371918_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:42). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctgaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371919_C_P-D Feature FT:CDS AY371919_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:20). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcggggatctcaatgttag
>gnl|hbvcds|AY371920_C_P-D Feature FT:CDS AY371920_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:22). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ccctcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371921_C_P-D Feature FT:CDS AY371921_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:21). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY371922_C_P-D Feature FT:CDS AY371922_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR:40). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY373431_C_P-D Feature FT:CDS AY373431_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaataactctatctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603427_C_P-D Feature FT:CDS AY603427_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 12T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggatctagtagttagttatgtcaacactaatatgggcctaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603428_C_P-D Feature FT:CDS AY603428_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 13T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcctaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603433_C_P-D Feature FT:CDS AY603433_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 26T). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatattg
cactcaggcaagcaattctttggtggggggacctaatgactctagctacctgggtgggagttaatttagaagatccagca
tctagggacctagttgttagttatgtcaacactaatgtgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggccggtgccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603434_C_P-D Feature FT:CDS AY603434_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 30T). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603437_C_P-D Feature FT:CDS AY603437_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagctatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603439_C_P-D Feature FT:CDS AY603439_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 40T). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcagggcccctagaagaagaact
ccctcgaatcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603440_C_P-D Feature FT:CDS AY603440_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 58T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttagaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603443_C_P-D Feature FT:CDS AY603443_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 02T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttagaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603445_C_P-D Feature FT:CDS AY603445_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 09T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagctactgtggagttactctcgttttcgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttagaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcagacaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY661792_C_P-D Feature FT:CDS AY661792_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ayw). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgaacattgttctcctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY661793_C_P-D Feature FT:CDS AY661793_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgaacattgttctcctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY721605_C_P-D Feature FT:CDS AY721605_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AK1.1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctataccgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggcggtaatttggaagatccaata
tccagagacctagtagtcagtcatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtttctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY721606_C_P-D Feature FT:CDS AY721606_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AT1.2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY721607_C_P-D Feature FT:CDS AY721607_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HIY1.3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY721608_C_P-D Feature FT:CDS AY721608_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IB1.4). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY721609_C_P-D Feature FT:CDS AY721609_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA1.5). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccttcagt
acgtgatcttctagatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY721610_C_P-D Feature FT:CDS AY721610_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FK1.6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcgttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY721611_C_P-D Feature FT:CDS AY721611_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SK1.7). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctaatagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcgttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY721612_C_P-D Feature FT:CDS AY721612_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BL1.8). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY741794_C_P-D Feature FT:CDS AY741794_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-50). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcacaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY741795_C_P-D Feature FT:CDS AY741795_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-Hi). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY741796_C_P-D Feature FT:CDS AY741796_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY741797_C_P-D Feature FT:CDS AY741797_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-21). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctggaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY741798_C_P-D Feature FT:CDS AY741798_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttcctgcagt
acgagatcttttagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgtctctagctacctgggtgggtggtaatttggaagatcaacaa
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY796030_C_P-D Feature FT:CDS AY796030_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FC1.9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY796031_C_P-D Feature FT:CDS AY796031_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RA1.10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataacgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactttgctggggggacttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtaagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AY796032_C_P-D Feature FT:CDS AY796032_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NA1.11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgaatctagccacctgggtgggtagtaatttggatgatccaaca
tccagggaccaagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaggtagttttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY945307_C_P-D Feature FT:CDS AY945307_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ111986_C_P-D Feature FT:CDS DQ111986_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MBT181). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggagttaatgactctagccacctgggtgggtggtaatttggaagatccaana
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctatagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacnacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ178011_C_P-D Feature FT:CDS DQ178011_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Afgh-3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acaagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtattcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggcttcacacttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ178012_C_P-D Feature FT:CDS DQ178012_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Afgh-4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acaagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtaatcagttatgtcaacactaatatgggcctaaaattcaggccactattgtggtttcacatttcttg
tctcaattttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ178015_C_P-D Feature FT:CDS DQ178015_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Afgh-7). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acaagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatatcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttttagac
caccgaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ178016_C_P-D Feature FT:CDS DQ178016_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Afgh-8). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acaagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacccaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ178017_C_P-D Feature FT:CDS DQ178017_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Afgh-9). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaaatattgtggtttcacatttcttg
tctcacttttggaagagaaacggttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcgacacttccggagactactgttgttagacgacgaggcaggtcccctagaaaaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ178018_C_P-D Feature FT:CDS DQ178018_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Afgh-10). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acaagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ178019_C_P-D Feature FT:CDS DQ178019_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Afgh-11). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acaagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccagagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ178020_C_P-D Feature FT:CDS DQ178020_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Afgh-12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acaagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaccactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ304547_C_P-D Feature FT:CDS DQ304547_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaaca
tccagggatctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcgcttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ304548_C_P-D Feature FT:CDS DQ304548_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cgccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ctctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ304549_C_P-D Feature FT:CDS DQ304549_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ctctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ304550_C_P-D Feature FT:CDS DQ304550_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ304551_C_P-D Feature FT:CDS DQ304551_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|DQ315776_C_P-D Feature FT:CDS DQ315776_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI00615). Complete genome. [Hepadnaviridae] (length=552 residues).
atagacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ315778_C_P-D Feature FT:CDS DQ315778_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI0388). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcttt
tcgagatcttctcgataccgcctctgctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagctattctgtgctggggggacttgataaatctatctacctgggtgggaagtaatttggaagatccagca
tccagggacttagtagtcagctatgtcaatactaacatgggcctaaagctcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ329356_C_P-D Feature FT:CDS DQ329356_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggagagatctaatgactctagctacctcggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtgccttcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgctagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcggcggagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ329357_C_P-D Feature FT:CDS DQ329357_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgttggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaagggctcaatcgccgcggcggagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336674_C_P-D Feature FT:CDS DQ336674_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336675_C_P-D Feature FT:CDS DQ336675_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336676_C_P-D Feature FT:CDS DQ336676_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336677_C_P-D Feature FT:CDS DQ336677_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggacgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336678_C_P-D Feature FT:CDS DQ336678_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336679_C_P-D Feature FT:CDS DQ336679_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336680_C_P-D Feature FT:CDS DQ336680_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgatcattgcacacctcaccacactg
cactaaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggatctagtagtcagttatgtaaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcacagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttag
>gnl|hbvcds|DQ336681_C_P-D Feature FT:CDS DQ336681_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcagctcaccacactg
cactaaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtaaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcacagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttag
>gnl|hbvcds|DQ336682_C_P-D Feature FT:CDS DQ336682_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgatcattgcacacctcaccacactg
cactaaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggatctagtagtcagttatgtaaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcacagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttag
>gnl|hbvcds|DQ336683_C_P-D Feature FT:CDS DQ336683_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgatcattgcgcacctcaccacactg
cactaaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggatctagtagtcagttatgtaaacactaatatgggcctaaagttcaggcacctattgtggtttcacatttcttg
tctcacttttggaagagacacggtcaaagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336684_C_P-D Feature FT:CDS DQ336684_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcctctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgatcattgcacacctcaccacactg
cactaaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggatctagtagtcagttatgtaaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcacagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttag
>gnl|hbvcds|DQ336685_C_P-D Feature FT:CDS DQ336685_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctccttgttag
>gnl|hbvcds|DQ336686_C_P-D Feature FT:CDS DQ336686_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagctactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggacgccttagagtcttccgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336687_C_P-D Feature FT:CDS DQ336687_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgcgatcttctagataccgcctcagctctgtttcgggacgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336688_C_P-D Feature FT:CDS DQ336688_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttccttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tcccacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336689_C_P-D Feature FT:CDS DQ336689_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ctctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336690_C_P-D Feature FT:CDS DQ336690_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tcccacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataaac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336691_C_P-D Feature FT:CDS DQ336691_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggggttactctcgtttttgccttctgacttctatccttcagt
acgcgatcttctagataccgcctcagctctgtttcgggacgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaacttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ336692_C_P-D Feature FT:CDS DQ336692_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttccttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ399006_C_P-D Feature FT:CDS DQ399006_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate G1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtaccgggatgccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagtttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|DQ464168_C_P-D Feature FT:CDS DQ464168_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggttccacatttcttg
tctcacttttggaggagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464169_C_P-D Feature FT:CDS DQ464169_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464170_C_P-D Feature FT:CDS DQ464170_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgcagggggggactaaagactctagctacctgggtgggtgttaatttggaagcgccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatggtag
>gnl|hbvcds|DQ464172_C_P-D Feature FT:CDS DQ464172_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgccttagctctgtttcgggacgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctacaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcaggaatctcactgttag
>gnl|hbvcds|DQ464173_C_P-D Feature FT:CDS DQ464173_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgttttcgccttctgacttctatccttcagt
acaagatcttctagataccgccttagctctgtttcgggacgccttagatgctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464174_C_P-D Feature FT:CDS DQ464174_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctcgctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464175_C_P-D Feature FT:CDS DQ464175_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcgttgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggcgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaagcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464176_C_P-D Feature FT:CDS DQ464176_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctacataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaatagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464177_C_P-D Feature FT:CDS DQ464177_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctgggggaatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464178_C_P-D Feature FT:CDS DQ464178_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctggctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464181_C_P-D Feature FT:CDS DQ464181_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S3). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctccggagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcgtaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagacacggtcctagagtatttggtgtccttcggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ464182_C_P-D Feature FT:CDS DQ464182_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctttgctggggggaactaatgactttagccacatgggtgggtggtaatttggaagatccaaca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatggtag
>gnl|hbvcds|DQ486021_C_P-D Feature FT:CDS DQ486021_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagatgctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ486022_C_P-D Feature FT:CDS DQ486022_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT11). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgaattctatccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ctctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ486023_C_P-D Feature FT:CDS DQ486023_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttactaaatctatccacatgggtgggtggaaatttgcaagatcaaaca
tccagggacctagtagtcacttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcatgtttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactagtgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgaagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ486025_C_P-D Feature FT:CDS DQ486025_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattggtcaccgcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103275_C_P-D Feature FT:CDS EF103275_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccataccg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103276_C_P-D Feature FT:CDS EF103276_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103277_C_P-D Feature FT:CDS EF103277_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran33). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103279_C_P-D Feature FT:CDS EF103279_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran99). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103280_C_P-D Feature FT:CDS EF103280_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran100). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagagacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103281_C_P-D Feature FT:CDS EF103281_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran102). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatcgttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccgata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU155893_C_P-D Feature FT:CDS EU155893_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacagctcttgtggtttcacatttcttg
tctcacttttggaagaaatacagttatagagtatttggtgtctttcggggtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaggttgctgttgttagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU155895_C_P-D Feature FT:CDS EU155895_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5b). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccttcggt
tcgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU185779_C_P-D Feature FT:CDS EU185779_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H-IDU6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=550 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagca
tctagagacctagtagtcggttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tcttacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtt
>gnl|hbvcds|EU414054_C_P-D Feature FT:CDS EU414054_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagacccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414055_C_P-D Feature FT:CDS EU414055_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggkgggcggtaatttggaagatccagta
tctagagacctagtagtcagttatgtcaacactaatgtgggcctaaagtttaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414056_C_P-D Feature FT:CDS EU414056_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcarctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggcgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagawacarttataraatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcrcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414057_C_P-D Feature FT:CDS EU414057_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctctgctggggggaactaatgactctagctacctgggtgggtgttaatctggaagacccagca
tctagggacctagtagtcagctatgtcaacactaatatgggcctaaagttcagacaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatarac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcrtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414058_C_P-D Feature FT:CDS EU414058_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggatctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414059_C_P-D Feature FT:CDS EU414059_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttaragtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactttgctggggggaactaatgactctrgccacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaamt
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414060_C_P-D Feature FT:CDS EU414060_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414061_C_P-D Feature FT:CDS EU414061_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggkgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatarac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414135_C_P-D Feature FT:CDS EU414135_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagacccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414136_C_P-D Feature FT:CDS EU414136_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
acgagatctgctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414138_C_P-D Feature FT:CDS EU414138_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggkgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatarac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414139_C_P-D Feature FT:CDS EU414139_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttaragtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactttgctggggggaactaatgactctrgccacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaamt
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414140_C_P-D Feature FT:CDS EU414140_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414141_C_P-D Feature FT:CDS EU414141_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcarctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggcgtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagawacarttataraatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcrcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414142_C_P-D Feature FT:CDS EU414142_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggkgggcggtaatttggaagatccagta
tctagagacctagtagtcagttatgtcaacactaatgtgggcctaaagtttaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414143_C_P-D Feature FT:CDS EU414143_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctctgctggggggaactaatgactctagctacctgggtgggtgttaatctggaagacccagca
tctagggacctagtagtcagctatgtcaacactaatatgggcctaaagttcagacaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatarac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcrtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594382_C_P-D Feature FT:CDS EU594382_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggcgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594396_C_P-D Feature FT:CDS EU594396_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594397_C_P-D Feature FT:CDS EU594397_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594398_C_P-D Feature FT:CDS EU594398_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctttcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatctacctgggtgggagctaatttggaagatccagca
tctagggatctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594399_C_P-D Feature FT:CDS EU594399_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttggggtttcacatttcttg
tctcacttttggaaaagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594400_C_P-D Feature FT:CDS EU594400_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594401_C_P-D Feature FT:CDS EU594401_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594402_C_P-D Feature FT:CDS EU594402_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594403_C_P-D Feature FT:CDS EU594403_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594404_C_P-D Feature FT:CDS EU594404_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggccttaagttcaggcaacttttgtggtttcacacttcttg
tctcacttttggaagagacacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|EU594405_C_P-D Feature FT:CDS EU594405_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594407_C_P-D Feature FT:CDS EU594407_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgcgatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594408_C_P-D Feature FT:CDS EU594408_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594409_C_P-D Feature FT:CDS EU594409_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594410_C_P-D Feature FT:CDS EU594410_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594411_C_P-D Feature FT:CDS EU594411_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU594412_C_P-D Feature FT:CDS EU594412_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU594415_C_P-D Feature FT:CDS EU594415_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594416_C_P-D Feature FT:CDS EU594416_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594421_C_P-D Feature FT:CDS EU594421_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttatggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594422_C_P-D Feature FT:CDS EU594422_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagctcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgacgctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594423_C_P-D Feature FT:CDS EU594423_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594424_C_P-D Feature FT:CDS EU594424_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594425_C_P-D Feature FT:CDS EU594425_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594426_C_P-D Feature FT:CDS EU594426_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcactgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggatctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594427_C_P-D Feature FT:CDS EU594427_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgcgatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594428_C_P-D Feature FT:CDS EU594428_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594430_C_P-D Feature FT:CDS EU594430_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594431_C_P-D Feature FT:CDS EU594431_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594432_C_P-D Feature FT:CDS EU594432_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594433_C_P-D Feature FT:CDS EU594433_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594434_C_P-D Feature FT:CDS EU594434_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtcgagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctctgctggggggaattaatgactctagctacctgggtgggtggtaatttggacgacccaaca
tctagggacctagtagtcagctatgtcaacactaatatgggcctaaagttcagacaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726844_C_P-D Feature FT:CDS EU726844_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3556). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagccattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726845_C_P-D Feature FT:CDS EU726845_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7061). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtaccgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtgggaatttggaaaatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726847_C_P-D Feature FT:CDS EU726847_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3251). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactttagccacctgggtgggtggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagatacagttgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726848_C_P-D Feature FT:CDS EU726848_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-5778). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatcctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggatgatccaaca
tctagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcctg
tctcacttttggaagacaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726849_C_P-D Feature FT:CDS EU726849_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4672). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
caacaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726850_C_P-D Feature FT:CDS EU726850_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6834). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagacacggttgtagagtatttggtatctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726853_C_P-D Feature FT:CDS EU726853_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7182). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcatttctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726854_C_P-D Feature FT:CDS EU726854_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3173). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726855_C_P-D Feature FT:CDS EU726855_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7179). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctttgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattttgtgctggggggatttaataaatctaagtacctgggtgggtggaaatttggaagatcaaaca
tccagggacctaatagtcaattatgtcaactctaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaactgttatagagtatttggtgtctttcggagtgtggattcgcactcctcaaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726856_C_P-D Feature FT:CDS EU726856_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4450). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattcatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU726857_C_P-D Feature FT:CDS EU726857_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7114). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726858_C_P-D Feature FT:CDS EU726858_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3252). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttccgt
acgagatcttctagataccgcctcagctttgtatcgggacgccttagagtctcctgagcattgcacaccacatcatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggaaatttgcaagatccagta
tccagggacctagtagtcagttatgttaacaccaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaagtagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caacaaatgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726859_C_P-D Feature FT:CDS EU726859_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7075). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatctgctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactttatccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattatggtttcacatttcttg
tctcacttttggaagagaagtggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726860_C_P-D Feature FT:CDS EU726860_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3172). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaataactttatccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacagtcatagagtatttggtgtctttcggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726861_C_P-D Feature FT:CDS EU726861_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7181). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttggtggggggaattaatgactctagccacctgggtgggtgataatttggaagatccaata
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaaaagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagattatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaacatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726862_C_P-D Feature FT:CDS EU726862_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7178). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726864_C_P-D Feature FT:CDS EU726864_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6822). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccgttctttgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726865_C_P-D Feature FT:CDS EU726865_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7474). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggcggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttgggagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726868_C_P-D Feature FT:CDS EU726868_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8152). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatcagaca
tccagggacctagtagtcacttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU726869_C_P-D Feature FT:CDS EU726869_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3886). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726871_C_P-D Feature FT:CDS EU726871_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7083). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcatgtctttgctggggggaattaatgactctagctacctgggtgggaactaatttagaagatcaagca
tctagggacctagtagtccagtatgtcaacactaatatgggcctgaagtttagacaactcttgtggtttcacatttcttg
tctcacttttggaagagatatcgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|EU726872_C_P-D Feature FT:CDS EU726872_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3874). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgcgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcgttgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU726873_C_P-D Feature FT:CDS EU726873_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6835). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgtacacctcaccataccg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccaata
tctagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726874_C_P-D Feature FT:CDS EU726874_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7185). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggggctactgtggagttactctcatttttgccttctgacttctttccttcagt
acgagatcttctagataccgcttcagctctatatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726875_C_P-D Feature FT:CDS EU726875_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4757). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctatttcgggatgccttagagtctcctgagcattgtacgcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgtctctggccacctgggtgggtggtaatttggaagatccaaca
tccagggacttagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacgtttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726876_C_P-D Feature FT:CDS EU726876_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7054). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccctagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggagacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726878_C_P-D Feature FT:CDS EU726878_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4955). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726879_C_P-D Feature FT:CDS EU726879_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7180). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatttagccacctgggtgggtggtaatttggaagatccagta
tccagagacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726880_C_P-D Feature FT:CDS EU726880_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6814). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctatgctggggggacctaatgactctagctacctgggtgggtagtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacaccaatgcgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726881_C_P-D Feature FT:CDS EU726881_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6826). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactactgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccgaatgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726884_C_P-D Feature FT:CDS EU726884_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6845). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgccgcagctttatatcgggaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagccattatttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcggttatgttaactctaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagtgtactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|EU726885_C_P-D Feature FT:CDS EU726885_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3170). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccaccgctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaattactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacagtcctagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|EU726886_C_P-D Feature FT:CDS EU726886_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6836). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctaatgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggtctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaaaagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU726887_C_P-D Feature FT:CDS EU726887_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4652). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726888_C_P-D Feature FT:CDS EU726888_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-N001). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726891_C_P-D Feature FT:CDS EU726891_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6847). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcggt
acgagatcttctagataccgcctcagctctatatcgggacgccttagagtctactgaacattgttcacctcaccatactg
cactcaggcaagcaattttgtgctggggggacctaattactttatccacctgggtgggtggtaatttggacgatccaaca
tccagagacctagtagtcagttatgttaacacgaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tcttacttttggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaattactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|EU726892_C_P-D Feature FT:CDS EU726892_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7077). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcggt
acgagatcttctagataccgcctcagctctgttccgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtggtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttacagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaatgcttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|EU726893_C_P-D Feature FT:CDS EU726893_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4661). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcatttctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactactgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726894_C_P-D Feature FT:CDS EU726894_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3171). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726895_C_P-D Feature FT:CDS EU726895_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6021). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726897_C_P-D Feature FT:CDS EU726897_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7563). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtcccctgagcattgttcagctcaccatacgg
cactcaggcaagcaattctatgctggggggaactaatgcagctagctacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcggttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaagtcgttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttattagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726898_C_P-D Feature FT:CDS EU726898_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4765). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726899_C_P-D Feature FT:CDS EU726899_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-0.02). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccacaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726900_C_P-D Feature FT:CDS EU726900_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7132). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaatcctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726901_C_P-D Feature FT:CDS EU726901_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-5779). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccctcggt
acgagatcttctagatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgcacaccgcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacgtctcttg
tctcacttttggaagagaaacagttgtagagtatttggtgtctttcggggtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactgctgttgttagatgccgaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726902_C_P-D Feature FT:CDS EU726902_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7145). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcgcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726904_C_P-D Feature FT:CDS EU726904_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-0.05). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcacgtatctctttgctggggggacctaatgaacttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtccttgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726905_C_P-D Feature FT:CDS EU726905_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3892). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggaaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctctcttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726906_C_P-D Feature FT:CDS EU726906_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-0.06). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagaatctcctgaacattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgaatctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726907_C_P-D Feature FT:CDS EU726907_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3861). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatcgagtatttggtatcttttggagtgtggattcgcactcctccagcttatagac
caccgaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726908_C_P-D Feature FT:CDS EU726908_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-0.07). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatctgctggataccgcctcagctctatatcgggacgccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccagtt
tccagggacttagtagtcagttatgttaacactactgcgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttagtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgatag
>gnl|hbvcds|EU726909_C_P-D Feature FT:CDS EU726909_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4653). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatcgagtatttggtatcttttggagtgtggattcgcactcctccagcttatagac
caccgaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726910_C_P-D Feature FT:CDS EU726910_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7149). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726911_C_P-D Feature FT:CDS EU726911_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7150). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaataactctatccacctgggtgggaggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726912_C_P-D Feature FT:CDS EU726912_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7063). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcttcagctctatatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctatgctggggggaactgatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtctcagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacgcttccggaggttgctgttgttagacgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|EU726914_C_P-D Feature FT:CDS EU726914_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3865). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaatcctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726917_C_P-D Feature FT:CDS EU726917_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4755). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagatacagtcatagagtatttggtatcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726918_C_P-D Feature FT:CDS EU726918_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-2336). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaatcctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726919_C_P-D Feature FT:CDS EU726919_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-0.08). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagctttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726921_C_P-D Feature FT:CDS EU726921_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L034). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacagttacagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726922_C_P-D Feature FT:CDS EU726922_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L033). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaagtagttatagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726923_C_P-D Feature FT:CDS EU726923_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L025). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726924_C_P-D Feature FT:CDS EU726924_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L002). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactcttgctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726925_C_P-D Feature FT:CDS EU726925_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L012). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcatcatactg
cactcaggcaagcaattctgtgctggggggacctaataactctatctacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|EU726926_C_P-D Feature FT:CDS EU726926_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L001). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttgcaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU726929_C_P-D Feature FT:CDS EU726929_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L035). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattctatgctggggggaattaatgtctctagccacctgggtgggtggcaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcataaagttcaggcaactattgtggtttcacatttcttg
tctcatgtttggaagagatacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726930_C_P-D Feature FT:CDS EU726930_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L013). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtaagttatgttaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726931_C_P-D Feature FT:CDS EU726931_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-9954). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccggaatctcaatgttag
>gnl|hbvcds|EU726932_C_P-D Feature FT:CDS EU726932_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-N002). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgttcggctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtggtcagttatgttaacactcatatgggactaaagttcaggcaactattgtggtttcacctttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726933_C_P-D Feature FT:CDS EU726933_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7740). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcctcatgacttctttccttccgt
gcgagatcttctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcatgtctcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgaatttagccacctgggtgggtggtaatttggaagatccacca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagatcaacggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726935_C_P-D Feature FT:CDS EU726935_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L020). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactcttgctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagacttcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726937_C_P-D Feature FT:CDS EU726937_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L003). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726938_C_P-D Feature FT:CDS EU726938_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L005). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggatattgatccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgaccattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccagta
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtattagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacgcttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaagtctcaatcgccgcgtcgcagaagaactccatctcgggaacctcaatgttag
>gnl|hbvcds|EU726940_C_P-D Feature FT:CDS EU726940_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L016). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
tcgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726941_C_P-D Feature FT:CDS EU726941_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L022). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
ctctcaggcaagcaattctttgctggggggatctaatgaatctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcggttatgttaacactactatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggttgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacgcttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726943_C_P-D Feature FT:CDS EU726943_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-6821). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagagatcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU726944_C_P-D Feature FT:CDS EU726944_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8121). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctggataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttgcaagatccagta
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacctttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|EU726945_C_P-D Feature FT:CDS EU726945_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8102). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttattagacgacaatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726946_C_P-D Feature FT:CDS EU726946_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8114). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726947_C_P-D Feature FT:CDS EU726947_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8109). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726950_C_P-D Feature FT:CDS EU726950_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3863). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaagacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|EU726951_C_P-D Feature FT:CDS EU726951_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3554). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctatgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU726952_C_P-D Feature FT:CDS EU726952_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-1927). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtacgcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggcaatttggacgatcccaca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacagctattgtggtttcacatttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU726954_C_P-D Feature FT:CDS EU726954_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-4965). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
tcgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcagctcaccatactg
cactcaggcaagcaattctttgctggggggatctaataactttatccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcttagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726957_C_P-D Feature FT:CDS EU726957_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8130). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaattactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726958_C_P-D Feature FT:CDS EU726958_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8111). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcgcttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726959_C_P-D Feature FT:CDS EU726959_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8108). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccagca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726960_C_P-D Feature FT:CDS EU726960_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8122). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726961_C_P-D Feature FT:CDS EU726961_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8232). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagttagttatgttaacactaatgtgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726962_C_P-D Feature FT:CDS EU726962_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8115). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726963_C_P-D Feature FT:CDS EU726963_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7113). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcatgtatctcaatgttag
>gnl|hbvcds|EU726964_C_P-D Feature FT:CDS EU726964_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8118). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726965_C_P-D Feature FT:CDS EU726965_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8123). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccctataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaaca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagacaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726967_C_P-D Feature FT:CDS EU726967_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3257). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgtactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726969_C_P-D Feature FT:CDS EU726969_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L023). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactacggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaataaatttatccacctgggtgggtggtaatttgcaagatccaaca
tccagagatctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaagtagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcgatgttag
>gnl|hbvcds|EU726970_C_P-D Feature FT:CDS EU726970_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L026). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgaatctagctacctgggtgggtagtaatttggaagatccaaca
tccagggacctagtagtaagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaatagttatagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726971_C_P-D Feature FT:CDS EU726971_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8142). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726972_C_P-D Feature FT:CDS EU726972_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-9550). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726973_C_P-D Feature FT:CDS EU726973_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-8124). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggatattgatccctataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttcagt
acgagatcttctagataccggctcagctctatttcgggatgccttagagtctcctgaacattgttcaccccaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaata
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caacaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU726975_C_P-D Feature FT:CDS EU726975_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L028). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctagtgtggagttactctcgtttttgcctgctgacttttttccttccgt
acgagatctcctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctatgctggggggacttaatgtctctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcggttatgtcaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagaccaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|EU726976_C_P-D Feature FT:CDS EU726976_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-L029). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726977_C_P-D Feature FT:CDS EU726977_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-7067). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattttgtgctggggggaacttatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU726979_C_P-D Feature FT:CDS EU726979_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-RCGLD-3068). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccacagctctgtatcgggatgccttagagtctcctgagcattgtactcctcaccatactg
cactcaggcaagcaattctatgttggggggaactaatgactttagccacctgggtgggtagtaatttggatgatccgacg
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacctttcttg
tctcatgtttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcgggaatctcaatgttag
>gnl|hbvcds|EU787436_C_P-D Feature FT:CDS EU787436_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 165). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactaaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtagtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787437_C_P-D Feature FT:CDS EU787437_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787438_C_P-D Feature FT:CDS EU787438_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttgcaagatccaaca
tccagggacctggtagtcacttatgttaacactaatatgggcctaaagtttagacaactattgtggtttcacatttcgtg
tctcacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|EU787439_C_P-D Feature FT:CDS EU787439_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 89). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggggggggggaatttggaagatccaata
tccagggacctaatagtcagttatgttaacactaatatgggcctaaagtttaagcaactattggggtttcacatttcttg
tctcacttttggaagaaaaacggttatagagtatttggtgtctttcggagtgtggattcccactcctccagcttataaac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagacct
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787440_C_P-D Feature FT:CDS EU787440_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787441_C_P-D Feature FT:CDS EU787441_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787442_C_P-D Feature FT:CDS EU787442_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactgatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787443_C_P-D Feature FT:CDS EU787443_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate w40). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tcaagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU787445_C_P-D Feature FT:CDS EU787445_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W51). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787446_C_P-D Feature FT:CDS EU787446_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W75). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtaagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU787447_C_P-D Feature FT:CDS EU787447_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919197_C_P-D Feature FT:CDS EU919197_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJU). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttgtaaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU921418_C_P-D Feature FT:CDS EU921418_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.165.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcatttttgccttctgatttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggagctaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagtttagacaactcttgtggtttcacctttcttg
cctcacttttggaagacaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU921419_C_P-D Feature FT:CDS EU921419_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.252.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggaggtaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactcttgtggtttcacgtttcttg
cctcacttttggaagacaaacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|EU939680_C_P-D Feature FT:CDS EU939680_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C186). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaaattcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtaccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939681_C_P-D Feature FT:CDS EU939681_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccatccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttttagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ040872_C_P-D Feature FT:CDS FJ040872_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=555 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaaga
actccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349205_C_P-D Feature FT:CDS FJ349205_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgctttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaatactttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcctgca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349206_C_P-D Feature FT:CDS FJ349206_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctccatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349208_C_P-D Feature FT:CDS FJ349208_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcctttttgcctgctgacttctttccttcggt
acgagatcttctggataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcatgcctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|FJ349209_C_P-D Feature FT:CDS FJ349209_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349211_C_P-D Feature FT:CDS FJ349211_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H34). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctccgctctgtatcgggaagccttagagtctcctgagcattgttcgcctcaccatactg
cactcaggcaagcaactctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatcaagcg
tctagagacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|FJ349213_C_P-D Feature FT:CDS FJ349213_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H59). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcctctgtggagttactctcgtttttgcctggtgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagca
tctagggacctagtagtcggctatgtcaacactaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaatagttttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacaacgacacaggtccactagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349214_C_P-D Feature FT:CDS FJ349214_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H61). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcaatca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaagtagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacgcttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349215_C_P-D Feature FT:CDS FJ349215_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H82). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tcccgggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349216_C_P-D Feature FT:CDS FJ349216_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H113). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagta
tcccgggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349217_C_P-D Feature FT:CDS FJ349217_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H129). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tcccgggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ349218_C_P-D Feature FT:CDS FJ349218_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H135). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgttggggggaactaatgactttagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaacatgggcctgaagttcaggcaactattatggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349219_C_P-D Feature FT:CDS FJ349219_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H138). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtcttctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tctcgagacctagtagtcagctatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ349220_C_P-D Feature FT:CDS FJ349220_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H144). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggatgatccaaca
tcccgggacctagtagtcagttatgtcaacaataatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ349228_C_P-D Feature FT:CDS FJ349228_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
acgggatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgttggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349229_C_P-D Feature FT:CDS FJ349229_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagatactgcatcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349230_C_P-D Feature FT:CDS FJ349230_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatcccaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349231_C_P-D Feature FT:CDS FJ349231_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
gcgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaattctgtgttggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccgaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349232_C_P-D Feature FT:CDS FJ349232_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C51). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaacatgggcctaaagttcaggcaactcttatggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349233_C_P-D Feature FT:CDS FJ349233_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C54). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349234_C_P-D Feature FT:CDS FJ349234_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C82). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattatttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|FJ349235_C_P-D Feature FT:CDS FJ349235_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C90). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ386590_C_P-D Feature FT:CDS FJ386590_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1841). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggargccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562309_C_P-D Feature FT:CDS FJ562309_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I200). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttagaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ562338_C_P-D Feature FT:CDS FJ562338_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I192). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692506_C_P-D Feature FT:CDS FJ692506_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50157). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692507_C_P-D Feature FT:CDS FJ692507_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50158). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692532_C_P-D Feature FT:CDS FJ692532_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50053). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccggca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcscctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692533_C_P-D Feature FT:CDS FJ692533_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50064). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttagaagatccggca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899792_C_P-D Feature FT:CDS FJ899792_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccatccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatatggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcgctcctccagcttttagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904395_C_P-D Feature FT:CDS FJ904395_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A10a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcggt
acgagatcttctcgataccgcctcagctctgtatcgggatgccttggagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccactctttgctggggggaactaatgcaactagctacctgggtgggagcaaatttggaagatcaaaca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcactttcggaagaccaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904399_C_P-D Feature FT:CDS FJ904399_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
acgagatgttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctcaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
catcaaatgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagwcgaaggtstcaatcgscgcgtcgcagaagatctcaatctcgggaatctcaatgtaag
>gnl|hbvcds|FJ904402_C_P-D Feature FT:CDS FJ904402_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgccggctgacttctttccttctgt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggaaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctagcagacgaaggtgtcaatcgccgcgtcgcagaagatctcaatctcgggaatcscaatgttag
>gnl|hbvcds|FJ904410_C_P-D Feature FT:CDS FJ904410_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A54b). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctcatgacttctttccttcagt
acgagatctactagataccgccactgctctgtttcgggatgcattagagtctcctgagcattgttcacctcaccataccg
cactcaggcaagccattctttgctggggggatgtaatgaatatagctacctgggtgggagtaaatttgcaagatcaagca
tcgagggaccaagtagtcaattatgtcaattctaatatgggcctaaagttcaggcagctattgtggtttcacatttcttg
cctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904412_C_P-D Feature FT:CDS FJ904412_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A56). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcactttgggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccatatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904415_C_P-D Feature FT:CDS FJ904415_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A63). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagccacctgggtgggtggtaatttggatgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagcattctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcgtagcagtcgaaggtgtcaatcggcgggtagcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904418_C_P-D Feature FT:CDS FJ904418_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A69a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttctgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggacttaatgaatctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcggttatgttaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcactttcggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904419_C_P-D Feature FT:CDS FJ904419_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A70). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagctattctttgctggggggaactactgtctctatctacctgggtgggagtaaatttggacaatcaagca
tctagggacctagtagtcggttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagaganaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904420_C_P-D Feature FT:CDS FJ904420_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagccacctgggtgggtggtaatttggatgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904421_C_P-D Feature FT:CDS FJ904421_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71b). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagccacctgggtgggtggtaatttggatgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904422_C_P-D Feature FT:CDS FJ904422_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A76). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcact
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggacttaatgaatctagccacctgggtgggagtaaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactagtgtggtttcacatttcttg
tctcacttttggaagagataccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904424_C_P-D Feature FT:CDS FJ904424_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A79a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcggctctatttcgggaagccttagagtctcctgagcattgttcwcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcacccctccagcttatagac
cabtaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ904426_C_P-D Feature FT:CDS FJ904426_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaatactatgctggggggaactaatgactctagccacctgggtgggtgctaatttggaagatccaaca
tctagggacctagtagtcagttatgttaacaataatatgggcgtaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccaccatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgctag
>gnl|hbvcds|FJ904427_C_P-D Feature FT:CDS FJ904427_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggacgccttagagtctcctgagcattgtacatctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtagtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggttycacatttcttg
tctcacttttggaagagaaacggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904429_C_P-D Feature FT:CDS FJ904429_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcatttttgcctggtgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgaatctagccacctgggtgggtggtaatttggaagatccaacg
tccagggacctagtagtcagttatgttaactctcatatgggcctgaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctaacgcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904431_C_P-D Feature FT:CDS FJ904431_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B12). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgcctgccgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcmtgagcattgttcacctcaccataccg
cactcaggcaagcaattctttgctggggggacttaatgtctctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggatgcgcactcctccagcatatagac
cgacaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatag
>gnl|hbvcds|FJ904432_C_P-D Feature FT:CDS FJ904432_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctmgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|FJ904433_C_C-D Feature FT:CDS FJ904433_C_C-D of [Viruses] Hepatitis B Virus genotype D (isolate B15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgtacaccgcaccatactg
cactcaggcaagccattctttgttggggggaactaatgaatctagctacctgggtgggagtgaatttggaagatccagca
tctagggacctagtagtcaattatgtcaactctaatatgggcctaaagttcagacaactgttgtggtttcacacttcttg
tcttacttttggaagagaaaccgtcttagaatatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caacaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatstcaatgttag
>gnl|hbvcds|FJ904435_C_P-D Feature FT:CDS FJ904435_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttttgacttctttccttccgt
wcgagattttttagattccgccttagctttgtatcgggattccttagagtttcctgagccttgttcccctccccatwctg
ccctcaggccaacccttttttgctggggggatctaatgactctagctacctgggtgggagtaaatttggaagatccagca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaggaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904438_C_P-D Feature FT:CDS FJ904438_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccgttctttgctggggggaactaatgactctagctacctgggtgggtggaaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagacaaaccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caacaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|FJ904439_C_P-D Feature FT:CDS FJ904439_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggatgccttagagtctcctgagcattgcacacctcatcatactg
cactcaggcaagccatactatgttggggggaattaatgactctagctacctgggtgggggtcaatttagaagatcaagct
tccagggacctagtagtcagttatgttaacaataatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaaccgtcttagaatatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
cagcaaatgcccctatcttatcaacacttccggagactgctgttgttagatcaagaagcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ904443_C_P-D Feature FT:CDS FJ904443_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B46). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904445_C_P-D Feature FT:CDS FJ904445_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B62). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcytgttgacttctttccttcagt
acgagatcttctggataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaagtggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904446_C_P-D Feature FT:CDS FJ904446_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B64a). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggcgctactgtggagttactctcatttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcggcaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgtctctagccacctgggtgggtggcaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcttagaatatttggtgtctttcggagtgtggattcgcactcccccagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ167301_C_P-D Feature FT:CDS GQ167301_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM452). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctatttcgggacgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcacttatgttaatactaatatgggcattaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|GQ167302_C_P-D Feature FT:CDS GQ167302_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4521). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctatttcgggacgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaggatccaaca
tccagggacctagtagtcacttatgttaacaccaatatgggcataaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaaccttatagac
caccaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|GQ183448_C_P-D Feature FT:CDS GQ183448_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4629). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggattctcaatgttag
>gnl|hbvcds|GQ183449_C_P-D Feature FT:CDS GQ183449_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4591). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183450_C_P-D Feature FT:CDS GQ183450_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4589). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183451_C_P-D Feature FT:CDS GQ183451_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4588). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183452_C_P-D Feature FT:CDS GQ183452_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4590). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183453_C_P-D Feature FT:CDS GQ183453_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4574). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183454_C_P-D Feature FT:CDS GQ183454_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4582). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183455_C_P-D Feature FT:CDS GQ183455_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4573). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183456_C_P-D Feature FT:CDS GQ183456_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4572). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183457_C_P-D Feature FT:CDS GQ183457_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4583). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183458_C_P-D Feature FT:CDS GQ183458_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4587). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183459_C_P-D Feature FT:CDS GQ183459_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4585). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183460_C_P-D Feature FT:CDS GQ183460_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4584). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183461_C_P-D Feature FT:CDS GQ183461_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4586). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183462_C_P-D Feature FT:CDS GQ183462_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4567). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183463_C_P-D Feature FT:CDS GQ183463_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4613). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183464_C_P-D Feature FT:CDS GQ183464_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4703). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctacggtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183465_C_P-D Feature FT:CDS GQ183465_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4614). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183466_C_P-D Feature FT:CDS GQ183466_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4577). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183467_C_P-D Feature FT:CDS GQ183467_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4705). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183468_C_P-D Feature FT:CDS GQ183468_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4632). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183469_C_P-D Feature FT:CDS GQ183469_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4602). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183470_C_P-D Feature FT:CDS GQ183470_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4639). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttcggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|GQ183471_C_P-D Feature FT:CDS GQ183471_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4610). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagagacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183472_C_P-D Feature FT:CDS GQ183472_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4691). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cgctcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183473_C_P-D Feature FT:CDS GQ183473_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4601). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ183474_C_P-D Feature FT:CDS GQ183474_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ183475_C_P-D Feature FT:CDS GQ183475_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4575). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgttcacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaaaaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183476_C_P-D Feature FT:CDS GQ183476_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4603). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183477_C_P-D Feature FT:CDS GQ183477_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4604). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagagacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183478_C_P-D Feature FT:CDS GQ183478_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4605). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagtaatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttataggc
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183479_C_P-D Feature FT:CDS GQ183479_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4607). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183480_C_P-D Feature FT:CDS GQ183480_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4609). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctttatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcgacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183481_C_P-D Feature FT:CDS GQ183481_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4569). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183482_C_P-D Feature FT:CDS GQ183482_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4570). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183483_C_P-D Feature FT:CDS GQ183483_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4566). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183484_C_P-D Feature FT:CDS GQ183484_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4598). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgtcaatttggaagatccagca
tctagagacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ183485_C_P-D Feature FT:CDS GQ183485_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4599). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagtaatagaatagtatttggctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ184322_C_P-D Feature FT:CDS GQ184322_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4522). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctatttcgggacgccttagaatctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcacttacgttaatactaatatgggcattaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcgatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|GQ205380_C_P-D Feature FT:CDS GQ205380_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1245). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ205382_C_P-D Feature FT:CDS GQ205382_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1360d). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtgttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ205384_C_P-D Feature FT:CDS GQ205384_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1434d). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
acgagatcttctagataccgccgcagctctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactttagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacggcgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ205385_C_P-D Feature FT:CDS GQ205385_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1469). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcaactgtggagttactctcatttttgccttccgatttctttccgtcagt
ccgagatcttctagataccgcctcagcgctatatcgggatgctttagagtctcctgagcattgttcacctcaccatactg
cattcaggcaagcaattctttgttggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ205388_C_P-D Feature FT:CDS GQ205388_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1562). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ205389_C_P-D Feature FT:CDS GQ205389_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1667). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccgtcagt
acgagatcttctagataccgcctcagctctatatcgggaagcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|GQ377589_C_P-D Feature FT:CDS GQ377589_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate J145). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477452_C_P-D Feature FT:CDS GQ477452_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctttcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagctacctgggtgggagctaatttggaagatccagca
tctagggatctagttgttagttatgtcaacactaatgtgggcttaaaatttaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagatacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477453_C_P-D Feature FT:CDS GQ477453_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P39). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggatgccttagagtcccctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgaatctagctacctgggtgggaactaatttggaagatcaagga
tctagggacctagttgttagttatgtcaacactcatatgggcttaaaattcaggcaacttttgtggtttcacgtttcttg
tctcatgtttggaagagcagtggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagtaaatgcccctatcttatcaacacttccggagacttctgttgttagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggactcccaatgttag
>gnl|hbvcds|GQ477454_C_P-D Feature FT:CDS GQ477454_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P68). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgagccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgttggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctgaagttcaggcaactcttatggtttcacatttcttg
tctcacttttggaagacaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477455_C_P-D Feature FT:CDS GQ477455_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P73). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccgtcggt
acgacatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactatgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ477456_C_P-D Feature FT:CDS GQ477456_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P84). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcctacagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcatgtttcagctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggagctaatttggatgatccacaa
tctagggacctagttgttagttatgtcaacactaatgtgggcttaaagttcaggcaacttttgtggtttcacatttcttg
tctcacgtttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaccaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttaa
>gnl|hbvcds|GQ477457_C_P-D Feature FT:CDS GQ477457_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P118). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccgtcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactttgctggggggacttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477458_C_P-D Feature FT:CDS GQ477458_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P126). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctggtgactactttccttccgt
acgtgatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccagca
tccagggacctagtagttggttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctatagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|GQ477459_C_P-D Feature FT:CDS GQ477459_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P127). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ922000_C_P-D Feature FT:CDS GQ922000_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3552). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgctcccttactctcgtttttgcctcatgacttctttccttcaat
acgagatcttctagataccgccacagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccaaca
tttagagaacgagtagtcagttatgtcaacgataatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacctttggaagagatgtagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ922001_C_P-D Feature FT:CDS GQ922001_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3654). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
gcgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacctttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ922002_C_P-D Feature FT:CDS GQ922002_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3624). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
gcgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacctttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ922003_C_P-D Feature FT:CDS GQ922003_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3225). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaagacttttttccttccgt
acgmgatcttctagataccgccgcagctctgtatcggaatgccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggagaactcatgarcctagctacctgggtgggtgctaatttagaagatcaagca
tctagggacctagtagtcagytatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacgtttcttg
tcttacttttggaagagatacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|GQ922004_C_P-D Feature FT:CDS GQ922004_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3284). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttttttccttccgt
acgagatcttctagataccgccacagctctgtatcgagatgccttagagtctcctcatcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagacttaatgaacctagctacctgggtgggtactaatttagaagatccagca
tctagggaccaagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|GQ922005_C_P-D Feature FT:CDS GQ922005_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B2894). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttttttccttccat
acgagatcttctagataccgccgcagctctgtttcgggatgccttagagtctcctgagcattgttcagctcaccatactg
caatcaggcaagcagttctttgctggggagaactgattggtctagctacctgggtgggcactaatttagaagatcaagca
tctagggacctagtagtcagttatgtcaacaataatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tcttacttttggaagagatacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttaa
>gnl|hbvcds|GQ924652_C_P-D Feature FT:CDS GQ924652_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M89). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctggtagtcagttatgtcaacactaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|GU357846_C_P-D Feature FT:CDS GU357846_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Y10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctccgctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctggccacctgggtgggtggtaatttggaagatccaata
tccagggacctggtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456635_C_P-D Feature FT:CDS GU456635_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcatttctttgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggagctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456636_C_P-D Feature FT:CDS GU456636_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagcaattttatgctggggggatctaatgactctagctacctgggtggggggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagatacagtcatagagtatttagtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456637_C_P-D Feature FT:CDS GU456637_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T49). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagatgccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagacacagttttagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caacaaatgcccctatcttgtcaacacttccggagacttgtgttgttagacgacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456638_C_P-D Feature FT:CDS GU456638_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaatcgttatagagtatttggtgtcattcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456639_C_P-D Feature FT:CDS GU456639_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T129). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaggacttctatccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgtctctagctacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagtcacttatgtcaacactaatatgggccttaagttcagacaactattgtggtttcacgtttcttg
tctcacttttggaagagaagtagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcccatagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456640_C_P-D Feature FT:CDS GU456640_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactatgctggggggaactgatgactctagctacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttagtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU456641_C_P-D Feature FT:CDS GU456641_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtgcagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttacagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|GU456642_C_P-D Feature FT:CDS GU456642_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T70). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgcctaatgacttctttccttcact
acgagatcttctagataccgccgcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagcaattctgtgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctaatagtcacttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacctttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|GU456643_C_P-D Feature FT:CDS GU456643_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T52). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaattaatctatctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactactataggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456644_C_P-D Feature FT:CDS GU456644_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T58). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaatttcgtgctggggggatctacttaatttatctacctgggtgggtagtaatttggaagatcaaaca
tccagggacctagtagtcagttatgtcaacactactagtggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU456645_C_P-D Feature FT:CDS GU456645_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T80). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaatccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaataactctatctacctgggtgggtggtaatttggaagatcccaca
tccagggacctagtagtcagctatgtcaacactaatatgggcctgaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|GU456646_C_P-D Feature FT:CDS GU456646_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T77). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgttgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|GU456647_C_P-D Feature FT:CDS GU456647_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T130). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaatccttagagtctccggagcattgttcacttcaccatactg
cactcaggcaagcaattctgtgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatgtaaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456648_C_P-D Feature FT:CDS GU456648_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T85). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
gcgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456649_C_P-D Feature FT:CDS GU456649_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T57). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggatctaataactctaagtacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456650_C_P-D Feature FT:CDS GU456650_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T62). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcatttctgtgctggggggaactaatgaatctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctaatagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcctg
tctcaattttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU456651_C_P-D Feature FT:CDS GU456651_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctagtatcgagttactctcgtttttgccttctgacttctatccttcagt
aagagatcttctagataccgcctcagctttatatcgagaagccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggaattaatgactttggctacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttgtagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctccatgttag
>gnl|hbvcds|GU456652_C_P-D Feature FT:CDS GU456652_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactatgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaatgcttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU456653_C_P-D Feature FT:CDS GU456653_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T59). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaatcctttgctggggggatttaatgtctctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggatccgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456654_C_P-D Feature FT:CDS GU456654_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T39). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttcctgcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaatcctttgctggggggaactaatgtctctagccacctgggtgggtggtaatttggaagatcaacaa
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcactttcggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ccccaaatgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactcccaatgttag
>gnl|hbvcds|GU456655_C_P-D Feature FT:CDS GU456655_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T95). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtactcctcaccatactg
cactcaggcaagcattcctatgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccgaca
tccagggacctagtagtcagttatgttaacactaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456656_C_P-D Feature FT:CDS GU456656_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctatatcgggaagccttagagtctcatgatcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacaccaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataggc
catcaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU456657_C_P-D Feature FT:CDS GU456657_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T83). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttcagt
acgagatctactagataccgcctcagctctatatcgggaagcattagagtctcctgaacattgttcagctcaccatactg
