HBVdb

Dataset for nucleotide sequence PreC of genotype B

[Download (right click)] [Edit] [Sequences] [Repertoires]

3018 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


KP659255_PreC_P-B      atacaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659221_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcwtgttcatgtcctac
KP659250_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287317_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287318_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659219_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP659240_PreC_P-B      nnnnnnnnnn---nnnnnnnnnnnnnnatcatctcatgttcatgtcctac
KP659244_PreC_P-B      nnnnnnnnnn---nnnnnnnnnnnnnnntcatctcatgttcatgtcctac
AB287323_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659239_PreC_P-B      nnnnnnnnnn---nnnnnnnnnnnnnnntcatctcatgttcatgtcctac
KP659248_PreC_P-B      atgcaacttt---ttcacctctgcctartcatctcttgttcatgtcctac
AB287320_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287324_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287321_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659252_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659253_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcwtgttcatgtcctac
KP659245_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659251_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctctcgttcatgtcctac
JN792901_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JN792902_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287319_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659224_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP659254_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463795_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463796_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463799_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463787_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ463791_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ463802_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659223_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KP659220_PreC_P-B      atgmaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463792_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ463800_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JN792898_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JN792897_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287325_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463801_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JN792893_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463793_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JN792894_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463797_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JN792895_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463789_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JN792896_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659249_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287322_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463798_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JN792899_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463790_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JN792900_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287316_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ463794_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ463788_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659234_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KP659235_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB287314_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287315_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659247_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KP659237_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KP659246_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB642093_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB300371_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB828708_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073849_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900097_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB900096_PreC_P-B      atgtaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073853_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB302095_PreC_P-B      atgcaacttt---ttcacctctgcctagtcacctcttgttcatgtcctac
AB073854_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900102_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB931168_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB931169_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073858_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB106884_PreC_P-B      atgtaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB900103_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900112_PreC_P-B      acgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
D50521_PreC_P-B        atgcaacttt---ttcacctctgcctagtcatctctcgttcatgtcctac
D50522_PreC_P-B        atgcaacttt---ttcacctctgcctagtcatctctcgttcatgtcctac
AB900108_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900098_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB362933_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB073838_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900106_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB642101_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073855_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073847_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073856_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB014366_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073857_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073852_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900111_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287327_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900105_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
D00329_PreC_P-B        atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073851_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900104_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073845_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900107_PreC_P-B      atgccacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB300370_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB010292_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB010290_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB010291_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
LT992442_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073850_PreC_P-B      acgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073842_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073844_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB900095_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
MH932712_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB246343_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
D23679_PreC_P-B        atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB010289_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB246341_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB205121_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB073846_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073848_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
LC279268_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
LC279269_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
LC279270_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
LC279271_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
LC279272_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
LC279273_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB246342_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB287326_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB073843_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
D23678_PreC_P-B        atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
DQ993682_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ027312_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276819_PreC_P-B      atgcamcttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276792_PreC_P-B      ctgcgacttt---ttcacctctgcctaatcagctcttgttcatgtcctac
KY881837_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011477_PreC_P-B      acgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276795_PreC_P-B      aygcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MK818222_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctay
KU576893_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576894_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576895_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576897_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576750_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576896_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576898_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576892_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576890_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576889_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576888_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576886_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576891_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576887_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU668036_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU668004_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU667988_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU668045_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
HM011496_PreC_P-B      atgyaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011482_PreC_P-B      aygcaacttt---ttcacctctgcctratcatctcttgttcatgtcctac
KX276797_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276789_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ995804_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276798_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
KM875418_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276800_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276775_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276812_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011484_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011487_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcccac
MG571326_PreC_P-B      acgcaccttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571329_PreC_P-B      acgcaccttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668369_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576713_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576708_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576709_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgctcatgtcctac
KU576820_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgctcatgtcctac
KU576702_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576707_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576710_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576706_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576700_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576701_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576705_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgccctac
KU668309_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668332_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667987_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576718_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667997_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctgc
KU668003_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668359_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MK818225_PreC_P-B      atgcahcttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571352_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MK818223_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
GQ924630_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
EU939636_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KF166001_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689406_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
HM011466_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KJ803816_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276804_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011470_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcacgtcctac
AY596111_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276770_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU522072_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU522073_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU522075_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276778_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ386648_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276813_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667944_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667951_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668229_PreC_P-B      atgcaacttt---ctcacctctgcctaatcatctcatgttcatgtcctac
KU576622_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668259_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668249_PreC_P-B      atgcaacttt---tccacctctgcctaatcatctcatgttcatgtcctac
KU668278_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668202_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668238_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576616_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576611_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576613_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668290_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939677_PreC_P-B      atggaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY167102_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctctcgttcatgtcctac
KY881845_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU487257_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667825_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576876_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667773_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667668_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667835_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011494_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM011503_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB073839_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ410502_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
X98077_PreC_P-B        atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ993698_PreC_P-B      atgcaacttt---ttgaactctgcctaatcatctcttgttcatgtcctac
DQ993710_PreC_P-B      atgcaacttt---ttgaactctgcctaatcatctcttgttcatgtcctac
JQ341474_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KT749820_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MF674464_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
GQ924660_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU522074_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964152_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964147_PreC_P-B      atgcaacttt---ttcacctctgcctaatcacctcttgttcatgtcctac
KU964138_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964139_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964140_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964142_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964144_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964145_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964148_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964150_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964151_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964141_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964143_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964146_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964149_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774397_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU939665_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY163869_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY163870_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ173371_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173372_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689419_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AF157020_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ790200_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
GQ377606_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ341471_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ803755_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ803758_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667801_PreC_P-B      atgcaacatt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668243_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcccac
KU667730_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgccctac
KU667828_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881869_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881853_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881849_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881865_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY217355_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY217356_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ386680_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX504543_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386615_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667789_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY217361_PreC_P-B      atgcaacttt---ttgaactctgcctaatcatctcatgttcatgtcctac
KJ173347_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173348_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667591_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667796_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667784_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667612_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcacgtcctac
KU576804_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576806_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571370_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667581_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562321_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881867_PreC_P-B      atgcaacttt---ttcacctctgcctaatcttctcttgttcatgtcctac
KY881856_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881905_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881844_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881863_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881903_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881902_PreC_P-B      atgcactttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881912_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881909_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881862_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881854_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881846_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881911_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881898_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881857_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881847_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881895_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881848_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881906_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881908_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881904_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881899_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881893_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881859_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881894_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881897_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881901_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881855_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881860_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881852_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881858_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881866_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881868_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881896_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881900_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881907_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881910_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881913_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881914_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881851_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667637_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667649_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576621_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576617_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576612_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576614_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881838_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
GQ377622_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881833_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU939660_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881830_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964394_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964244_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964246_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964251_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964253_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964254_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964247_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964249_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964245_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964255_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964256_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964248_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881826_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881834_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881825_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881829_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881823_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881841_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881827_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881836_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881843_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881828_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881831_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881821_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881824_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881835_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881822_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881842_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881820_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881839_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576938_PreC_P-B      atgcaacatt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774405_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667574_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964137_PreC_P-B      atgcaacttt---ttgaagagctctagaccggatattgttcatgtcctac
KU964123_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964124_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964128_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964129_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964131_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964134_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964136_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964127_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964132_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964126_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964130_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964133_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964135_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964125_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ386669_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571363_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576807_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576809_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX661480_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AF121250_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964080_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964082_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964091_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964084_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964088_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964087_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964089_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964090_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964092_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964086_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964085_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964079_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964081_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964083_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KT749851_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964287_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964289_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964290_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964291_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964292_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964293_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964294_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964295_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964296_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964297_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964298_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964299_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964300_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964301_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964302_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964288_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562240_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MF674450_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939637_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562254_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB073823_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571324_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AF157023_PreC_P-B      atgcaacttt---ttcaccgctgcctaatcatctcatgttcatgtcctac
AF157024_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF157025_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689511_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144544_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ144554_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY217357_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY217358_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144600_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144585_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144596_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144593_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144587_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144583_PreC_P-B      atgcaacttt---ctcacctctgcctaatcatctcatgtccatgtcctac
DQ144581_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144574_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144570_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144569_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgctcatgtcctac
DQ144551_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144559_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144589_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144606_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144592_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144584_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144582_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144579_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144576_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144545_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144565_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144590_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144556_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144595_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144548_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144558_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144575_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144543_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcatgttcatgtcctac
DQ144552_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcatgttcatgtcctac
DQ144555_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcatgttcatgtcctac
DQ144546_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144557_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144567_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144578_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144586_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774367_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774362_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
GQ377582_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY596106_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX661477_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KU576939_PreC_P-B      acgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774377_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX661476_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KC774412_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774372_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX661470_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KC774406_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774401_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774390_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774378_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774384_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774366_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KM392083_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JX661478_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JX661484_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JX661473_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JX661472_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JX661474_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JX661475_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JX661481_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
JX661471_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KC774410_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774383_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774389_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774371_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774407_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774365_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774395_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774417_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774402_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774391_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774379_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774385_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774373_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774380_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KC774386_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KC774392_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KC774368_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
KC774374_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
HM011478_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcaygtcctac
KU964280_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964286_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964276_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964283_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964274_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964282_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964273_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964275_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964278_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964279_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964281_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964272_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964284_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964277_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964285_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276791_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576125_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576126_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576130_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576131_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576127_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KM875420_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562260_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU547563_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
EU939678_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276793_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY206383_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
FJ562312_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU158263_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB073841_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU579441_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU570075_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
FJ032344_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
EU589335_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ386656_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ341503_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571357_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689490_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689559_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689560_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU577047_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU577046_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU577048_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ027315_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276771_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011476_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939674_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ899790_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ899791_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276806_PreC_P-B      ttgcracttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ027325_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276801_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269128_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcatac
HM011480_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ027329_PreC_P-B      aggcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB900110_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377644_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ341508_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU939635_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803789_PreC_P-B      atgcaacttt---tcactctctgcctaatcatctcatgttcatgtcctac
JQ341480_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP406276_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406277_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406275_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406278_PreC_P-B      nnnnnnnnnn---atcacctctgcctaatcatctcatgttcatgtcctac
KP406272_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406263_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406274_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406264_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406255_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406265_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406268_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406270_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406279_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406261_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406163_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
JQ801516_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP406184_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406176_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406178_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406180_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406181_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406183_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406185_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406177_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406179_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406182_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406197_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406219_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406186_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406187_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406189_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406192_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406194_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406198_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406199_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406203_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406208_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406210_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406214_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406216_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406188_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406195_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406200_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406217_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406201_PreC_P-B      nnnnnnnnnn---atcacctctgcctaatcatctcatgttcatgtcctac
KP406190_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406212_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406191_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406193_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406196_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406202_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406204_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406205_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406206_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406207_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406209_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406211_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406213_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406215_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406218_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406165_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406167_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406171_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406173_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406241_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcctgttcatgtcctac
KP406232_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406243_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406237_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406236_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcctgttcatgtcctac
KP406234_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406238_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406240_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406220_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406221_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406222_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406223_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406224_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406225_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406227_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406228_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406229_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406230_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406231_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406233_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406235_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406242_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406331_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406330_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406332_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406334_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406333_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406335_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406318_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406319_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406320_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406321_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406322_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406324_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406325_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406326_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406327_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406328_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406329_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406323_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406164_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406162_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406166_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406273_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406262_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406266_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406269_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406271_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406260_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406257_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406280_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406249_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406246_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406244_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406247_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406248_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406251_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406252_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406253_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406254_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406245_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406250_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406258_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406256_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406259_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406267_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406283_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406282_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406290_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406291_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406294_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406281_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406293_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406284_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406286_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406289_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406285_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406287_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406292_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406303_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406299_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406311_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406307_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406308_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406309_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406310_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406313_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406315_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406316_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406302_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406288_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406298_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406296_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406300_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406305_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406306_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406312_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406314_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406297_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406317_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406301_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406304_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
X97850_PreC_P-B        atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576924_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
KU668361_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcgtgctcatgtcctac
KU668360_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667413_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668322_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668354_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576923_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668371_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668343_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667603_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668334_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY220697_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964258_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964270_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
KU964266_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964257_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964259_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964261_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964262_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964263_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964265_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964267_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964268_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964269_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964271_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964260_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
KU964264_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
FJ787475_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ787476_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB073825_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939671_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
EU919175_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU919176_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689476_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB555498_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ803768_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562222_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB365445_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276810_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668070_PreC_P-B      atgcaacttt---ttcacctctgcgtaatcatctcttgttcatgtcctac
FJ562259_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY269109_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcatac
EU487256_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU660224_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667714_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576342_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576853_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576340_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668138_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668088_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576344_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668063_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667719_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667716_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU577092_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667720_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667718_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667717_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576341_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576345_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667721_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667715_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576343_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667713_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667712_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668104_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668130_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668111_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668074_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668122_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ386658_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576300_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
KU576307_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
KU576305_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576303_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576306_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576304_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcatgttcatgtcctac
KU576299_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576308_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576288_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576295_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576302_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF282917_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KM213035_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JF436921_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939663_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB073830_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668081_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668019_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668060_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667680_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY596112_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctctcgttcatgtcctac
EU939669_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ899779_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276773_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939639_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ899786_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ899787_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU939672_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ899784_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ899785_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KM213032_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX429901_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatcttatgttcatgtcctac
KJ173378_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY220703_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY220704_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU882003_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU882004_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562253_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY206375_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386681_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073837_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571327_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX504532_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562231_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AF233234_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB642094_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470834_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470837_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470841_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470832_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470840_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470833_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470836_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470839_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470830_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470835_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY470838_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571350_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KM213034_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ040147_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU881997_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU881998_PreC_P-B      atgcaacttt---tttacctctgcctaatcatctcatgttcatgtcctac
KM213036_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KM875416_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KM875417_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ032349_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386675_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562289_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576297_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377519_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964381_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964382_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964383_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964384_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964385_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964388_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964391_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964393_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964395_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964397_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964386_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964387_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964389_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964390_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964392_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU964396_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
GQ924637_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276776_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcayctcttgttcatgtcctac
KX276811_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562246_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcytgttcatgtcctac
EF494382_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY206391_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276781_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY206390_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcgtgttcatgtcctac
AY238972_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcgtgttcatgtcctac
KM875426_PreC_P-B      atgcaactttttcttcacctctgcctaagcatctcatgttcatgtcctac
DQ995802_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689469_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689516_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689414_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
KC492740_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ995805_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689500_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ803795_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803781_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803783_PreC_P-B      atgcaacatt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803752_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939638_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ032353_PreC_P-B      atgcaacttt---ttcacctcttcctaatcatctcatgttcatgtcctac
FJ032352_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ032354_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276805_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689494_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689562_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU939559_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctat
EU882002_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY217364_PreC_P-B      atgcaacttt---ttgaactctgcctaatcatctcatgttcatgtcctac
KU577118_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EF473974_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881792_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP036970_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX429910_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EF473973_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ173418_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173419_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577113_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774400_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX026881_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU796066_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
GQ377525_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571331_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881850_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX026886_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ386682_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU939664_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB205120_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ518811_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ173411_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173412_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM153811_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576803_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576808_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562316_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ040128_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576879_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576875_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576877_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ592177_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ751767_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881789_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY881783_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576046_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803817_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377550_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU522066_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ995801_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073822_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386600_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881799_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881794_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881798_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881796_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881808_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881797_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881790_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgctcatgtcctac
KY881788_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881786_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881780_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881781_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881782_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881784_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881787_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881791_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881793_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881800_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881801_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881795_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939666_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
D00330_PreC_P-B        atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF335738_PreC_P-B      atgcaacttt---ttcacctctgcccaatcatctcatgttcatgtcctac