cactcaggcaagcaattctttgctggggggacttaacgaatctagccacctgggtgggtggtaatttggatgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagatcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcctagagtatttggtatctttcggagtgtggattcgcactcctgtagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|GU456658_C_P-D Feature FT:CDS GU456658_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T114). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctattgagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaacccttggagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggaaatctacaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggggtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|GU456659_C_P-D Feature FT:CDS GU456659_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgttttcgcctcatgacttctttccttcagt
acgagatcttctagataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaataaatttatccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctgaagttcagacaactattgtggtttcacctttcttg
tctcacttttggaagagaaacggtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactgctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456660_C_P-D Feature FT:CDS GU456660_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T64). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctatccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgttgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|GU456661_C_P-D Feature FT:CDS GU456661_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T99). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctgcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456662_C_P-D Feature FT:CDS GU456662_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T23). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456663_C_P-D Feature FT:CDS GU456663_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T86). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactatgttggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tctagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgctag
>gnl|hbvcds|GU456664_C_P-D Feature FT:CDS GU456664_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T40). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcatctcaccatactg
cactaaggcaagcaattctttgctggggggacttaatgaatctagccacctgggtgggtagtaatttggaagatccagta
tccagagacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacctttcttg
tctcacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU456665_C_P-D Feature FT:CDS GU456665_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T76). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggcgcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattttatgctggggggagctaataactctaagcacctgggtgggtggtaatttggaagatccaaca
tccagagagctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcactttcggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456666_C_P-D Feature FT:CDS GU456666_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttttttccttcggt
aagagatcttctagataccgcctcagctctgtatcgggaagctttagagtctcctgagcattgttcacctcaccatactg
cactcaggcacgcatgtctttgctggggggacctaatgaacttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgtcaactctaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcgtagagtatttggtgtctttcggagtgtggatccgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456667_C_P-D Feature FT:CDS GU456667_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T120). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcctggtgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcactgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456668_C_P-D Feature FT:CDS GU456668_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T21). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtactcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcgacacttccggagactactgttgttagacaacgaagcaggttccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456669_C_P-D Feature FT:CDS GU456669_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T94). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggatgctttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tcaagagacctagtagtcggttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaatagtcattgaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagtaaatgcccctatcttatcaacacttccggagactactgttgttagatcccgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456670_C_P-D Feature FT:CDS GU456670_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacgtggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|GU456671_C_P-D Feature FT:CDS GU456671_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T56). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactttagccacctgggtgggtggtaatttggaagatccagta
tccagagacctagtagtcaattatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|GU456672_C_P-D Feature FT:CDS GU456672_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T73). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactacggagttactctcgtttttgcctatggacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgtctttagccacctgggtgggtggtaatttggaagatcaaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaaatattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456673_C_P-D Feature FT:CDS GU456673_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T75). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttttatccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagatctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaggacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|GU456674_C_P-D Feature FT:CDS GU456674_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgcctgctgacttctttccttcggt
acgagatcttctagataccgccgccgctctgtatcgggatgccttagagtctcacgatcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtaagttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
cagcaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcgccgcatcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|GU456675_C_P-D Feature FT:CDS GU456675_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctattgagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgctgcagctctgtatcgggatgccttagagtctcaggagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactcatatgggccttaagttcaggcaactattgtggtttcacgtttcttg
tctcatgtttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU456676_C_P-D Feature FT:CDS GU456676_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T98). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaataaatttatccacctgggtgggtggtaatttgcaagatccaaca
tccagagacttagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcatcacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456677_C_P-D Feature FT:CDS GU456677_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T46). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccctataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagaccttcttgataccgcctcagctttatttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatggctctagccacctgggtgggtggtaatttggaagatcaaaca
tccagagacctagtagtcaggtatgttaacactaatatgggccttaagttcagacaactattgtggtttcacgtttcttg
tctcatttttggaagagaagtggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456678_C_P-D Feature FT:CDS GU456678_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T97). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcatatctttgctggggggaactactgggtttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaatggtcatagagtacttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456679_C_P-D Feature FT:CDS GU456679_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T63). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgttgacttctatccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagcattagagtctcctcagcatgtttcacctcatcatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacagtagtagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456680_C_P-D Feature FT:CDS GU456680_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T88). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggatctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456681_C_P-D Feature FT:CDS GU456681_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T79). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccccagctttgtatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttggttatgttaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456682_C_P-D Feature FT:CDS GU456682_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T42). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcatttctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcatgtttggaagagatacggtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagactactgttattagacaacgaagcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU456683_C_P-D Feature FT:CDS GU456683_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T101). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|GU456684_C_P-D Feature FT:CDS GU456684_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T60). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggacgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgagtctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagatacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagtaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HE805987_C_P-D Feature FT:CDS HE805987_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 11999). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
ttggtcatgggccatcataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagstcttctagataccgcctcagctatatatcgggaagccttagartctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactratatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaaga
agaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042266_C_P-D Feature FT:CDS HM042266_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 472). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactcttgctacctgggtgggtgttaacttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcacactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042267_C_P-D Feature FT:CDS HM042267_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 473). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042272_C_P-D Feature FT:CDS HM042272_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 478). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042273_C_P-D Feature FT:CDS HM042273_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 479). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042276_C_P-D Feature FT:CDS HM042276_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 482). Partial genome (Contains: HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042277_C_P-D Feature FT:CDS HM042277_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 483). Partial genome (Contains: HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042283_C_P-D Feature FT:CDS HM042283_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 489). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750151_C_P-D Feature FT:CDS HM750151_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSD-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750152_C_P-D Feature FT:CDS HM750152_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate QHN-99). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaaaaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750153_C_P-D Feature FT:CDS HM750153_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJW-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750154_C_P-D Feature FT:CDS HM750154_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XGW-23). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccatcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcttaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750155_C_P-D Feature FT:CDS HM750155_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagatactgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgcttgggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM750156_C_P-D Feature FT:CDS HM750156_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagatactgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgttggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ236014_C_P-D Feature FT:CDS HQ236014_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagta
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ236015_C_P-D Feature FT:CDS HQ236015_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tctagagacctggtagtcagttatgtcaacactaatgtgggcctgaaattcaggcaactcttgtggtttcacatttcttg
tcttacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|HQ236016_C_P-D Feature FT:CDS HQ236016_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tctagagacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|HQ641710_C_P-D Feature FT:CDS HQ641710_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatatcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggggactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700439_C_P-D Feature FT:CDS HQ700439_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD03_1999). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagcgctatatcgggaagccttagagtctcctgagcattgctcacatcaccatactg
cactcaggcaagcaattctttgctggggggaccttatgackctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctggtagtcagttatgttaacactactgcgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|HQ700440_C_P-D Feature FT:CDS HQ700440_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD05_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700441_C_P-D Feature FT:CDS HQ700441_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN10_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700442_C_P-D Feature FT:CDS HQ700442_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagacccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700443_C_P-D Feature FT:CDS HQ700443_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1999). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagacccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700444_C_P-D Feature FT:CDS HQ700444_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN19_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaccttatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700445_C_P-D Feature FT:CDS HQ700445_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700446_C_P-D Feature FT:CDS HQ700446_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1999). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700447_C_P-D Feature FT:CDS HQ700447_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700448_C_P-D Feature FT:CDS HQ700448_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1999). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggamcttatgactctagccacctgggtgggtggtaatttggaagatccarta
tccagggacctagtagtcagttatgttaacactaatrtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700449_C_P-D Feature FT:CDS HQ700449_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE06_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatctcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700450_C_P-D Feature FT:CDS HQ700450_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE09_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700451_C_P-D Feature FT:CDS HQ700451_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GI11_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700454_C_P-D Feature FT:CDS HQ700454_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA53_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700455_C_P-D Feature FT:CDS HQ700455_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HA53_1999). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagmtcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctygcaramgaaggtytcaatygccgcgtcgcaaaagatytcaatytcgggaatctcaatgttag
>gnl|hbvcds|HQ700458_C_P-D Feature FT:CDS HQ700458_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE35_1997). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccgcggctctgtatcgggatgccttagagtctcctgagcattgttcagctcaccatactg
cactcaggcaagcaattctttgctggggagacctaatgaatctagctacctgggtgggtactaatttagaagaccaacca
tctagggacctagtagtcggttatgtcaacactactgtgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|HQ700459_C_P-D Feature FT:CDS HQ700459_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE55_1993). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700463_C_P-D Feature FT:CDS HQ700463_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HI43_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctccgctctatatcgagaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttgcaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcagctattgtggtttcacatttcttg
tctcacttttggaagacyaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|HQ700464_C_P-D Feature FT:CDS HQ700464_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_KA40_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700466_C_P-D Feature FT:CDS HQ700466_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700467_C_P-D Feature FT:CDS HQ700467_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1999). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcggctctatttcgggaagccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagcaattctttgctggggggaccttatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggaccttgtggtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700468_C_P-D Feature FT:CDS HQ700468_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI27_1984). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaccttatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacccaatgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700469_C_P-D Feature FT:CDS HQ700469_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700470_C_P-D Feature FT:CDS HQ700470_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1999). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggatcttatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700471_C_P-D Feature FT:CDS HQ700471_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO70_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700472_C_P-D Feature FT:CDS HQ700472_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO77_1997). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catctaatgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccactgttaa
>gnl|hbvcds|HQ700473_C_P-D Feature FT:CDS HQ700473_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaayactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcmagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700474_C_P-D Feature FT:CDS HQ700474_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1999). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcatcacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700477_C_P-D Feature FT:CDS HQ700477_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1984). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggamcttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatrtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700478_C_P-D Feature FT:CDS HQ700478_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1994). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|HQ700479_C_P-D Feature FT:CDS HQ700479_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA11_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700480_C_P-D Feature FT:CDS HQ700480_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700481_C_P-D Feature FT:CDS HQ700481_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1999). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatatggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcacgtaattctttgctggggggaccttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700482_C_P-D Feature FT:CDS HQ700482_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA40_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700483_C_P-D Feature FT:CDS HQ700483_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA120_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaccttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700484_C_P-D Feature FT:CDS HQ700484_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA229_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700487_C_P-D Feature FT:CDS HQ700487_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TU25_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700488_C_P-D Feature FT:CDS HQ700488_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_WA13_1984). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700489_C_P-D Feature FT:CDS HQ700489_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_WA13_1999). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaccttatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggwcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700510_C_P-D Feature FT:CDS HQ700510_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_128225_2003). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacatcaccatactg
camtcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagca
tctagggagctagtagtcagctatgtcaacaytaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700511_C_P-D Feature FT:CDS HQ700511_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_164317_2001). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagctatcctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700512_C_P-D Feature FT:CDS HQ700512_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_182089_2001). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagca
tctagggacctagtagtcagctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700513_C_P-D Feature FT:CDS HQ700513_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_16600_2001). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagca
tctagggacctagtagtcagctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700514_C_P-D Feature FT:CDS HQ700514_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_1664337_2001). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagca
tctagggacctagtagtcagctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700553_C_P-D Feature FT:CDS HQ700553_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1999). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagcaattctttgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|HQ833465_C_P-D Feature FT:CDS HQ833465_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ833466_C_P-D Feature FT:CDS HQ833466_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB26). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctwctgtkgagttactctcgtttttgcckactgacttctttccttcmgt
acgagatcttctagayaccgcctcagckctatatcgrgaagccttagagtctcctgagcattgytcacctcaccatackg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgakgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttag
>gnl|hbvcds|HQ833467_C_P-D Feature FT:CDS HQ833467_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttcggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggatccgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ833468_C_P-D Feature FT:CDS HQ833468_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB52). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaya
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|HQ833469_C_P-D Feature FT:CDS HQ833469_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB79). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgaatctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ833470_C_P-D Feature FT:CDS HQ833470_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB80). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ833471_C_P-D Feature FT:CDS HQ833471_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB97). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439692_C_P-D Feature FT:CDS JF439692_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN132). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaataggggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439695_C_P-D Feature FT:CDS JF439695_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN135). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
catcaaatgcccctatcctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439696_C_P-D Feature FT:CDS JF439696_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN136). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaataggggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439699_C_P-D Feature FT:CDS JF439699_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN142). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaataggggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439700_C_P-D Feature FT:CDS JF439700_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN143). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cgctcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaataggggcctaaagttcaggcaactcttgtggcttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcctctaccctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439701_C_P-D Feature FT:CDS JF439701_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN144). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cgctcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaataggggcctaaagttcaggcaactcttgtggcttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcctctaccctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439703_C_P-D Feature FT:CDS JF439703_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN146). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaataggggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439704_C_P-D Feature FT:CDS JF439704_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN149). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctattgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctaccctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF439705_C_P-D Feature FT:CDS JF439705_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN150). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctattgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctaccctatcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF439712_C_P-D Feature FT:CDS JF439712_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN158). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctattgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggttccacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439718_C_P-D Feature FT:CDS JF439718_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FEN167). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcagcactaataggggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcctctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754588_C_P-D Feature FT:CDS JF754588_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK61). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctatatcgggatgcattagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagtaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754590_C_P-D Feature FT:CDS JF754590_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK41). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggatttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagattcaaca
tccagggacctagtagtcggttatgttaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|JF754591_C_P-D Feature FT:CDS JF754591_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK38). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754592_C_P-D Feature FT:CDS JF754592_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK64). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctaatgacttctttccttcagc
acgagatcttctagataccgcctcagctctatttcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggcggtaatttggacgatcaacac
tccagggacctagtagtcagttatgttaactctaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|JF754593_C_P-D Feature FT:CDS JF754593_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK170). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgccacagctctatatcgggaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacgataatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatattgtcctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttcttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754594_C_P-D Feature FT:CDS JF754594_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK165). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcggt
acgagatcttctagataccgccacagctctatttcggcaagacttagagtctcctgagcatgtttcagctcaccacactg
cactcaggcaagcaatactatgctggggggagctaatgaatctagccacctgggtgggtggtaatttggatgatccaaca
tccagggaccaagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tatctcttttgggagaacaacggtcgtagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754595_C_P-D Feature FT:CDS JF754595_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK164). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctacggacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttagaagatccaaca
tccagggacctagtagtcagctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|JF754596_C_P-D Feature FT:CDS JF754596_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK106). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgcgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggcggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754597_C_P-D Feature FT:CDS JF754597_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK105). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcttcagctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatacgg
cactcaggcaagcaatactatgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtcttttggagtgtggattcgcactccaccaccttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754598_C_P-D Feature FT:CDS JF754598_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK104). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctcatgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcggcaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgaatctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754599_C_P-D Feature FT:CDS JF754599_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK173). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754600_C_P-D Feature FT:CDS JF754600_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK91). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgaatctagccacctgggtgggtggyaatttggaagatccaaca
tccagggacctagtagtcagttatgttaactctaatatgggcctaaagttcagacaactattgtggtttcacacttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
cagcaaatgcccctatcttatcaacacttccggagactgctgttattagaccacgaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754601_C_P-D Feature FT:CDS JF754601_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK88). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tcgagatcttctagataccgcctcagctttgtatcgggaagctttagagtcgcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754602_C_P-D Feature FT:CDS JF754602_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK83). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctggtgacttctttccttcagt
acgtgatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacttagtagtcagttatgtcaacactaatatgggcctaaaattccggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaatagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagactgctgttgttagaccacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF754603_C_P-D Feature FT:CDS JF754603_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttccttcagt
acgagatcttctagataccgcttcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactatgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcataaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagaatatttggtgtctttyggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754604_C_P-D Feature FT:CDS JF754604_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK79). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcatgtttcagctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggatgatccaaca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF754605_C_P-D Feature FT:CDS JF754605_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK77). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754606_C_P-D Feature FT:CDS JF754606_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK73). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctacttcggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaact
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754607_C_P-D Feature FT:CDS JF754607_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK67). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tcccgggacctagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacacttcttg
tctcacttttggaagagacacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF754608_C_P-D Feature FT:CDS JF754608_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK63). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggatcttatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754609_C_P-D Feature FT:CDS JF754609_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK45). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=549 residues).