KU576472_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MK052964_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881785_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AF461362_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377567_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964093_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964095_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964097_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964099_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964103_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964106_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964094_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939676_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF335740_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF335741_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774408_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674480_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964101_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964096_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964098_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964100_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964102_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964105_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964107_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964104_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571341_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ801512_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcgtgttcatgtcctac
KM359440_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173420_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173421_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF121243_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF121244_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF121245_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF121246_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX507215_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ410500_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667891_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgtacatgtcctac
KU667659_PreC_P-B      atgcaacttt---ttcacctcagcctaatcatctcatgttcatgtcctac
KU668167_PreC_P-B      atgcaacttt---ctcacctctgcctaatcatctcatgttcatgtcctac
KU667492_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgtttatgtcctac
KU667859_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667936_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667840_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668367_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576387_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668132_PreC_P-B      atgcaacctt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668169_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668308_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667619_PreC_P-B      atgcaacttc---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668103_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
KU667938_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667422_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667540_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667438_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667493_PreC_P-B      atgaaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667569_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667460_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667469_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667508_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667412_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668358_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668318_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668330_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667448_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667955_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667996_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgtccatgtcctac
KU668289_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668076_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668009_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatcccatgttcatgtcctac
KU667879_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667700_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668299_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667980_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668300_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668307_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667640_PreC_P-B      atgcaacttt---ttcacctcagcctaatcaactcatgttcatgtcctac
KU668305_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667957_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667812_PreC_P-B      atgcaacttt---ttcacctctgcctaaccatctcatgttcatgtcctac
KU668304_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
KU667740_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctgc
MF568475_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctgc
KU667506_PreC_P-B      atgcaacttt---ctcacctctgcctaatcatctcatgttcatgtcctac
KU668014_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatcccatgttcatgtcctac
KU667586_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
KU667968_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667647_PreC_P-B      atgcaacttt---ttcacctcagcctaatcatctcatgttcatgtcctac
KU667455_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668165_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667787_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgctcatgtcctac
KU667473_PreC_P-B      atgcaacttt---ttcacctctgcttaatcatctcatgttcatgtcctac
KU667817_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667481_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667701_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667794_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667768_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU564825_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU564826_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ803786_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276783_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576101_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576106_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctat
KU576114_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576111_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576113_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576108_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576109_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576112_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576105_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576107_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924646_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG372436_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276786_PreC_P-B      mtgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576180_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576636_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
KU576338_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576165_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576173_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576185_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276785_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803805_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ801506_PreC_P-B      atgccacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341488_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276784_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY217362_PreC_P-B      atgcaacttt---ttgacctctgcctaatcatctcatgttcatgtcctac
KJ803808_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073836_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX504533_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576921_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgctcatgtcctac
KU668232_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668261_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668241_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668270_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668252_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668222_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668342_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668353_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668333_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU158262_PreC_P-B      atgcaacttt---ttsamctctgcctgatcatctcatgttcatgtcctac
FJ787477_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
KJ173385_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576293_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576301_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480353_PreC_P-B      atgcaactct---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480349_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480341_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480343_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480363_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480351_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480337_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480344_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480342_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480356_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480355_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480339_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480357_PreC_P-B      atgcaacttt---tccacctctgcctaatcatctcatgttcatgtcctac
AF480345_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480338_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480362_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480364_PreC_P-B      atgcaactct---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480348_PreC_P-B      atgcaacttt---tacacctctgcctaatcatctcatgttcatgtcctac
AF480346_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480359_PreC_P-B      atgcaactct---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480360_PreC_P-B      atgcaactct---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480361_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480352_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480350_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480358_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480354_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgttctac
AF480340_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF480347_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173362_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ144602_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY167094_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667546_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939679_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667739_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803820_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX026883_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689551_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcatgttcatgtcctac
KJ173368_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667555_PreC_P-B      atgcaacttt---ctcacctctgcctaatcatctcatgttcatgtcctac
KY689513_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689514_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667708_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667686_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386634_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815747_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
GU815748_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AF233237_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU305547_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668101_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667869_PreC_P-B      atgcaacttt---ctcacctctgcctaatcatctcatgttcatgtcctac
KU667860_PreC_P-B      atgcaacttt---ctcacctctgcctaatcatctcatgttcatgtcctac
KU577120_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcacgttcatgtcctac
GU815778_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924644_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815783_PreC_P-B      atgcaacccc---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815777_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815776_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815775_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815773_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815772_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815774_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815779_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815781_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815782_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815757_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674503_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU595031_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173357_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668100_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577121_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577117_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386683_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577111_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577115_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667695_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668097_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668098_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668102_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939667_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MF674465_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU919172_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU919173_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011499_PreC_P-B      mtgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276858_PreC_P-B      mtgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
HM011475_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ027313_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276794_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571375_PreC_P-B      atgcaacttt---gtcacctttccataatcatgtcttgttcaagtcggag
KX276787_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgtgcatgtcctac
KX276779_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276802_PreC_P-B      ctgcgacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571325_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276796_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU564822_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU564824_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU564823_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276807_PreC_P-B      mtgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ027330_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
JQ027331_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
AB073832_PreC_P-B      mtgcaacttt---ttcacctctgcctaatcatctcttgtycatgtcctac
JQ341495_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341492_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ803797_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM011483_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571358_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803773_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276772_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
JQ801494_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341498_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276816_PreC_P-B      aygcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY206387_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667549_PreC_P-B      atgcaacttt---ttcacctctgccaaatcatctcttgttcatgtcctac
KU668293_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576749_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667539_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576628_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576145_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576736_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667528_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667517_PreC_P-B      gtgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668302_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576418_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576416_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576415_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576414_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576417_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668150_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668188_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668171_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668195_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562311_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276790_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689402_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689501_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689502_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ032342_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
HM011473_PreC_P-B      aygcracttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571337_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM011471_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571353_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571376_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667531_PreC_P-B      atgcagcttt---ttcacctctgcctaatcatctctagttcatgtcctac
KX276774_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571336_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939675_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM011474_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939661_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY167093_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM011504_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689483_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073824_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276799_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
KU576600_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803825_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924624_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ341466_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571351_PreC_P-B      acgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689444_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924632_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ801474_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571354_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667858_PreC_P-B      atgaaacttt---ttcacctctgcctaatcatctcatattcatgtcctac
AY269105_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
DQ995803_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276782_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576148_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576146_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803821_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386608_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY269102_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcatac
KU576848_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576753_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576765_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576632_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576703_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576626_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576641_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576856_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576854_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576843_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576754_PreC_P-B      ttgcaacttt---ttcgcctctgcctaatcatctcatgttcatgtcctac
KU576693_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576692_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576637_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576845_PreC_P-B      ttgcaacttt---tttacctctgcctaatcatctcatgttcatgtcctac
KU576766_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576681_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576647_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576630_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576240_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576619_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576620_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576629_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576633_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576640_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576645_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576656_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576698_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576704_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576714_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576738_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576748_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576751_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576874_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576623_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276808_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU919171_PreC_P-B      ttgcaatttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689481_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KM875427_PreC_P-B      atggaactttttcttcacctctgcctaatcatctcatgttcatgtcctac
KX276788_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AF157021_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF157022_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276814_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276809_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562296_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
AJ627225_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcatgttcatgtcctac
KY689417_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173373_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ904357_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341487_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341476_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341469_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276803_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341468_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924648_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ341467_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881861_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667956_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576950_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EF494381_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ751766_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ751769_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803756_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY167098_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY596105_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB555499_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcttgttcatgtcctac
EU939670_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ386660_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667905_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667597_PreC_P-B      atgcaacttt---ttcacctctgcctaaccatctcatgttcatgtcctac
KU667519_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667972_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667570_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576392_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667578_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576393_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571333_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023631_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX026879_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX429911_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP406172_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406170_PreC_P-B      ccgtattaca---ctcacctctgcctaatcatctcatgttcatgtcctac
KP406175_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406169_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcttgttcatgtcctac
KP406168_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
KP406174_PreC_P-B      nnnnnnnnnn---ntcacctctgcctaatcatctcatgttcatgtcctac
GQ924640_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924605_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993704_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939633_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
EU939634_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
AF282918_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
X97851_PreC_P-B        atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341497_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386688_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571367_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674422_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB302945_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB302942_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB302944_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB302943_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571339_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576778_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576237_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689453_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571338_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG571321_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668012_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX504531_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ040157_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689555_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341479_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341475_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571360_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276777_PreC_P-B      mtgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
KU668258_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377610_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269091_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcatac
MG571368_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668234_PreC_P-B      atgcaacatt---ttcacctctgcctaatcatctcatgttcatgccctac
KU667551_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC492739_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY167101_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctctcgttcatgtcctac
GQ924647_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073821_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576990_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
JQ040138_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ448622_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173384_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY596103_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774376_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173383_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173379_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY596104_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173377_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173380_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562219_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
FJ562237_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562303_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ755833_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcgtgttcatgtcctac
KJ803784_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571340_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY417926_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ803796_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ410490_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
KC774415_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
FJ562262_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY167100_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU939673_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269120_PreC_P-B      atgcaacttt---tttacctctgcctaatcatctcatgttcatgttctac
KU667507_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341472_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ843165_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562234_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF461360_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674506_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571323_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815574_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815577_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815578_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306677_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306679_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306680_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306678_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306681_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571373_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562236_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562224_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341494_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341491_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341481_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571374_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571372_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571361_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667560_PreC_P-B      atgcaacttt---ttcacccctgcctaatcatctcatgttcatgtcctac
KU576322_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576051_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576024_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575981_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX504538_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815639_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562257_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306699_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatcacatgttcatgtcctac
AF121247_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689491_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY470956_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY596109_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF335748_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386654_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EF494380_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993711_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993705_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341459_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674391_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774396_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576186_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX870001_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX507213_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ040169_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386636_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993699_PreC_P-B      atgcaacttt---ttgaactctgcctaatcatctcttgttcatgtcctac
GQ924631_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571334_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668093_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815701_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815699_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815706_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815710_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815707_PreC_P-B      atgcaacccc---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689408_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
JQ341501_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341485_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341473_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341462_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571349_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963816_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667823_PreC_P-B      atgcaacttt---ctcacctctgcctaatcatctcatgttcatgtcctac
KU577081_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctgc
KU576940_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576022_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173298_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774413_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX869998_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX661479_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
GQ924611_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY470960_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY470961_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963842_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963843_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963844_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963845_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963846_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963847_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963848_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963849_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963850_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963851_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963852_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963853_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963828_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963829_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963830_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963831_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963832_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963833_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963834_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963835_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963836_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963837_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963838_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963839_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963840_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963841_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963855_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173403_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173404_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144564_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144594_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341477_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668027_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667702_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386676_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144550_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY800389_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB246339_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB287328_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575927_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575922_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575982_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575976_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575959_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576740_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575983_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575979_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575975_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575973_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF100309_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575945_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575974_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575978_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575980_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575984_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575928_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF335746_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF335754_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689553_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667676_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatcccatgttcatgtcctac
KU668124_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668061_PreC_P-B      atgcaacttt---tacacctctgcctaatcatctcatgttcatgtcctac
KU576792_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576794_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576788_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576783_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576782_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576781_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576780_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576777_PreC_P-B      atgcaacctt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576784_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576785_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576793_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668115_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668133_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668149_PreC_P-B      gtgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF479684_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF121248_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576389_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576390_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576391_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576394_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341483_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571348_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY596110_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctctcgttcatgtcctac
AF233231_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963824_PreC_P-B      atgcaacttt---ttttcctctgcctaatcatctcatgttcatgtcctac
KU963854_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963825_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963814_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963815_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963817_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963818_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963820_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963821_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963822_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963823_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963826_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963827_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963819_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964158_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964154_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964168_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964153_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964159_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964160_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964167_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964156_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964157_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964161_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964162_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964163_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964166_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963960_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963962_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963963_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963964_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963965_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963968_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963969_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963970_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963971_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963972_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963973_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963974_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963975_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963961_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963966_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963967_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964111_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964113_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964115_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964120_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964108_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964119_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964109_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964110_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964112_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964114_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964116_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964118_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964121_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964122_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964117_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173339_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173340_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EF134945_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EF134946_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689554_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcatgttcatgtcctac
KY689538_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689508_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341490_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341489_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341484_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MH663473_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571371_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571364_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964164_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668108_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668099_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577003_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576040_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148582_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148332_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803764_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774404_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774393_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX507210_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ801471_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815572_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924606_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377561_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU796071_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306703_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY766463_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269095_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY167097_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF233235_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF121251_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073833_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
AB073831_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148366_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386582_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU439021_PreC_P-B      atgcaacttt---ttcacctctrmctaatcatctcatgttcatgtcctac
DQ448623_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341460_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341461_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341510_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341482_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341470_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341465_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341496_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KM392084_PreC_P-B      ---caaattt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ475340_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993700_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993701_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993702_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MH061283_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836861_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ801524_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815712_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815587_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ787444_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386584_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815739_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815722_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815700_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815696_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815695_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815680_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815705_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815709_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815688_PreC_P-B      atgcaacctt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB205119_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815679_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815681_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815683_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815684_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815685_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815686_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815687_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815689_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815691_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815692_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815693_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815694_PreC_P-B      -------ttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815697_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815698_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815702_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815703_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815704_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815708_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815711_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815713_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815715_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815716_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815717_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815718_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815719_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815720_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815721_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815723_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815724_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815725_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815726_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815727_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815728_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815729_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815730_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815731_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815732_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815733_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815734_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815735_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815736_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815737_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815738_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815740_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815741_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815742_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815743_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815744_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815745_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815746_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ410507_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ410516_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ410517_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073827_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815610_PreC_P-B      atgcaacccc---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815612_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815609_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815605_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815599_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815589_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815584_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815583_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815591_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815594_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815579_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815581_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815585_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815586_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815588_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815590_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815593_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815595_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815596_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815597_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815598_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815601_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815602_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815603_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815604_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815606_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815607_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815608_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815611_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815613_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815614_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815600_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX661483_PreC_P-B      atgcaacttt---ttcacgttagcctaatcatctcatgttcatgtcctac
GQ377639_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148342_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148348_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173389_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173390_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB300364_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073834_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571342_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ801507_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB471854_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB471855_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ040170_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ032357_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ032358_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576053_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576054_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577004_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576052_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576044_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576042_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576041_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576038_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576026_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774411_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX978431_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX429900_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576039_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576045_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576043_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815678_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815677_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815676_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815673_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815669_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815668_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815664_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815662_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815659_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815657_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815646_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815641_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815640_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815635_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815627_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815629_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815630_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815616_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815617_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815618_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815620_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815621_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815622_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815623_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815624_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815625_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815626_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815628_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815631_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815632_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815633_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815634_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815636_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815637_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815638_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815642_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815643_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815644_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815645_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815647_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815648_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815649_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815650_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815651_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815652_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815653_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815654_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815656_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815658_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815660_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815661_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815663_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815665_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815666_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815667_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815670_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815672_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815674_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815675_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815619_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173386_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EF473975_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ448626_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881721_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881722_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881723_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881724_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881725_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881726_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881727_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881728_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881729_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881730_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881731_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881732_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881733_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881734_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881735_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881740_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881741_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881745_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881746_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881747_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881752_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881753_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881756_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881757_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881759_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881760_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881761_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881778_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881779_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576873_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576869_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576866_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576867_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576870_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576871_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576872_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576868_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510641_PreC_P-B      atgcggcttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510649_PreC_P-B      atgcggcttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510652_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX429897_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924634_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510642_PreC_P-B      ccgcggcttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510655_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510646_PreC_P-B      ccgtggattt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510648_PreC_P-B      atgcggcttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510656_PreC_P-B      atgcggcttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510644_PreC_P-B      ccgtgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510653_PreC_P-B      atgcggcttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510658_PreC_P-B      atgcggcttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ562322_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306696_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306695_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306698_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306697_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY217359_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY217360_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815760_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ518812_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377537_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689479_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MK052965_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG826153_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571366_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571362_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571347_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571346_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571322_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674485_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX765856_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963951_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668069_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576325_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KR152339_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148581_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148364_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148345_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148335_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148329_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KM392072_PreC_P-B      atgcaacttt---ttgacctctgcctaatcatctcatgttcatgtcctac
KC774388_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774382_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX869999_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX429899_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ040171_PreC_P-B      atgcaaattt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ040125_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815558_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924607_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377625_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377547_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386684_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386666_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386610_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386583_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU796067_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU570069_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU522067_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU439020_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306712_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306707_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306702_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ448621_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatttcatgttcatgtcctac
DQ448619_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144591_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY220698_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY167089_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF121249_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF100308_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB287329_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB246340_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073840_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667427_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668002_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173399_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173400_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173382_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173413_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173374_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MK075117_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173369_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173370_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173363_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
KJ173364_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
GU815761_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815764_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144561_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144598_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144560_PreC_P-B      atgcaacttg---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144597_PreC_P-B      atgcaacttg---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668116_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668058_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668037_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668046_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306711_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173375_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173376_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148323_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148334_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148314_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ448625_PreC_P-B      atgcaccttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774409_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148363_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148356_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148333_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148326_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148321_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377641_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148317_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148322_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148325_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148361_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148318_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148319_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148320_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148324_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148327_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148328_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148330_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148331_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148357_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148359_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148360_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148362_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148365_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148341_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011084_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576328_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576324_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576321_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576319_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576326_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576327_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576320_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993709_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctctcgttcatgtcctac
DQ448624_PreC_P-B      atgcaacttt---ttcacctctgcctaatcattccatgttcatgtcctac
KR232337_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173416_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173417_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173397_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173398_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU796068_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173422_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173423_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924603_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689413_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571356_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571328_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674426_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY470962_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY470954_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY470953_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964165_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU964155_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963987_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963956_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963949_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148579_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173356_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173355_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774416_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KC774387_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774381_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774375_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774363_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510659_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX429908_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ801514_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ801479_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ040173_PreC_P-B      atgcaaattt---ttcacctctgcctaatcatctcatgttcatgtcctac
JN827419_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JN406371_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JF412801_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815780_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815765_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815754_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815753_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815752_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815751_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815573_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815554_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815550_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU451682_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU434372_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924627_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924610_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924608_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
GQ855522_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377638_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377588_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
GQ377587_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377542_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386668_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
FJ386655_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ386642_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023569_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU570071_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU570070_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU439023_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306709_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306705_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU139543_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993708_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993703_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993697_PreC_P-B      atgcaacttt---ttaacctctgcctaatcatctcatgttcatgtcctac
DQ993696_PreC_P-B      atgcaacttt---ttaacctctgcctaatcatctcatgttcatgtcctac
DQ975271_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ448628_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ144599_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY596102_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY293309_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073828_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963799_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963800_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963801_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963802_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963803_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963804_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963805_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963806_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963807_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963808_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963809_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963810_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963811_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963812_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963813_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148336_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148338_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148339_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148343_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148347_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173409_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173410_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173405_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173406_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173359_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173360_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173352_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173354_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836857_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836874_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774394_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148344_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815749_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815750_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815755_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815756_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815759_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815762_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815766_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815767_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815768_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815769_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815770_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815771_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815552_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815564_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815548_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815549_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815551_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815553_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815555_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815556_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815557_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815559_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815560_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815561_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815562_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815563_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815565_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815566_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815567_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815568_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815569_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815570_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815571_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815575_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU815576_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU434373_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963976_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963977_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963978_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963979_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963980_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963981_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963982_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963983_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963984_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963985_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963986_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963988_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963989_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ855532_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963945_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963946_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963947_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963948_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963950_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963952_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963953_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963954_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963955_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963957_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963958_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU963959_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377569_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774398_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377566_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377568_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU439018_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU439022_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306700_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306701_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306704_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306706_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306708_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU306710_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU305548_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JX429902_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY518556_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148583_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MK052962_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB675676_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377629_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148340_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB195933_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924653_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571369_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073829_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB195934_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB195935_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ448627_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU350409_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377612_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774399_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774403_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173343_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173345_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173365_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173366_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173424_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173425_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803763_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674427_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674449_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571344_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571365_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510643_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510647_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510650_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510651_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510654_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510657_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC510660_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073826_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269115_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ448620_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377558_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ377643_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GU357842_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JF775480_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JF775484_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JF899335_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ688405_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173351_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173353_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173361_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173367_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173381_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173387_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173388_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173407_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173408_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173414_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173415_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148346_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148349_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148580_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674512_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MG571355_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269135_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576069_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
KU576070_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcctac
KU667763_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667836_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667813_PreC_P-B      atgcaacttt---tccacctctgcctaatcatctcatgttcatgtcctac
KU667774_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667800_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667827_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667729_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667752_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgatcatgtcctac
KU667788_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB334303_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
AB355454_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
AB334302_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB334300_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB334301_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB334299_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB048705_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU679959_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023620_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023617_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023618_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023573_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ667207_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JF775482_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JF775483_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023630_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023629_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023628_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023627_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023613_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023610_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023608_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023605_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023607_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023609_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023611_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023612_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023614_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023606_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667929_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576380_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576385_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576379_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576381_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576383_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576773_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcacgtcctac
JQ341515_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
KU576064_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576495_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576501_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576500_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576496_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576507_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576277_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576279_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689468_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcttgttcatgtcctac
KU576618_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576624_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576660_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcttgttcatgtcctac
KU668105_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgtccatgtcctac
KU576653_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576648_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgtgcatgtcctac
KU576654_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcacgtcctac
KU576655_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576016_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576020_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576015_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcgtgttcatgtcctac
KU576018_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689496_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668059_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576979_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668335_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667445_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576980_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668344_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576975_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668345_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668323_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576978_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576982_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576983_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576984_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576985_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576981_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576420_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576397_PreC_P-B      atgcaacttt---ttcacctctgcctaatcagctcatgttcatgtcctac
KU668287_PreC_P-B      atgcaacttt---ttcgcctctgcctaatcatctcatgttcatgtcctac
KU576467_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667778_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668265_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576493_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668316_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgtacatgtcctac
KU667777_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667780_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668274_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576411_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcatgttcatgtcctac
KU576402_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576499_PreC_P-B      atgcacttcc---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576398_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668337_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668306_PreC_P-B      atgcaacttt---ttcacctctgcctgatcatctcatgttcatgtcctac
KU576413_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576408_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576407_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576395_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668297_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576406_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576470_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668256_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576466_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576401_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtccttc
KU576399_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576400_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576412_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576419_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667520_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576386_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689404_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689503_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576088_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667516_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576087_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576090_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576096_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576100_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576086_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576085_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576157_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576084_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576153_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668157_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576986_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668277_PreC_P-B      atgcgacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU667420_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU668170_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU668357_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU668366_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccat
KU668193_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576598_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576988_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576989_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576606_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU576597_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576609_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577107_PreC_P-B      agcacccttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576746_PreC_P-B      ttgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689451_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689426_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689520_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576283_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576280_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576287_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576292_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576289_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576291_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU577088_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667671_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667672_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576290_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689523_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgytcatgtcctac
AY269097_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689423_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667874_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667896_PreC_P-B      atgcaacttt---ttcacctcagcctaatcatctcatgttcatgtcctac