atggatattgatccttataaagaatttggagcttctgtgcagttactctcgtttttgcctgaagacttctttccttcagt
acgagatcttctagataccgcatcagctctatatcgggaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagccatactatgctggggggacctaatgaatctagccacctgggtgggtagtaatttggaaccaacagcc
agggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtct
tacttttggaagagaaacggtcatagagtatttagtgtctttcggagtgtggattcgcactcctccaccttatagaccac
caaatgcccctatcttatcaacacttccggagattactgttattagacgacgaggcaggtcccctagaagaagaactccc
tcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754610_C_P-D Feature FT:CDS JF754610_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK157). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctggataccgcctcagctctgtatcgggaagccttagagtctcctgaccattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggagctaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactactgtggtttcacatttcttg
tctcacttttggaaagcaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754611_C_P-D Feature FT:CDS JF754611_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK152). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctatgctggggggatttaatgaacctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcggttatgtcaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcatgtttggaagacatacagtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaggctactgttattagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754612_C_P-D Feature FT:CDS JF754612_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK148). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggcgcttctgtggagttactctcttttttgccttctgacttctttcctgcagt
acgagatcttctagataccgccaccgctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacttagtagtcagttatgttaacactaatatgggcataaagttcagacaactattgtggtttcacatttcttg
tctcatgtttggaagagatacggtcgtagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttattagacaacgaagcaggacctctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggactctcaatgttag
>gnl|hbvcds|JF754614_C_P-D Feature FT:CDS JF754614_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcgtg
tctcacttttggaagagatacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caacaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754615_C_P-D Feature FT:CDS JF754615_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK141). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggggtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754617_C_P-D Feature FT:CDS JF754617_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK131). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatctgctggataccgccgcaggcctatatcgggaagccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagcaattctttgctggggggacctaattaatttatccacctgggtgggtagtaatttagaagatccaaca
tccagggacctagtagtcagttatgttaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggggtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaatgcttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF754618_C_P-D Feature FT:CDS JF754618_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK129). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcctgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754619_C_P-D Feature FT:CDS JF754619_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK62). Complete genome. [Hepadnaviridae] (length=552 residues).
atggayatygatccttataaagaatttggagctactgtgcagttactctcgtttttgcctcctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctcctgagcattgttcatctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcattgagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|JF754621_C_P-D Feature FT:CDS JF754621_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK161). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagctacctgggtgggtgctaatttgcaagatccagca
tctagggaccaagtagtcagctatgttaacactaatatgggcctaaagttcaggcaactattgtggttccacgtttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754622_C_P-D Feature FT:CDS JF754622_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK16). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcttctgagcattgtacacctcaccatactg
cactcaggcaagcaattctatgctggggggacttaatgaacctgggcacctgggtgggtgctaatttgcaagatcaacat
tccagggaccaagtagtcagttatgttaacactaatatgggactaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcgtagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttga
>gnl|hbvcds|JF754623_C_P-D Feature FT:CDS JF754623_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK171). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754624_C_P-D Feature FT:CDS JF754624_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tctagggacctagtagtcagttatgttaacactaatatgggcctgaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754625_C_P-D Feature FT:CDS JF754625_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK25). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcttttttgcctactgacttctttccttcggt
acgagatcttctagataccgccaaagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggacgatcaagga
tctagagaacaagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaaattttgtggtttcacatttcttg
tctcacttttggaagagaagtagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttattagacaacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754626_C_P-D Feature FT:CDS JF754626_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK23). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggcgctactgtggagttactctcgtttttgcctgatgacttctttccttcagt
acgagatcttctagatgccacctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagtcagttatgttaacactcatatgggtcttaagttcaggcaactattgtggtttcacttttcttg
tatcatgtttggaagagaaacggttgtagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|JF754627_C_P-D Feature FT:CDS JF754627_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctttgctggggggaactaatgaccctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacaccaatatgggcctaaagttcaggcaactattgtggtttcacatttcgtg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754628_C_P-D Feature FT:CDS JF754628_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754629_C_P-D Feature FT:CDS JF754629_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK176). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatctgtggagttactctcgtttttgccttctgacttttttccttcagt
tcgagatcttctagataccgcctcagctttgtatcgggacgctttagagtctcatgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggatctaataactctatctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcaattatgtcaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
ctccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF754630_C_P-D Feature FT:CDS JF754630_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK175). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaataactctatctacctgggtgggtggtaatttagaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctgaagttcaggcaactactgtggtttcacatttcttg
tctctgtttcggaagagaagtagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttgtcaacacttccggagactactgttattagacaacgagtcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF754631_C_P-D Feature FT:CDS JF754631_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK193). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctatccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattatttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcttagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754632_C_P-D Feature FT:CDS JF754632_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK186). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgtgatcttctagataccgccacagctctgtatcgggacgccttagagtctcctgagcattgtacaccgcaccatactg
cactcaggcaagcaattctatgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagattcaaca
tccagggacctagtagtcagttatgtcaacactaatatgggccttaagttccggcaactattgtggtttcacatttcttg
tctcatgtttggaagagatatagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagcaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754633_C_P-D Feature FT:CDS JF754633_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK128). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF754634_C_P-D Feature FT:CDS JF754634_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggatattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctatccttcagt
acgagatcttctagatactgcctcagctctatatcgggaagccttagagtctcctgagcattgttcagctcatcatactg
cactcaggcaagcaattctttgctggggggacctaatgaatctagccacctgggtgggtggtaacttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JF754635_C_P-D Feature FT:CDS JF754635_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK113). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctggtgacttctttccttccgt
acgagatcttctagataccgcctcagctctatttcggcaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatcctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttacagagtatttggtgtcttttggagtgtggattcgcactccgccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN040750_C_P-D Feature FT:CDS JN040750_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919078). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
tcgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN040751_C_P-D Feature FT:CDS JN040751_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919047). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040752_C_P-D Feature FT:CDS JN040752_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919033). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtcgagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgaacattgttcacctcaccatactg
cactcaggcaagccattctttgctggggggaactaatgactctagccacatgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaatccttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040753_C_P-D Feature FT:CDS JN040753_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919064). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cgctcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtagtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgcgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccttcagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|JN040754_C_P-D Feature FT:CDS JN040754_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919045). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctggtgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggatctaatgtctctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040755_C_P-D Feature FT:CDS JN040755_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919086). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccaccgctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctaacttttggaagagaaacagtcctagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|JN040756_C_P-D Feature FT:CDS JN040756_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919039). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccctataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|JN040757_C_P-D Feature FT:CDS JN040757_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919056). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccctataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040758_C_P-D Feature FT:CDS JN040758_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919037). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccttagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggaaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggactaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040759_C_P-D Feature FT:CDS JN040759_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919063). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040761_C_P-D Feature FT:CDS JN040761_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919002). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccagta
tccagagatctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040762_C_P-D Feature FT:CDS JN040762_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919007). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcggggtgccttagagtcttctgagcattgttctcctcaccatactg
cactcaggcaagcggttctttgctggggggatctaataaatttatccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040765_C_P-D Feature FT:CDS JN040765_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919006). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtacagggaagccttggagtctcctgagcattgtactcctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcttatcaatacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040766_C_P-D Feature FT:CDS JN040766_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919046). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatagatccttataaagaatttggcgcttctgtggagttactctcgtttttgcctggtgacttctttccttccgt
acgcgatcttctagataccgcctcagctctgtatcgggaagccttagagtctccggagcattgtactcctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaacttggaagatccgaca
tccagagacctagtagtcacttatgttaacactaatatgggcataaaattcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgcctcgtcgcagaagatctcaatctagggaagctcaatgttag
>gnl|hbvcds|JN040767_C_P-D Feature FT:CDS JN040767_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919019). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacgtttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggcatctcaatgttag
>gnl|hbvcds|JN040768_C_P-D Feature FT:CDS JN040768_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919051). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttcggt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaataactttatccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcatgtttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactagtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040769_C_P-D Feature FT:CDS JN040769_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919015). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgcgctcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcatctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtggggggtaacttggaagatccagta
tccagagacctagtagtcacttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcacacctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacaacgaggcaggtcctctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040770_C_P-D Feature FT:CDS JN040770_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919087). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
tcgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcagctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcttagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040771_C_P-D Feature FT:CDS JN040771_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919013). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcagttctatgctggggggaactaatgtctttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagacaaacggtcttagagtatttgatatctttcggagtgtggatgcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040772_C_P-D Feature FT:CDS JN040772_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919065). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cgctcaggcaagccattctttgctggggggacttaatgaatctagccacctgggtgggtggtaatttggaagatccagca
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagttcagacagctattgtggtttcacatttcttg
tctcacttttggaagagatacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040773_C_P-D Feature FT:CDS JN040773_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919084). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcggt
acgagatcttctagataccgcctcagctctatatcgggacgccttagagtctactgaacattgttcacctcaccatactg
cactcaggcaagcaattttgtgctggggggacctaattactttatccacctgggtgggtggtaatttggacgatccaaca
tccagagacctagtagtcagttatgttaacacgaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaattactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttga
>gnl|hbvcds|JN040774_C_P-D Feature FT:CDS JN040774_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919088). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtacgcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggcaatttggacgatcccaca
tctagggacctagtagtcagttatgttaacactcatatgggcctaaagttcagacagctattgtggtttcacgtttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN040775_C_P-D Feature FT:CDS JN040775_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919049). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcacgtatctctttgctggggggacctaatgaacttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagatacggttttagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040776_C_P-D Feature FT:CDS JN040776_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919043). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctggataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttgcaagatccagta
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacctttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN040777_C_P-D Feature FT:CDS JN040777_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919017). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctactagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcacttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|JN040778_C_P-D Feature FT:CDS JN040778_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919038). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgcaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040779_C_P-D Feature FT:CDS JN040779_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919070). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatcagaca
tccagggacctagtagtcacttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040780_C_P-D Feature FT:CDS JN040780_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919072). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtgcagttactctcgtttttgcctgttgacttctttccttcaat
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattatttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040781_C_P-D Feature FT:CDS JN040781_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919029). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacgg
ctctcaggcaagcatgtctgtgctggggggaactaatgaatttagccacctgggtgggtggaaatttggaagatccaaca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagagtatttggtttctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN040782_C_P-D Feature FT:CDS JN040782_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919041). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtagtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgcgggcctaaagttcagacaactgttatggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttctgttattagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatccagatgttag
>gnl|hbvcds|JN040783_C_P-D Feature FT:CDS JN040783_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919090). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagttagttatgttaacactaatgtgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040784_C_P-D Feature FT:CDS JN040784_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919030). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaatt
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040785_C_P-D Feature FT:CDS JN040785_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919022). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040786_C_P-D Feature FT:CDS JN040786_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919035). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040788_C_P-D Feature FT:CDS JN040788_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919024). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040790_C_P-D Feature FT:CDS JN040790_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919054). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040791_C_P-D Feature FT:CDS JN040791_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919082). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaactctaatatgggcctaaagttcagacaactattgtggtttcacctttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040792_C_P-D Feature FT:CDS JN040792_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919079). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaaattggaagatccaata
tccagggacctagtagtcagttatgttaactctaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040793_C_P-D Feature FT:CDS JN040793_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919083). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaactctaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040794_C_P-D Feature FT:CDS JN040794_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919075). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040795_C_P-D Feature FT:CDS JN040795_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919003). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctttgtttcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcatatttcttg
tctcacttttggaagagaaatagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|JN040796_C_P-D Feature FT:CDS JN040796_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919018). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaattgggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
caccaaatgcccctatcttatcaacgcttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN040797_C_P-D Feature FT:CDS JN040797_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919021). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagacacagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040799_C_P-D Feature FT:CDS JN040799_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919080). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040800_C_P-D Feature FT:CDS JN040800_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919012). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgctaccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagaaattctgtgctggggggaactaatgaatctagctacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagttaattatgtcaacactaatatgggcctaaagctcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|JN040801_C_P-D Feature FT:CDS JN040801_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919042). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgctaccgcctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagaaattctgtgctggggggaactaatgaatctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagttaattatgtcaacactaatatgggcctaaagctcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|JN040802_C_P-D Feature FT:CDS JN040802_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919074). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaataactctatctacctgggtgggtggtaatttggaagatccagca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagaggacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|JN040804_C_P-D Feature FT:CDS JN040804_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919028). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttaatctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactcttgctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacaccaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaactgttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040805_C_P-D Feature FT:CDS JN040805_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919058). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040806_C_P-D Feature FT:CDS JN040806_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919066). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgagacaggttccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040807_C_P-D Feature FT:CDS JN040807_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919034). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040808_C_P-D Feature FT:CDS JN040808_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919011). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagtaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040809_C_P-D Feature FT:CDS JN040809_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919014). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040810_C_P-D Feature FT:CDS JN040810_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919060). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcttcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggacttaataactctatctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040811_C_P-D Feature FT:CDS JN040811_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919048). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcggttatgtcaacactactgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|JN040812_C_P-D Feature FT:CDS JN040812_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919027). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctaatagtcagttatgtcaacactaatatgggcctaaagttcaggcaaatattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|JN040813_C_P-D Feature FT:CDS JN040813_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919025). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040814_C_P-D Feature FT:CDS JN040814_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919032). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatactgtgttggggagacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccggcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040815_C_P-D Feature FT:CDS JN040815_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919073). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040816_C_P-D Feature FT:CDS JN040816_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919016). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040817_C_P-D Feature FT:CDS JN040817_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919020). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040818_C_P-D Feature FT:CDS JN040818_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919081). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatctgctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacctgggtgggtggtaatttggatgatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttctta
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacaacgaggcaggtccactagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040819_C_P-D Feature FT:CDS JN040819_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919067). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgcggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgagaagctttagagtctcctgaacattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaaatattgtggtttcacatttcttg
tctaacttttggaagacaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040820_C_P-D Feature FT:CDS JN040820_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919010). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctgctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcacttatgtcaacactaatatgggcctaaagttcaggcaactactgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagaatatttggtgtctttcggagtgtggattcgcactccttcagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040821_C_P-D Feature FT:CDS JN040821_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919085). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgaacattgttcacctcaccatactg
cgctcaggcaagccgttctttgctggggggaactaatgactctagccacctgggtgggtggtaatttgcaagatccagta
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaatagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN040822_C_P-D Feature FT:CDS JN040822_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919044). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcgcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN040823_C_P-D Feature FT:CDS JN040823_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919005). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040824_C_P-D Feature FT:CDS JN040824_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919071). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040826_C_P-D Feature FT:CDS JN040826_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919055). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040827_C_P-D Feature FT:CDS JN040827_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919008). Complete genome. [Hepadnaviridae] (length=552 residues).
atggatattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040828_C_P-D Feature FT:CDS JN040828_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919069). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaaaatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040829_C_P-D Feature FT:CDS JN040829_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919089). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgaatctagctacctgggtgggtagtaatttggaagatccaaca
tccagggacctagtagtaagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaatagttatagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN040830_C_P-D Feature FT:CDS JN040830_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919052). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgaacattgtacgcctcaccatactg
cactcaggcaagcaattctttgctggggggacttgatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcatttttggaagagaaacagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN132126_C_P-D Feature FT:CDS JN132126_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-7642). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgtaag
>gnl|hbvcds|JN132127_C_P-D Feature FT:CDS JN132127_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-5204). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatatcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggggactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN132128_C_P-D Feature FT:CDS JN132128_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-5256). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatctggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatatcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggggactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN132130_C_P-D Feature FT:CDS JN132130_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-5314). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctgtatcgggaagccttagagtctcctgaacattgctcacctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN132131_C_P-D Feature FT:CDS JN132131_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-5255). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaggaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctgtatcgggaagccttagagtctcctgaacattgctcacctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaggagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgttgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN132132_C_P-D Feature FT:CDS JN132132_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-7974). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatctcctagataccgcctcagctctgtatcgggaagccttagagtctcctgaacattgctcacctcatcatactg
cactcaggcaagcaactctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257148_C_P-D Feature FT:CDS JN257148_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMF). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccgata
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttacagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|JN257149_C_P-D Feature FT:CDS JN257149_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSFN). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgasatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggamytaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggycccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257150_C_P-D Feature FT:CDS JN257150_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABS). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257151_C_P-D Feature FT:CDS JN257151_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHHR). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257152_C_P-D Feature FT:CDS JN257152_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRJB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcaccacaccatactg
cactcaggcaagcaattctgtgctggggggamctaatractctakctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257153_C_P-D Feature FT:CDS JN257153_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHRS1). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcatcatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttgcaagatccagta
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacgtttcttg
tctcatgtttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctgcagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgytag
>gnl|hbvcds|JN257155_C_P-D Feature FT:CDS JN257155_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJHM1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagacccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257159_C_P-D Feature FT:CDS JN257159_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMRW). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctkctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacatgggtgggtggaaatttggaagatccmaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcycaatgttag
>gnl|hbvcds|JN257160_C_P-D Feature FT:CDS JN257160_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHATR1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcggttatgttaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgcckcgtcgcagamgatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257161_C_P-D Feature FT:CDS JN257161_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHATR2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcggttatgttaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgcckcgtcgcagamgatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257162_C_P-D Feature FT:CDS JN257162_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSDQ). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgaacattgtacacctcaccatacgg
ctctcaggcaagcaatactatgctggggggaactaatgactctagctacctgggtgggtggtaatttgsaagatscaaca
tccagggacctagtagtcrgttatgtcaacwctaatatgggcttaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257163_C_P-D Feature FT:CDS JN257163_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAZI). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtgsagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagggatctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN257165_C_P-D Feature FT:CDS JN257165_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcctctgtggagttactctcatttttgccttccgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagggatctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagatatagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttcttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|JN257166_C_P-D Feature FT:CDS JN257166_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL2). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagcctctgtggagttactctcatttttgccttccgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagggatctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagatatagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttcttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|JN257169_C_P-D Feature FT:CDS JN257169_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAFF). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacatcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacctgggtggggggtaatttggaagacccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257170_C_P-D Feature FT:CDS JN257170_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJWB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcctggtgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagaatctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN257171_C_P-D Feature FT:CDS JN257171_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKML). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257172_C_P-D Feature FT:CDS JN257172_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMYD1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatttagccacctgggtgggtggtaatttggaagatccagta
tccagagacctagtagtcggttatgttaacactaccgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaagtggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcgacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257173_C_P-D Feature FT:CDS JN257173_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMYD2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatttagccacctgggtgggtggtaatttggaagatccagta
tccagagacctagtagtcggttatgttaacactaccgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaagtggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcgacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257176_C_P-D Feature FT:CDS JN257176_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgccgyctgacttctttccttcagt
acgagatcttctagataccgcctcggctctrtttcgggaacccttagagtctactgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgamtctagccacctgggtgggtggtaatttgsaagatccaaca
tccagggacctagtagtcacttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacgtgaatgttag
>gnl|hbvcds|JN257177_C_P-D Feature FT:CDS JN257177_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ2). Complete genome. [Hepadnaviridae] (length=555 residues).
atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgccgyctgacttctttccttcagt
acgagatcttctagataccgcctcggctctrtttcgggaacccttagagtctactgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgamtctagccacctgggtgggtggtaatttgsaagatccaaca
tccagggacctagtagtcacttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacaacatcaatgttag
>gnl|hbvcds|JN257178_C_P-D Feature FT:CDS JN257178_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHTRK). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggawctaatgactctagctacctgggtgggtgttaatttgsaagatccagca
tctagggamctagtagtcagtyatgtcaacactaatatgggcctgaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cwcmaaatgcccctatcttatcaacacttccggaaactrctgttgttagacgacgakgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257179_C_P-D Feature FT:CDS JN257179_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMJD1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctrgataccgcctcagctctatatcgggaagccctagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacytaatgactctagccacctgggtgggtggtaatttggaagatccaatt
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257181_C_P-D Feature FT:CDS JN257181_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHNDA). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctctgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagtttagacaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257182_C_P-D Feature FT:CDS JN257182_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMSL). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctataccgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggaactgatgactttagccacctgggtgggtggtaacttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257183_C_P-D Feature FT:CDS JN257183_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKSH). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgccgcagctctgtatggggaagccttacagtctcctgagcattgctcacctcaccatacag
cactcaggcaagcaattctgtgctggggggacctaatgaatctagctacctgggtgggtggtaatttggaagacccagta
tccagggacctaatagtcggttatgtcaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcctg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257185_C_P-D Feature FT:CDS JN257185_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHZYD). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257186_C_P-D Feature FT:CDS JN257186_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHDHM). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257187_C_P-D Feature FT:CDS JN257187_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMLL1). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgayccktataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagartctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcmtagagtatttggtgtctttcggagtgtggattcgcactcccccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257188_C_P-D Feature FT:CDS JN257188_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMLL2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgayccktataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagartctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcmtagagtatttggtgtctttcggagtgtggattcgcactcccccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257190_C_P-D Feature FT:CDS JN257190_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHYHY). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctrgataccgcctcagcactgtatcgggatgccttagagtctcctgaacattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctgaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagatrtrgtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|JN257193_C_P-D Feature FT:CDS JN257193_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRKN1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257194_C_P-D Feature FT:CDS JN257194_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRKN2). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257195_C_P-D Feature FT:CDS JN257195_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHRS2). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcatcatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttgcaagatccagta
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacgtttcttg
tctcatgtttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctgcagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgytag
>gnl|hbvcds|JN257196_C_P-D Feature FT:CDS JN257196_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABR1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagacccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257199_C_P-D Feature FT:CDS JN257199_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSOD2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttagaagacccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257200_C_P-D Feature FT:CDS JN257200_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMNM). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaact
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN257201_C_P-D Feature FT:CDS JN257201_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFAD). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctgtgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN257202_C_P-D Feature FT:CDS JN257202_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSLI). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacctttataaagaatttggagctaccgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaattcaatgctggggggaactaatgactctagctacctgggtgggtgggaatttggaagacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN257203_C_P-D Feature FT:CDS JN257203_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJKF). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagayaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257205_C_P-D Feature FT:CDS JN257205_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRYD). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacttgggtgggtggtaatttggacgacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257209_C_P-D Feature FT:CDS JN257209_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMR2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggamctaatramtctakccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257211_C_P-D Feature FT:CDS JN257211_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHBRH1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgattcttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257214_C_P-D Feature FT:CDS JN257214_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJDR1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattggtcacctcaccatactg
caatcaggcaagcaattctttgctggggggawctaatgactttagccacctgggtgggtggtaatttggaagatcmaaya
tccagagacctagtagtcagttatgttaacrytaatrtgggcctaaagttyagacaactattgtggtttcacatttcttg
tctcacgtttggaaragaaacggtyatagagtatttggtgyctttcggagtgtggattcgcactcctcmrgctwatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgygtcgcagaagatctmaatctcgggaatctcaatgttag
>gnl|hbvcds|JN257215_C_P-D Feature FT:CDS JN257215_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJDR2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattggtcacctcaccatactg
caatcaggcaagcaattctttgctggggggawctaatgactttagccacctgggtgggtggtaatttggaagatcmaaya
tccagagacctagtagtcagttatgttaacrytaatrtgggcctaaagttyagacaactattgtggtttcacatttcttg
tctcacgtttggaaragaaacggtyatagagtatttggtgyctttcggagtgtggattcgcactcctcmrgctwatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgygtcgcagaagatctmaatctcgggaatctcaatgttag
>gnl|hbvcds|JN558561_C_P-D Feature FT:CDS JN558561_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-5077). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctcctagataccgcctcagctctgtatcgggaagccttagagtctcctgaacattgctcacctcatcatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN558562_C_P-D Feature FT:CDS JN558562_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-5283). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatatcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcctccggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN558563_C_P-D Feature FT:CDS JN558563_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-8082). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN558564_C_P-D Feature FT:CDS JN558564_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642126_C_P-D Feature FT:CDS JN642126_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642128_C_P-D Feature FT:CDS JN642128_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb11). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccctataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcgcctcaccatactg
caatcaggcaagaatgtctttgctggggggaactaatgactctagccacctgggtgggtagtaatttggaagatcaaaga
tccagggaccaagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtttcattcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttcccgagactactgttattagatgccgaggcagggcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642129_C_P-D Feature FT:CDS JN642129_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctagtgtggagttactctcgtttctgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgttcagctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataggc
caccaaatgcccctatcttatcaacacttccggagactactgttattagacaaagacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642130_C_P-D Feature FT:CDS JN642130_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642131_C_P-D Feature FT:CDS JN642131_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642132_C_P-D Feature FT:CDS JN642132_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttccttcagt
acgagatcttctagataccgccagagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcactgttag
>gnl|hbvcds|JN642133_C_P-D Feature FT:CDS JN642133_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb21). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctatgctggggggaattaatgactctagccacctgggtgggtggcaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN642134_C_P-D Feature FT:CDS JN642134_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgccgagtcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642135_C_P-D Feature FT:CDS JN642135_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttttttccttccgt
acgagatcttctagataccgcctcagctctatatcgggacgccttagagtctcctgagcattgtacatatcatcatactg
cactcaggcaagcaattctatgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaaca
tccagggacctagtagtcagttatgtcaataataatatgggcctaaaattcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagcaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacaacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttag
>gnl|hbvcds|JN642136_C_P-D Feature FT:CDS JN642136_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgcctgaggacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtcacctgagcattgttctcctcaccatactg
cactcaggcaagcagttctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatcaaaca
tccagggacctagtagtcacttatgttaacactcatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctaacttttgggagagatacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642138_C_P-D Feature FT:CDS JN642138_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtcacctgagcattgttcttatcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcacagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|JN642140_C_P-D Feature FT:CDS JN642140_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctcgatactgcctcagctctgtatcgagatgccttggagtctcctgagcattgcactcctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgtctctagctacctgggtgggtggtaatttggacgacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagggaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cagtaaatgcccctatcttatcaacacttccggagactactgttgttagaccacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN642142_C_P-D Feature FT:CDS JN642142_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgagcattgttcacatcatcatactg
cactcaggcaagcaattctatgctggggggaactaatgactctagctacctgggtgggtggaaatttggatgatccaaca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaaatattgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642143_C_P-D Feature FT:CDS JN642143_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb33). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagcactgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctgaagttcagacaaatattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642144_C_P-D Feature FT:CDS JN642144_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgttcagctcaccatactg
cactcaggcaagcaattctttgctggggggaactaattaatctaattacctgggtaggtgttaatttggacaatccagca
tctagggacctagtagtcagttatgtcaatgatcatatgggcctgaagttcagacaactattgtggtttcacatttcctg
tcttacttttggaagagaaacggttttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642145_C_P-D Feature FT:CDS JN642145_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb36). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctatgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagacccagta
tccagggacctggtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtcgccatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642146_C_P-D Feature FT:CDS JN642146_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb38). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacctttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattcagtgctggggggaattaatgtctctagctacctgggtgggtagtaatttggaagatccaaca
tccagggacctggtagttggttatgtcaactctaatatgggcataaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642147_C_P-D Feature FT:CDS JN642147_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb39). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttccgt
acgagatcttctagataccgcctcagctctatatcgggacgccttagagtctcctgagcattgttcacctcaccacactg
cactcaggcaagcaattctatgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcggttatgttaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttcccgagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|JN642148_C_P-D Feature FT:CDS JN642148_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb40). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgatcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgctaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagtttaggcaaatattgtggtttcacatttcttg
tctcacttttggaagagacacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642149_C_P-D Feature FT:CDS JN642149_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb41). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttcagacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcatgagcattgctcacctcaccatactg
cactcaggcaagcaatactatgctggggggacctaatgtctctagctacctgggtgggtggtaatttggaagacccagta
tccagggacctagtagtcggttatgtcaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642150_C_P-D Feature FT:CDS JN642150_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttcagt
acgagatcttctagataccgccacagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642151_C_P-D Feature FT:CDS JN642151_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttccgt
acgagatcttctagataccgcctcagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaagagaaacggtaatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN642153_C_P-D Feature FT:CDS JN642153_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb47). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttattccgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN642154_C_P-D Feature FT:CDS JN642154_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb48). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttctgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cattaaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagacccaaca
tccagggacctaatagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacagtcatagaatatttggtgtctttcggagtgtggattcgcactcctctagcttatagac
caacaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|JN642155_C_P-D Feature FT:CDS JN642155_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb49). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctctgctggggggatctaataactttatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642156_C_P-D Feature FT:CDS JN642156_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb50). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgaacattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtaagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacgcttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642157_C_P-D Feature FT:CDS JN642157_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb51). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cattaaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagacccaaca
tccagggacctaatagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacagtcatagaatatttggtgtctttcggagtgtggattcgcactcctctagcttatagac
caacaaatgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttaa
>gnl|hbvcds|JN642158_C_P-D Feature FT:CDS JN642158_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb57). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgccacagctctatatcgggaggccttagagtctcctgaacattgttcacctcaccatacgg
cactcaggcaagcaattctatgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaact
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcatgtttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN642159_C_P-D Feature FT:CDS JN642159_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb52). Complete genome. [Hepadnaviridae] (length=552 residues).
atggaccttgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctggtgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctgaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642161_C_P-D Feature FT:CDS JN642161_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb54). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacctgtataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttctagatactgcctcagctctgtttcgagacgccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagcaatacaatgctggggggaattaatgtctctagctacctgggtgggtggcaatttggaagacccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN642162_C_P-D Feature FT:CDS JN642162_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb58). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcctgcggacttctttcctccagt
acgagctcttctagataccgcccaagctctgtatcgggatgcattagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcc
tctagggaactagtagtcagttatgtcaacactaatatgggcctgaagtttaggcaaatattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggatacgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642163_C_P-D Feature FT:CDS JN642163_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb59). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagcattgtatcgggaagccctagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatttaatgactctagcaacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctgaagttcagacaactattgtggtttcacgtttcttg
tctcacttttggaagagaaacggtaatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642164_C_P-D Feature FT:CDS JN642164_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb60). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccatataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgaacatgtttcacctcaccatactg
cactcaggcaagcatatctttgctggggggacctaatgaatttagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcggttatgttaacaatactgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|JN642165_C_P-D Feature FT:CDS JN642165_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactttagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgacgcaggacccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642166_C_P-D Feature FT:CDS JN642166_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagaatctcctgaccattgttcacctcaccatactg
cactcaggcaagcaattctctgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccaatt
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN642167_C_P-D Feature FT:CDS JN642167_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttcggacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtcttgtgagcattgttcacctcaccatactg
cactcaggcaagcaattttttgctggggggaactaatgactctcgccacctgggtgggtggaaatttgcaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccacgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664909_C_P-D Feature FT:CDS JN664909_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB36_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664910_C_P-D Feature FT:CDS JN664910_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB43_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgaatctagctacctgggtgggtactaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacggttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664911_C_P-D Feature FT:CDS JN664911_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB47_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664912_C_P-D Feature FT:CDS JN664912_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB49_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tccagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664913_C_P-D Feature FT:CDS JN664913_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN01_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664914_C_P-D Feature FT:CDS JN664914_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN48_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccatca
tctagggacctagtagtcagttatgtcaacactaatatgggcctgaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664917_C_P-D Feature FT:CDS JN664917_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SKR_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664918_C_P-D Feature FT:CDS JN664918_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2198_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagctcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgaacattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacccaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664919_C_P-D Feature FT:CDS JN664919_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2320_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttccgtctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattttgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaatgttatcatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664920_C_P-D Feature FT:CDS JN664920_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1903_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagcaattctttgctggggggaactgatgactctagctacctgggtgggtggtaatttggaagatccagcg
tctagagaattagtagtaagctatgtcaatgctaatatgggcctaaaactcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664921_C_P-D Feature FT:CDS JN664921_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN47_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctat
tcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtaagctatgtcaatgttaacatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664922_C_P-D Feature FT:CDS JN664922_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DH01_IC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtctgt
tcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggggaggtgacgaatctggccacctgggtgggaagtaatctggaagaccaagca
tccagggaattagtagtaagctatgtcaatactaacatgggcctaaaaatcagacaattattgtggtttcacatttcctg
tcttacttttggaagagaaactgttctagagtatttggtgtcttttggagtgtggattcgcactcctgctgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664924_C_P-D Feature FT:CDS JN664924_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN32_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccgtctgt
acgggacctcctcgacaccgcctctgctctatatcgggatgcgttagagtctccggaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaattaatgactctagctacctgggtgggtactaatttggaagatcaagct
tctagggacctagtggtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttgggagacaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN664926_C_P-D Feature FT:CDS JN664926_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN63_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
tcgagatcttctagataccgccgcagctctatatcgggatgcgttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaatcctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN664927_C_P-D Feature FT:CDS JN664927_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HE20_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgttggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664928_C_P-D Feature FT:CDS JN664928_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HE27_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagctcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664930_C_P-D Feature FT:CDS JN664930_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEN9_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664931_C_P-D Feature FT:CDS JN664931_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB6_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctctttcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacgaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664932_C_P-D Feature FT:CDS JN664932_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2235_CHB). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgt
gcgggatcttctcgacaccgccgcagctctgtatcgggatgcgttagaatctcctgaacattgttcacctcaccatactg
cactaaggcaagcaattctgtgctggggagagttgatgactctagctacctgggtgggtagtaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttgggagagaaacggttttggagtatttggtgtctttcggagtgtggattcgcactcctaccgcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664936_C_P-D Feature FT:CDS JN664936_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate E3529_LC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaatcctttgctggggggaattaatgactctagctacctgggtgggagttaatttggaagacccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacctttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664937_C_P-D Feature FT:CDS JN664937_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN45_LC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664938_C_P-D Feature FT:CDS JN664938_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN46_LC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664939_C_P-D Feature FT:CDS JN664939_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN71_LC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctctttcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacgaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN664941_C_P-D Feature FT:CDS JN664941_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB21_LC). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgctaccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagttaatggacctagccacctgggtgggtgttaatttggaagatccagca
tctagggaccaagtagtcagctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttggaaaagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN664947_C_P-D Feature FT:CDS JN664947_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB41_LC). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcctactgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcg
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JN664948_C_P-D Feature FT:CDS JN664948_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN64_LC). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacag
cactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctg
tcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN687947_C_P-D Feature FT:CDS JN687947_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-3111). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctataccgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcggttatgttaacactactgtgggcctaaagttcaggcaacttttgtggtctcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN688678_C_P-D Feature FT:CDS JN688678_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV007). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagga
tctagagaccaagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcctatcaacacttccggagattgttgttgttagacgacgaggcaggacccytagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN688679_C_P-D Feature FT:CDS JN688679_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV010). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctaccgtggagttactctcgtttttgcctgttgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgaacattgtacacctcaccatactg
cactcaggcaagcaattatttgctggggggaactaatgactctagctacctgggtgggggttaatttggaagatccagga
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN688683_C_P-D Feature FT:CDS JN688683_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV087). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagctctgtttcgggatgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggggttaatttggaagatcaacca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacacttcttg
tctcacttttggaagagacacagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttaaacaacaaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN688685_C_P-D Feature FT:CDS JN688685_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV097). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgaacattgtacacctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggggctaatttggaagatccagca
tctagggacctagtagtcacttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacacttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN688695_C_P-D Feature FT:CDS JN688695_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV128). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttttagataccgcctcagctctgtatcgggawgccttagagtctcctgagcatatttcacctcatcatactg
ctatcaggcaagcaatcctttgctggggggaattaatgactttagccccctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagagtatttggtgtctttcggagtgtggattsgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccatagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN688708_C_P-D Feature FT:CDS JN688708_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV142). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgcctactgacttctttccttcagt
acgagatcttctagataccgcctcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagctattctttgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccaaca
tctagagacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagacatagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagac
caaacaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN688710_C_P-D Feature FT:CDS JN688710_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV144). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggcgctaccgtggagttactctcgtttttgccttccgacttctttcctgcagt
acgagatcttctagataccgcctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgaatctagctacctgggtgggrgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacaccaatgtgggcctaaagttccggcaactyttgtggtttcacatttcttg
cctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaccaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN688711_C_P-D Feature FT:CDS JN688711_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV161). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactctagagttactttcttttttgccktctgacttctwtccttcggt
acgagatcttctagataccgcctcagctctgtrtcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattttttgctggggggaamtaatgactctagctacctgggtgggtgbtaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttg
tcttacttttggaagagaaacagttgtagagtatttggtgtttttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccgtagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN688712_C_P-D Feature FT:CDS JN688712_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV163). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcgtttttaccttctgacttctttccttccat
acgagatcttctagatacagccgcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcaccatactg
caatcaggcaagcaattctttgctggggggaactaatgaacctagctacctgggtgggggttaatttggatgatccaaca
tctagggaagcaataaccagttatgtcaacactaatatgggcctaaagtttcggcaactcttgtggtttcacgtttcttg
tctcacttttggaagagacacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttattagaagacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaactctcgggactctcaatgttag
>gnl|hbvcds|JN688713_C_P-D Feature FT:CDS JN688713_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV173). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctaccgtggagttactctcgtttttgcctrctgacttctttcctwccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatcaatcc
tctagagacctagtagtcagttacgtcaacaataatatgggcmtaaagttcaggcaactcttgtggtttcacatttcttg
tcttacttttggaagagaagtagtaatagagtatttggtgtyttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgagaaggcaggtcccctagaagaagaact
ccctcgcctagcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JN688722_C_P-D Feature FT:CDS JN688722_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV228). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacatcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgaatctaggtacctgggtgggtgttaatttggaagatcaagca
tctagagaccgagtagtcagttatgtcaacactaatatgggcctaaagttccggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN697591_C_P-D Feature FT:CDS JN697591_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NCVI-5293). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatatcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcctccggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN792903_C_P-D Feature FT:CDS JN792903_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 310000127). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttaaagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN792904_C_P-D Feature FT:CDS JN792904_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002943). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgaacatgtttcagctcaccatactg
cactcaggcaagcaattctgtgctggggggaattaatgactctagctacctgggtgggtgcgaatttggatgatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacgtttcttg
tctcatgtttggaagagatacggtcctagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN792905_C_P-D Feature FT:CDS JN792905_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000345). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgaacatgtttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatcaagca
tctagggaccaagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tatcacttttggaagaccaacggtcgtagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN792906_C_P-D Feature FT:CDS JN792906_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002958). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgaacatgtttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatcaagca
tctagggaccaagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagactaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcccccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN792907_C_P-D Feature FT:CDS JN792907_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000473). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttga
>gnl|hbvcds|JN792908_C_P-D Feature FT:CDS JN792908_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002951). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctattgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtacgaatttggaagatcaagga
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttga
>gnl|hbvcds|JN792909_C_P-D Feature FT:CDS JN792909_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000479). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN792910_C_P-D Feature FT:CDS JN792910_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 109001205). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN792911_C_P-D Feature FT:CDS JN792911_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002952). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctatatcgggacgccttagagtctcctgaacattgttcacctcaccatacag
cactcaggcaagcaattctttgctggggggaattaatgactctagctacctgggtgggtgtgaatttggaagatcaagca
tctagggaccaagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaacaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JN792912_C_P-D Feature FT:CDS JN792912_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 307000449). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatcttctagataccgcctcagctctatatcgggacgccttagagtctcctgaacattgttcacctcaccatacag
cactcaggcaagcaattctatgctggggggaattaatgactctagctacctgggtgggtgtgaatttggaagatcaagca
tctagggaccaagtagtcagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttg
tctcacttttggaagacaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaacaagaact
ccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JQ287601_C_P-D Feature FT:CDS JQ287601_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV469/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287602_C_P-D Feature FT:CDS JQ287602_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV470/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287603_C_P-D Feature FT:CDS JQ287603_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV471/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287604_C_P-D Feature FT:CDS JQ287604_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV472/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287605_C_P-D Feature FT:CDS JQ287605_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV473/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287606_C_P-D Feature FT:CDS JQ287606_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV474/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287607_C_P-D Feature FT:CDS JQ287607_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV475/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287608_C_P-D Feature FT:CDS JQ287608_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV476/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287609_C_P-D Feature FT:CDS JQ287609_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV477/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287610_C_P-D Feature FT:CDS JQ287610_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV478/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287611_C_P-D Feature FT:CDS JQ287611_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV479/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287612_C_P-D Feature FT:CDS JQ287612_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV480/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287613_C_P-D Feature FT:CDS JQ287613_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV481/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287614_C_P-D Feature FT:CDS JQ287614_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV482/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287615_C_P-D Feature FT:CDS JQ287615_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV483/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287616_C_P-D Feature FT:CDS JQ287616_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV484/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287617_C_P-D Feature FT:CDS JQ287617_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV485/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287618_C_P-D Feature FT:CDS JQ287618_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV486/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287619_C_P-D Feature FT:CDS JQ287619_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV487/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287620_C_P-D Feature FT:CDS JQ287620_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV488/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ287621_C_P-D Feature FT:CDS JQ287621_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV489/NCDC). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagctatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ687530_C_P-D Feature FT:CDS JQ687530_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Srb 200). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctaaaagaagaact
ccctcgcctcgcaaacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ687531_C_P-D Feature FT:CDS JQ687531_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Srb 205). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttatgcagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctttgtatcgggatgccttagagtctcctgagcattgttcacctcacctatctg
tactcaagcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tcaagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707476_C_P-D Feature FT:CDS JQ707476_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C1). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707477_C_P-D Feature FT:CDS JQ707477_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C11). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707478_C_P-D Feature FT:CDS JQ707478_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707479_C_P-D Feature FT:CDS JQ707479_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707480_C_P-D Feature FT:CDS JQ707480_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|JQ707481_C_P-D Feature FT:CDS JQ707481_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707482_C_P-D Feature FT:CDS JQ707482_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C17-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707483_C_P-D Feature FT:CDS JQ707483_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707484_C_P-D Feature FT:CDS JQ707484_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C19). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcggaaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707485_C_P-D Feature FT:CDS JQ707485_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707486_C_P-D Feature FT:CDS JQ707486_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707487_C_P-D Feature FT:CDS JQ707487_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707488_C_P-D Feature FT:CDS JQ707488_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707489_C_P-D Feature FT:CDS JQ707489_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcgacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707490_C_P-D Feature FT:CDS JQ707490_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707491_C_P-D Feature FT:CDS JQ707491_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C3). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccgtagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707492_C_P-D Feature FT:CDS JQ707492_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C30). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707493_C_P-D Feature FT:CDS JQ707493_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctgggggaagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707494_C_P-D Feature FT:CDS JQ707494_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707495_C_P-D Feature FT:CDS JQ707495_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C33). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707496_C_P-D Feature FT:CDS JQ707496_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C34-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707497_C_P-D Feature FT:CDS JQ707497_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C36). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcgtcttgataccacttcagctctgtatcgagaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaaggactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacaattccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707498_C_P-D Feature FT:CDS JQ707498_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C37). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaacgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707499_C_P-D Feature FT:CDS JQ707499_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C38). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707500_C_P-D Feature FT:CDS JQ707500_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C40). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccacaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707501_C_P-D Feature FT:CDS JQ707501_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C41). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacgggcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707502_C_P-D Feature FT:CDS JQ707502_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C42). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707503_C_P-D Feature FT:CDS JQ707503_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707504_C_P-D Feature FT:CDS JQ707504_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C44). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcatctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagctccagca
tctagggacctagtagtcagttatgtcaacactgatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707505_C_P-D Feature FT:CDS JQ707505_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707506_C_P-D Feature FT:CDS JQ707506_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C46). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707507_C_P-D Feature FT:CDS JQ707507_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C48). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707508_C_P-D Feature FT:CDS JQ707508_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707509_C_P-D Feature FT:CDS JQ707509_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C7). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggatctaacgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaacttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707510_C_P-D Feature FT:CDS JQ707510_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C8). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707511_C_P-D Feature FT:CDS JQ707511_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C9). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgacatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707512_C_P-D Feature FT:CDS JQ707512_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C1-22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707513_C_P-D Feature FT:CDS JQ707513_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707514_C_P-D Feature FT:CDS JQ707514_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcgcctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707515_C_P-D Feature FT:CDS JQ707515_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707516_C_P-D Feature FT:CDS JQ707516_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707517_C_P-D Feature FT:CDS JQ707517_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707518_C_P-D Feature FT:CDS JQ707518_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C17-3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707519_C_P-D Feature FT:CDS JQ707519_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707520_C_P-D Feature FT:CDS JQ707520_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707521_C_P-D Feature FT:CDS JQ707521_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcagcactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707522_C_P-D Feature FT:CDS JQ707522_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707523_C_P-D Feature FT:CDS JQ707523_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C36). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707524_C_P-D Feature FT:CDS JQ707524_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C4). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707525_C_P-D Feature FT:CDS JQ707525_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C40). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707526_C_P-D Feature FT:CDS JQ707526_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707527_C_P-D Feature FT:CDS JQ707527_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707528_C_P-D Feature FT:CDS JQ707528_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707529_C_P-D Feature FT:CDS JQ707529_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C46). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtattaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707530_C_P-D Feature FT:CDS JQ707530_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttcttgataccgcttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagca
tctagggacctagtagtcagttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tcttacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707682_C_P-D Feature FT:CDS JQ707682_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_1-10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707683_C_P-D Feature FT:CDS JQ707683_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707684_C_P-D Feature FT:CDS JQ707684_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707685_C_P-D Feature FT:CDS JQ707685_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_12). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707686_C_P-D Feature FT:CDS JQ707686_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaggcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707687_C_P-D Feature FT:CDS JQ707687_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707688_C_P-D Feature FT:CDS JQ707688_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707689_C_P-D Feature FT:CDS JQ707689_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707690_C_P-D Feature FT:CDS JQ707690_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707691_C_P-D Feature FT:CDS JQ707691_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707692_C_P-D Feature FT:CDS JQ707692_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_26). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707693_C_P-D Feature FT:CDS JQ707693_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_27). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707694_C_P-D Feature FT:CDS JQ707694_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707695_C_P-D Feature FT:CDS JQ707695_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctagtgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707696_C_P-D Feature FT:CDS JQ707696_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_3). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttctgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707697_C_P-D Feature FT:CDS JQ707697_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707698_C_P-D Feature FT:CDS JQ707698_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707699_C_P-D Feature FT:CDS JQ707699_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707700_C_P-D Feature FT:CDS JQ707700_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_36-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707701_C_P-D Feature FT:CDS JQ707701_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707702_C_P-D Feature FT:CDS JQ707702_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaattctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707703_C_P-D Feature FT:CDS JQ707703_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707704_C_P-D Feature FT:CDS JQ707704_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_5). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tttcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707705_C_P-D Feature FT:CDS JQ707705_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707706_C_P-D Feature FT:CDS JQ707706_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_8-2). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgactcttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagt
acgagatcttcttgataccgcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagcaatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ927384_C_P-D Feature FT:CDS JQ927384_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KM2109). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttcrgc
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcactgttcacctcaccatacta
cactcaggcaagccattctttgctggggggaacttatgaatctagctacctgggtgggtgcaaatttgcaagatcaagca
tctagggatctagtagtcaattatgtcaacactaatatgggcctaaagtttagacaactattgtggtttcacacttcttg
tctcacttttggaagagaaaccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
catcaaatgcccctatcttatcaacacttccggagacttgtgttrttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttga
>gnl|hbvcds|JX036342_C_P-D Feature FT:CDS JX036342_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Y2-212_CD). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgcgcagttactctcgtttttacctgctgacttctttccttcagt
acgagatcttctagatactgcctcagctttatatcgggaagccttagagtctcctgagcatgtttcatctcaccatactg
ctctcaggcaagcaattctttgttggggggaactaatgactctagccacctgggtgggtggtaatttggacgatccaaca
tccagggacccagtagtcagttatgttaacactaatatgggcctaaagtttagacaactattgtggtttcacatttcttg
tctcacttttggaagagccacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcggcacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttga
>gnl|hbvcds|JX036343_C_P-D Feature FT:CDS JX036343_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Y2-27_D). Partial genome (Contains: HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagatactgcctcagctttatatcgggaagccttagagtctcctgagcatgtttcatctcaccatactg
ctctcaggcaagcaattctttgttggggggatctaatgtctctagccacctgggtgggtagtaatttggacgatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcgacacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaggatctccatctcggggatctcaatgttaa
>gnl|hbvcds|JX036344_C_P-D Feature FT:CDS JX036344_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Y2-25_D). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgcgcagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagatactgcctcagctttatatcgggaagccttagagtctcctgagcatgtttcatctcaccatactg
ctctcaggcaagcaattctttgttggggggatctaatgtctctagccacctgggtgggtagtaatttggacgttccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagacacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcgacacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttaa
>gnl|hbvcds|JX096954_C_P-D Feature FT:CDS JX096954_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1-3242). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX096955_C_P-D Feature FT:CDS JX096955_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2-3051). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatggctctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcatatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX096956_C_P-D Feature FT:CDS JX096956_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5-6154). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX096957_C_P-D Feature FT:CDS JX096957_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6-2646). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagtagttagttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX096958_C_P-D Feature FT:CDS JX096958_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7-1276). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagca
tctagggacctagttgttagttatgtcaacactaatatgggcttaaaattcagacaacttttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX310733_C_P-D Feature FT:CDS JX310733_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D23_1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcactttcggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX310734_C_P-D Feature FT:CDS JX310734_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D23_3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX310735_C_P-D Feature FT:CDS JX310735_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D23_4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JX470760_C_P-D Feature FT:CDS JX470760_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H-IDU6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagca
tctagagacctagtagtcggttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tcttacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898689_C_P-D Feature FT:CDS JX898689_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898691_C_P-D Feature FT:CDS JX898691_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898692_C_P-D Feature FT:CDS JX898692_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898694_C_P-D Feature FT:CDS JX898694_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P24). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX898697_C_P-D Feature FT:CDS JX898697_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC012652_C_P-D Feature FT:CDS KC012652_C_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcagttctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagca
tctagagacctagtagtcggttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tcttacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774436_C_P-D Feature FT:CDS KC774436_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1008). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774437_C_P-D Feature FT:CDS KC774437_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1009). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgctttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttatggtttcatatttcttg
cctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774440_C_P-D Feature FT:CDS KC774440_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1028). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtggggggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774444_C_P-D Feature FT:CDS KC774444_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1038). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagctttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774445_C_P-D Feature FT:CDS KC774445_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1040). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccatataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774459_C_P-D Feature FT:CDS KC774459_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1111). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacacgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774460_C_P-D Feature FT:CDS KC774460_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1112). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagt
acgagatcttctagataccgccgcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774462_C_P-D Feature FT:CDS KC774462_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dxa2047). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC774477_C_P-D Feature FT:CDS KC774477_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dxn1031). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaaaaaaaacggtcatagagtatttggtgtctttcggagtgtggattcccactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875275_C_P-D Feature FT:CDS KC875275_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV39). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875276_C_P-D Feature FT:CDS KC875276_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV6). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagtctactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875277_C_P-D Feature FT:CDS KC875277_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875278_C_P-D Feature FT:CDS KC875278_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV38). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaaccattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875279_C_P-D Feature FT:CDS KC875279_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875280_C_P-D Feature FT:CDS KC875280_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV20). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875281_C_P-D Feature FT:CDS KC875281_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV32). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875282_C_P-D Feature FT:CDS KC875282_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV13). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875283_C_P-D Feature FT:CDS KC875283_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV15). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875284_C_P-D Feature FT:CDS KC875284_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV28). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875285_C_P-D Feature FT:CDS KC875285_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV29). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875286_C_P-D Feature FT:CDS KC875286_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV17). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875287_C_P-D Feature FT:CDS KC875287_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV18). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875288_C_P-D Feature FT:CDS KC875288_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV56). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875289_C_P-D Feature FT:CDS KC875289_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV55). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875290_C_P-D Feature FT:CDS KC875290_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV57). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875291_C_P-D Feature FT:CDS KC875291_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV58). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtgaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875292_C_P-D Feature FT:CDS KC875292_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV21). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaataaccctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875293_C_P-D Feature FT:CDS KC875293_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV69). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875294_C_P-D Feature FT:CDS KC875294_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV70). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875295_C_P-D Feature FT:CDS KC875295_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV81). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875296_C_P-D Feature FT:CDS KC875296_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV82). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875297_C_P-D Feature FT:CDS KC875297_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV84). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875298_C_P-D Feature FT:CDS KC875298_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV76). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KC875299_C_P-D Feature FT:CDS KC875299_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV85). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875300_C_P-D Feature FT:CDS KC875300_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV80). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875301_C_P-D Feature FT:CDS KC875301_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV89). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875302_C_P-D Feature FT:CDS KC875302_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV86). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875303_C_P-D Feature FT:CDS KC875303_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV92). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875304_C_P-D Feature FT:CDS KC875304_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV91). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
cacctaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875305_C_P-D Feature FT:CDS KC875305_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV41). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875306_C_P-D Feature FT:CDS KC875306_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV71). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875307_C_P-D Feature FT:CDS KC875307_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV74). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagacaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875308_C_P-D Feature FT:CDS KC875308_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV72). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatcgttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875309_C_P-D Feature FT:CDS KC875309_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV43). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcagccaagcaattctgtgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875310_C_P-D Feature FT:CDS KC875310_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV9). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcgcctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875311_C_P-D Feature FT:CDS KC875311_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV10). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875312_C_P-D Feature FT:CDS KC875312_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV22). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactg
cactcaggcaagctatcctttgctggggggagctaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccaggttatagac
cacctaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KC875313_C_P-D Feature FT:CDS KC875313_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875314_C_P-D Feature FT:CDS KC875314_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV2). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctccagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaaatctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875315_C_P-D Feature FT:CDS KC875315_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV8). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcatgcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacattacttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875316_C_P-D Feature FT:CDS KC875316_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV16). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttggggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875317_C_P-D Feature FT:CDS KC875317_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV48). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KC875318_C_P-D Feature FT:CDS KC875318_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV40). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875319_C_P-D Feature FT:CDS KC875319_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV30). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875320_C_P-D Feature FT:CDS KC875320_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875321_C_P-D Feature FT:CDS KC875321_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV19). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875322_C_P-D Feature FT:CDS KC875322_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV54). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875323_C_P-D Feature FT:CDS KC875323_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV53). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875324_C_P-D Feature FT:CDS KC875324_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV59). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccccagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875325_C_P-D Feature FT:CDS KC875325_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV60). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875326_C_P-D Feature FT:CDS KC875326_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV37). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KC875328_C_P-D Feature FT:CDS KC875328_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV83). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaatgctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KC875329_C_P-D Feature FT:CDS KC875329_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV90). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttctttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875330_C_P-D Feature FT:CDS KC875330_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV87). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|KC875331_C_P-D Feature FT:CDS KC875331_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV88). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KC875332_C_P-D Feature FT:CDS KC875332_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV42). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875333_C_P-D Feature FT:CDS KC875333_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV75). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KC875334_C_P-D Feature FT:CDS KC875334_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV47). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagacaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875335_C_P-D Feature FT:CDS KC875335_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV44). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875336_C_P-D Feature FT:CDS KC875336_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV45). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875337_C_P-D Feature FT:CDS KC875337_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV46). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagca
tctagagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875340_C_P-D Feature FT:CDS KC875340_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV34). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatctgtggagttactctcatttttgccttccgatttctttccgtctgt
ccgagatcttctagataccgcctcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgaatttagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|KC875341_C_P-D Feature FT:CDS KC875341_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV67). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatctgtggagttactctcatttttgccttccgatttctttccgtctgt
ccgagatcttctagataccgcctcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgaatttagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttctggagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|KC875342_C_P-D Feature FT:CDS KC875342_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV79). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagcatctgtggagttactctcatttttgccttccgatttctttccgtctgt
ccgagatcttctagataccgcctcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggagaactaatgaatttagctacctgggtgggtactaatttggaagatccagca
tctagggacctagtggtcagttatgtcaacactaacatgggcctaaagttcaggcaactattgttgtttcacatttcttg
tctcacttttggaagacaaacggttctggagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagac
caccaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaccctcaatgttag
>gnl|hbvcds|KF018177_C_P-D Feature FT:CDS KF018177_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcaat
acgagatcttctagataccgcctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactg
caatcaggcatgtatttctttgctggggggacctaatgaatctagccacctgggtgggtggtaatttgcaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcagctattgtggtttcacatttcctg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018180_C_P-D Feature FT:CDS KF018180_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagttagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018181_C_P-D Feature FT:CDS KF018181_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggaccttgatccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggatgccttggagtctcctgagcattgttcacctcaccatactg
cactcaggcacgtaattctttgctggggggacctaatgaatctagccacctgggtgggtggcaatttggaagatccaata
tccagggacctagtagtcaattatgttaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttttagagtatttggtgtctttcggagtgtggattcgcactcctcccccttatagac
cacaaaatgcccctatcttatcaacacttccggagacttctgttgttagacaacgaggcaggtcccctagaagaagaact
ccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018182_C_P-D Feature FT:CDS KF018182_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcatggctttgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagac
caacaaatgcccctatcttatcaacacttccggagactactgttgttagacaacgtgtcaggacccttagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018184_C_P-D Feature FT:CDS KF018184_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018185_C_P-D Feature FT:CDS KF018185_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctatatcgggaagccttagagtctccggagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgtctctagccacctgggtgggtggtaatttggaagatccaaca
tctagggacctaatagtcagttatgttaacactaatatgggcctaaagttcaggcaactactgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018187_C_P-D Feature FT:CDS KF018187_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018189_C_P-D Feature FT:CDS KF018189_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018190_C_P-D Feature FT:CDS KF018190_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttcttgataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaata
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactactgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018191_C_P-D Feature FT:CDS KF018191_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactcttgccacctgggtgggtggaaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018192_C_P-D Feature FT:CDS KF018192_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagcattagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaataactctatccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaactgtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018194_C_P-D Feature FT:CDS KF018194_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttggccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF018195_C_P-D Feature FT:CDS KF018195_C_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttagacgatccaaca
tccagggacctagtggtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctatcgcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagcggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF061167_C_P-D Feature FT:CDS KF061167_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_1a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccctataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcmacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF061168_C_P-D Feature FT:CDS KF061168_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_3a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaasccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggahctaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF061169_C_P-D Feature FT:CDS KF061169_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_7a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaatcctttgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaata
tcccgggatctagtagtcagttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF061170_C_P-D Feature FT:CDS KF061170_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_13a). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccctagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctggccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatatcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgagtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF170739_C_P-D Feature FT:CDS KF170739_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SDAC_024). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggatctaatgactctaaccacctgggtgggtggtaatttggaagatccagta
tccagggacctagtagtcacttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192830_C_P-D Feature FT:CDS KF192830_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP71). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192831_C_P-D Feature FT:CDS KF192831_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP59). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192832_C_P-D Feature FT:CDS KF192832_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP67). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF192834_C_P-D Feature FT:CDS KF192834_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP63). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagca
tccagggacctagtagtcagttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471640_C_P-D Feature FT:CDS KF471640_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-86). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtgaatttactctcgtttttgcctgctgactactttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtcttctgagcattgcacacctcaccatactg
cactcaggcaagcaattctgtgctggggggacttaataaatctatctacctgggtgggtagtaatttggaagatccaaca
tccagggacctagtagtcagttatgtcaacactaatatgggcctcaagttcaggcaactattgtggtttcacatttcttg
cctcacttttggaagagaagtagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctcgaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|KF471641_C_P-D Feature FT:CDS KF471641_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-66). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctcctgagcattgtactcctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacctttgggagagaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgtgcttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KF471642_C_P-D Feature FT:CDS KF471642_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-65). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcagctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgtctttagccacctgggtgggtggaaatttggaagatccagta
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacaacgacgcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttga
>gnl|hbvcds|KF471644_C_P-D Feature FT:CDS KF471644_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-52). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactg
cactcaggcaagcaattctttgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccgaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttg
tctcacttttggaagacaaacggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471645_C_P-D Feature FT:CDS KF471645_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-50). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagacaccgcctccgctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|KF471646_C_P-D Feature FT:CDS KF471646_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-37). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtagtaagttatgttaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471647_C_P-D Feature FT:CDS KF471647_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-35). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccataccg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471649_C_P-D Feature FT:CDS KF471649_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-31). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccaaca
tccagggacctagtggtcagttatgtcaacactaatatcgccctaaagttcaggcaattattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
ctccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471650_C_P-D Feature FT:CDS KF471650_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-25). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatctgctagataccgcctcagctctatatcgggacgccttagagtctcctgagcattgttcacctcaccatactg
ctctcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaaca
tctagggacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttagtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471651_C_P-D Feature FT:CDS KF471651_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-22). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471652_C_P-D Feature FT:CDS KF471652_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-20). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471653_C_P-D Feature FT:CDS KF471653_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-18). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggt
acgagatcttctagataccgcctcagctctgtatcggcaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagatacagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471654_C_P-D Feature FT:CDS KF471654_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-14). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtttcgggaacccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggacttaatgactttagccacctgggtgggtggtaatttggaagatccagta
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctaacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|KF471655_C_P-D Feature FT:CDS KF471655_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-11). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaat
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacatcaccatactg
ctctcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatctggaagatccaata
tccagggacctagtagtcagttatgtcaacactcatatgggcctaaagatcaggcaactattgtggtttcacatctcttg
tctcacttttggaagagaaacagttttagagtatttggtgtccttcggagtgtggattcgcactcctctaccttatagac
caccgaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KF471656_C_P-D Feature FT:CDS KF471656_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-8). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaata
tccagggacctagtagtcagttatgttaacactaatatgggcctaaagttcagggaactattgtggtttcacatttcttg
tctcacttttggaagagaaacgggcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471657_C_P-D Feature FT:CDS KF471657_C_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgatccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcgcctcaccatactg
cactcaggcaagcaattctttgctggggggatctaataactttatccacctgggtgggtggtaatttggaagatccaaca
tccagagacctagtagtcagttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttg
tctcacttttggaagagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF471658_C_P-D Feature FT:CDS KF471658_C_P-D of [Viruses] Hepatitis B Virus genotyp