KU576638_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576639_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575966_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575971_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576522_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU577089_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ377158_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576691_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774419_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668173_PreC_P-B      atgcaacttt---ttcacctcagcctaatcatctcatgttcatgtcctac
KU667577_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689445_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KY689488_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576132_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575938_PreC_P-B      atgcacttcc---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575941_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668008_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcatgttcatgtcctac
KU667993_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcatgttcatgtcctac
KU667447_PreC_P-B      atgcaacctt---ttcacctctgcctagtcatctcatgttcatgtcctac
KU575942_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcatgttcatgtcctac
KU575937_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcatgttcatgtcctac
KU575940_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcatgttcatgtcctac
KY881864_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668216_PreC_P-B      atgcaacttt---ttcacctcagcctaatcatctcatgttcatgtcctac
AY269110_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689557_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667952_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576460_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ803801_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KF164967_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU667733_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575921_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667605_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU668324_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JX661482_PreC_P-B      atgcaacttt---ttcacgttagcctaatcatctcatgttcatgtcctac
GU827630_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667590_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
KU667407_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689410_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689505_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689506_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689507_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576191_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KF165906_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576970_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576968_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576969_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689564_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689433_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576331_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576189_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689458_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576251_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576255_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576254_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689448_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689534_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668336_PreC_P-B      atgcaacttt---ttcaccacagcctaatcatctcatgttcatgtcctac
KU667439_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667568_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU668250_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576150_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576155_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576149_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576154_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU576151_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB908303_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB908299_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB908300_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB908304_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836847_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836865_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836872_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689472_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689546_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689517_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AF335751_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576152_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575953_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU575977_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689480_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689563_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689443_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836830_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836843_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689477_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ173297_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836853_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576188_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341530_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576309_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269100_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcatac
KC836841_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836863_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC836864_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269131_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU576310_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667457_PreC_P-B      atgcaacttt---tccacctctgcctaatcatcccatgttcatgtcctac
KF165328_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KJ173341_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173342_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667484_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU667515_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276827_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcytac
JQ027311_PreC_P-B      atacaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924641_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276820_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924635_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
DQ993684_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY800391_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AY800392_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB976562_PreC_P-B      ctgcaacttt---ttaacctatgccttatcctctctcgttcatgtcctaa
JQ341493_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MG826152_PreC_P-B      ctgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674492_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX765854_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MF674478_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MF674436_PreC_P-B      atgcaacttt---ttcacctctgcctaatcacctcttgttcatgtcctac
MF674439_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924656_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689484_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY689556_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924638_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
LC349868_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276830_PreC_P-B      attcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011094_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM011467_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276824_PreC_P-B      aggcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924628_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB115551_PreC_P-B      atgcaacttt---ttgaattctgcctagtcatctctcgttcatgtcctac
MF674476_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctctcgttcatgtcctac
KX276817_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803819_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924639_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB219429_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993683_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276828_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcatgttcatgtcctac
AB100695_PreC_P-B      atgcaacttt---ttgaattctgcctaatcatctcatgttcatgtcctac
DQ993687_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB713531_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ027316_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
LC349877_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB219427_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011093_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KF167010_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023633_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ855526_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011086_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011087_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674407_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674481_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881956_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881955_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881949_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881951_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881958_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881945_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881957_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881948_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881946_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881947_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881950_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881952_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881953_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881944_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY881954_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924625_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358144_PreC_P-B      atgcaacttt---ttcccctctgcctaatcatctcatgttcatgtcctac
EF473977_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EF473971_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269108_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcatac
KY629635_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774369_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774418_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KY629636_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173401_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ173402_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KC774370_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ707762_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707750_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707744_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707742_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707734_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707737_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707738_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707739_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707743_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707747_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707749_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707755_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707758_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707759_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707763_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707764_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707765_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707767_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707735_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707740_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707745_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707746_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707753_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707766_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707741_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707760_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707751_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707736_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707748_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707752_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707756_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707757_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707761_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
JQ707754_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcctgttcatgtcccac
AB241116_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB241117_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ429079_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB713528_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB493833_PreC_P-B      atgcaacttt---ttcacctctgcctaattatatcttgttcatgtcctac
LC349878_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HQ700546_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993681_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB713532_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358143_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023634_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023576_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993685_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB355455_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatcacttgttcatgtcctac
AB219428_PreC_C-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB493827_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148416_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148437_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148373_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148392_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148391_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148396_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148394_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148388_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148382_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148378_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148371_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148368_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148369_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148370_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148372_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148374_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148375_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148376_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148377_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148379_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148380_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148383_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148384_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148385_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148386_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148387_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148389_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148390_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148395_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148397_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148398_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148400_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148401_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148402_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148403_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148451_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148367_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148415_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148426_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148407_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148433_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148418_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148438_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148435_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148414_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148405_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148425_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148423_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148421_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148420_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148413_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148411_PreC_P-B      atgcaacttt---ttcacctctacctaatcatctcatgttcatgtcctac
KP148410_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148424_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148429_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148440_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148406_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148419_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148427_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148430_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148439_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148409_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341464_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674487_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctctcgttcatgtcctac
MF674448_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674433_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358148_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358137_PreC_P-B      atgcaacttt---ttcccctctgcctaaacatctcatgttcatgtcctac
AM888201_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB219426_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023636_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023632_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX765841_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358149_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358152_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011096_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358150_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358151_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674515_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358139_PreC_P-B      atgcaacttt---ttcacctctgcctaaacatctcatgttcatgtcctac
AP011089_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993707_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY033072_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY033073_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993706_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB073835_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674409_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674479_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674443_PreC_P-B      atgcaacttt---ttcgcctctgcctaatcatctcatgttcatgtcctac
MF674419_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674392_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674389_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674382_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
LC416037_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
LC349871_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924621_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
GQ358140_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB231909_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674396_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB355453_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674497_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674509_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HQ700549_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EF473976_PreC_P-B      atgcaacttt---ttcacctctgcctaaacatctcatgttcatgtcctac
DQ993694_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB713527_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011090_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358138_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011095_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674451_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674462_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674490_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674461_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674438_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674421_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674394_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358141_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ349236_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011091_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU234318_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674483_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674410_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674513_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674424_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674397_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674387_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674416_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674460_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023635_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674431_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674453_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674488_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674384_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924651_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924654_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674452_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674510_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674507_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674495_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674456_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674423_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674401_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358142_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011088_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674393_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674395_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674413_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674482_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674500_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011092_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924645_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803824_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674440_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276829_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcwtgttcatgtcctac
KJ803775_PreC_P-B      atgcaacttt---ttcaccttctcctaatcatctcatgttcatgtcctac
HM011490_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276823_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctay
KX276821_PreC_P-B      acgcaacttt---ttcacctctgcctaatcatctcmtgttcatgtcctac
JQ027334_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KX276825_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ924617_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB713529_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276818_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ341499_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
LC349879_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358145_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
GQ358146_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctaatgttcatgtcccac
GQ358147_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
JQ429080_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB713530_PreC_P-B      atgcaacttc---tccaccttagcctcatcatctcaggttcatgtcctac
DQ361535_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023637_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
EU330996_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU330989_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU330990_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU330997_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU330992_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU330994_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU330998_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU330999_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU331000_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU331001_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU330995_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023575_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148459_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcgtgttcatgtcctac
KP148458_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148460_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
FJ023638_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148453_PreC_P-B      atgcaacttt---ttcacctccgcctaatcatctcatgttcatgtcctac
KP148461_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcgtgtcctac
KP148457_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148455_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148456_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KP148452_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
LC349869_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
LC349874_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
LC349875_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341502_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM011492_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
LC349872_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ429082_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ429081_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB493835_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EF473972_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctag
M54923_PreC_P-B        atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB033554_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB219430_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB033555_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctat
HQ700548_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KJ803787_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
LC349873_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AP011085_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
D00331_PreC_C-B        atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
GQ358136_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577070_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
KU577076_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KU577077_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
GQ924626_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276815_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
HM011469_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
KX276822_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB368295_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
LC349870_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB212625_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
AB205122_PreC_P-B      atgcaacttt---ttcacctctgcctaatcacctcttgttcatgtcctac
JQ341463_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
DQ993680_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674441_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF621878_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB031267_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MF674385_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcccac
MF674415_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
JQ341504_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674459_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674434_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674470_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674496_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB212626_PreC_P-B      atgcaacttt---ttcacctctgcctagtcatctcttgttcatgtcctac
MF674505_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
DQ993686_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674473_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674447_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
JQ341486_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674491_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU660230_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU660231_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU660232_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
EU660233_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674406_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674508_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674420_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
AB117759_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AB031266_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MF674445_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674499_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674446_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674466_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
AY269093_PreC_P-B      tttcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674498_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674469_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcttgttcatgtcctac
MF674414_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674400_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674455_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674437_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674493_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674477_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674432_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674383_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674404_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674405_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
MF674511_PreC_P-B      atgcaacttt---ttcacctctgcctaatcatctcatgttcatgtcctac
                                                                  *      

KP659255_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659221_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP659250_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB287317_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB287318_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659219_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659240_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP659244_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB287323_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP659239_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP659248_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB287320_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB287324_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB287321_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP659252_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659253_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659245_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP659251_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN792901_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN792902_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB287319_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659224_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659254_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ463795_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ463796_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ463799_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463787_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463791_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463802_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP659223_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659220_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463792_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463800_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN792898_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN792897_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB287325_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463801_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN792893_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463793_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JN792894_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463797_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN792895_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ463789_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JN792896_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP659249_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB287322_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ463798_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN792899_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463790_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JN792900_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB287316_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
DQ463794_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ463788_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP659234_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP659235_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB287314_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB287315_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP659247_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP659237_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP659246_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB642093_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB300371_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB828708_PreC_P-B      kgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB073849_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB900097_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB900096_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB073853_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB302095_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB073854_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
AB900102_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB931168_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
AB931169_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
AB073858_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB106884_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB900103_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacatcg
AB900112_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
D50521_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
D50522_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
AB900108_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB900098_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB362933_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073838_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB900106_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB642101_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB073855_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB073847_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073856_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB014366_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB073857_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073852_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB900111_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB287327_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB900105_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
D00329_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073851_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB900104_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB073845_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB900107_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB300370_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB010292_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB010290_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB010291_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
LT992442_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073850_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB073842_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073844_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB900095_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH932712_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB246343_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
D23679_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB010289_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB246341_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB205121_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073846_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB073848_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC279268_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC279269_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC279270_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC279271_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC279272_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
LC279273_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB246342_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB287326_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB073843_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
D23678_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ993682_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ027312_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276819_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276792_PreC_P-B      tkttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
KY881837_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM011477_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276795_PreC_P-B      tkttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MK818222_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576893_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576894_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576895_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
KU576897_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576750_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576896_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576898_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggttttaggacatggacatcg
KU576892_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576890_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576889_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576888_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576886_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576891_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU576887_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU668036_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU668004_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU667988_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU668045_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggccttaggacatggacatcg
HM011496_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggayatyg
HM011482_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276797_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276789_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ995804_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KX276798_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
KM875418_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276800_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276775_PreC_P-B      tgttcaagcctctaagctgtgccttaggtggctttagggcatggacattg
KX276812_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggrcatggacatyg
HM011484_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM011487_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571326_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MG571329_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668369_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576713_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576708_PreC_P-B      tgttcaagcctccaagctgcgccttgggtggctttgggacatggacattg
KU576709_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576820_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576702_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576707_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576710_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576706_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576700_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576701_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576705_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU668309_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU668332_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU667987_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576718_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU667997_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU668003_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU668359_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MK818225_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571352_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MK818223_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ924630_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939636_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KF166001_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KY689406_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
HM011466_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803816_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276804_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM011470_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY596111_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX276770_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
EU522072_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
EU522073_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
EU522075_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
KX276778_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggayattg
FJ386648_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX276813_PreC_P-B      tkttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
KU667944_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667951_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668229_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576622_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668259_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668249_PreC_P-B      tgtccaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668278_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668202_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668238_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576616_PreC_P-B      tgttcaagcctccaagccgtgccttgggtggctttaggacatggacattg
KU576611_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576613_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668290_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU939677_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY167102_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881845_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatta
EU487257_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667825_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576876_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667773_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667668_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667835_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
HM011494_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM011503_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB073839_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ410502_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X98077_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
DQ993698_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ993710_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341474_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KT749820_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
MF674464_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ924660_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU522074_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacatcg
KU964152_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964147_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964138_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964139_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964140_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964142_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964144_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964145_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964148_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964150_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964151_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964141_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964143_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964146_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964149_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774397_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU939665_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
AY163869_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY163870_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173371_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173372_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689419_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AF157020_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ790200_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
GQ377606_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341471_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803755_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803758_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667801_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668243_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667730_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667828_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881869_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatgggcattg
KY881853_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881849_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881865_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY217355_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY217356_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ386680_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JX504543_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386615_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667789_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY217361_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173347_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173348_PreC_P-B      tggtcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667591_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667796_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667784_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667612_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576804_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576806_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571370_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667581_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562321_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881867_PreC_P-B      tgttcacgcctccaagctgtgccttgggtggctttaggacatggacattg
KY881856_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881905_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
KY881844_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881863_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881903_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881902_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881912_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881909_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881862_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881854_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881846_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881911_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
KY881898_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
KY881857_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
KY881847_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
KY881895_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggacatggacattg
KY881848_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KY881906_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KY881908_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881904_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881899_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881893_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881859_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881894_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881897_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881901_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881855_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881860_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881852_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881858_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881866_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881868_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881896_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881900_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881907_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881910_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881913_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881914_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY881851_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667637_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667649_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576621_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576617_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576612_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576614_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881838_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcgtggacattg
GQ377622_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881833_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939660_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881830_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964394_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964244_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964246_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964251_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964253_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964254_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964247_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964249_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964245_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964255_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964256_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964248_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881826_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881834_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881825_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881829_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881823_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881841_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881827_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881836_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881843_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881828_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881831_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881821_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881824_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881835_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881822_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881842_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881820_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881839_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576938_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774405_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667574_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964137_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964123_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964124_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964128_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964129_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964131_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964134_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964136_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964127_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964132_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964126_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964130_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964133_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964135_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964125_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386669_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571363_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576807_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576809_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JX661480_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121250_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964080_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964082_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964091_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964084_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964088_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964087_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964089_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964090_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964092_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964086_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964085_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964079_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964081_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964083_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KT749851_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964287_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964289_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964290_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964291_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964292_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964293_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964294_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964295_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964296_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964297_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964298_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964299_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964300_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964301_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964302_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964288_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562240_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF674450_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939637_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562254_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073823_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571324_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF157023_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF157024_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF157025_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689511_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144544_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144554_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY217357_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY217358_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144600_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144585_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144596_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144593_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144587_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144583_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144581_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144574_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144570_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggccatggacattg
DQ144569_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144551_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144559_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144589_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144606_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144592_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144584_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144582_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144579_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144576_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144545_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144565_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144590_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144556_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144595_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144548_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144558_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144575_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144543_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144552_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144555_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144546_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144557_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144567_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144578_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144586_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774367_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774362_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
GQ377582_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY596106_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX661477_PreC_P-B      tgttcaagccctccagctgtgccttgggtggctttggggcatggacattg
KU576939_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774377_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX661476_PreC_P-B      tgttcatactaggaagctgtgccttgggtggctttggggcatggacattg
KC774412_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774372_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JX661470_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774406_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774401_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774390_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774378_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774384_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774366_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KM392083_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661478_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661484_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661473_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661472_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661474_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661475_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661481_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661471_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774410_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774383_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774389_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774371_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774407_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774365_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774395_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774417_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774402_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774391_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774379_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774385_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774373_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KC774380_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774386_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774392_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774368_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KC774374_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
HM011478_PreC_P-B      tgttcaagcctccragctgtgccttgggtggctttaggacatggacattg
KU964280_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964286_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964276_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964283_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964274_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964282_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964273_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964275_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964278_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964279_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964281_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964272_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964284_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964277_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU964285_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276791_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576125_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576126_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576130_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576131_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576127_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM875420_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ562260_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatyg
EU547563_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
EU939678_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KX276793_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
AY206383_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ562312_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU158263_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB073841_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU579441_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU570075_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ032344_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU589335_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386656_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341503_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571357_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689490_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY689559_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY689560_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU577047_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577046_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577048_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ027315_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276771_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
HM011476_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939674_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ899790_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ899791_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276806_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ027325_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276801_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY269128_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM011480_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ027329_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB900110_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacatcg
GQ377644_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341508_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939635_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803789_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
JQ341480_PreC_P-B      tkttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406276_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406277_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406275_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406278_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406272_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406263_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406274_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406264_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406255_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406265_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406268_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406270_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406279_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406261_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406163_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ801516_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406184_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406176_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KP406178_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KP406180_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KP406181_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KP406183_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KP406185_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KP406177_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406179_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406182_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406197_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406219_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406186_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406187_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406189_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406192_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406194_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406198_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406199_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406203_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406208_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406210_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406214_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406216_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406188_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406195_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406200_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406217_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406201_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406190_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406212_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406191_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406193_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406196_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406202_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406204_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406205_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406206_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406207_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406209_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406211_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406213_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406215_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406218_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406165_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406167_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406171_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406173_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406241_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406232_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406243_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406237_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406236_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406234_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406238_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406240_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406220_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406221_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406222_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406223_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406224_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406225_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406227_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406228_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406229_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406230_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406231_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406233_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406235_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406242_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406331_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406330_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406332_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406334_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406333_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406335_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406318_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406319_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406320_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406321_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406322_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406324_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406325_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406326_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406327_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406328_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406329_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406323_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406164_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406162_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406166_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406273_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406262_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406266_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406269_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406271_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406260_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406257_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406280_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406249_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406246_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406244_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406247_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406248_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406251_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406252_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406253_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406254_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406245_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406250_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406258_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406256_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406259_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406267_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406283_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406282_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406290_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406291_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406294_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406281_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406293_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406284_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406286_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406289_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406285_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406287_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406292_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406303_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KP406299_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406311_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406307_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406308_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406309_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406310_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406313_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406315_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406316_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406302_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406288_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406298_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406296_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406300_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406305_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406306_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406312_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406314_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406297_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KP406317_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406301_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KP406304_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
X97850_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576924_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668361_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668360_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667413_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668322_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668354_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576923_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668371_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668343_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667603_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668334_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY220697_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964258_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964270_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964266_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964257_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964259_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964261_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964262_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964263_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964265_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964267_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964268_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964269_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964271_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964260_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964264_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ787475_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ787476_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB073825_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU939671_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU919175_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU919176_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689476_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB555498_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803768_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562222_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB365445_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276810_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattg
KU668070_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562259_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY269109_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU487256_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU660224_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667714_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576342_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576853_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576340_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668138_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668088_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576344_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU668063_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667719_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667716_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU577092_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667720_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667718_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggcttcaggacatggacattg
KU667717_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576341_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576345_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU667721_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667715_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576343_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667713_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU667712_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668104_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668130_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668111_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668074_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668122_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ386658_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576300_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576307_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576305_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576303_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576306_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576304_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576299_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576308_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576288_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576295_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576302_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF282917_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM213035_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JF436921_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU939663_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073830_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668081_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668019_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668060_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667680_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY596112_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939669_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ899779_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KX276773_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939639_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
FJ899786_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ899787_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939672_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ899784_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ899785_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM213032_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX429901_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173378_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY220703_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY220704_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU882003_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU882004_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ562253_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY206375_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386681_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073837_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571327_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX504532_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562231_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF233234_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB642094_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY470834_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470837_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470841_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470832_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470840_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470833_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470836_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY470839_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY470830_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470835_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470838_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571350_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM213034_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ040147_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU881997_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU881998_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM213036_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM875416_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM875417_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ032349_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386675_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ562289_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576297_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377519_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964381_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964382_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964383_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964384_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964385_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964388_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964391_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964393_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964395_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964397_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964386_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964387_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964389_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964390_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964392_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
KU964396_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcg
GQ924637_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276776_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrggacatggacattg
KX276811_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
FJ562246_PreC_P-B      tkttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EF494382_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AY206391_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KX276781_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY206390_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY238972_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KM875426_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ995802_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY689469_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689516_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689414_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrggrcatggacattg
KC492740_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ995805_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KY689500_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KJ803795_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803781_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803783_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803752_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU939638_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ032353_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ032352_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ032354_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX276805_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689494_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KY689562_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU939559_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU882002_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AY217364_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU577118_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EF473974_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881792_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP036970_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX429910_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF473973_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173418_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173419_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU577113_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC774400_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX026881_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU796066_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377525_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571331_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881850_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX026886_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386682_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939664_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB205120_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ518811_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173411_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173412_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM153811_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576803_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576808_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ562316_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ040128_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576879_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576875_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576877_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ592177_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ751767_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881789_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcacggacattg
KY881783_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576046_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803817_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377550_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU522066_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
DQ995801_PreC_P-B      tgtccaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073822_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386600_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881799_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881794_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881798_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881796_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacaccg
KY881808_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881797_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881790_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881788_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881786_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881780_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881781_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881782_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881784_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881787_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881791_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881793_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881800_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881801_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881795_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU939666_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
D00330_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF335738_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576472_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052964_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881785_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF461362_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377567_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964093_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964095_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964097_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964099_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964103_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964106_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964094_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU939676_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF335740_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF335741_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774408_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674480_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964101_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964096_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964098_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964100_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964102_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964105_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964107_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964104_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571341_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ801512_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM359440_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173420_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173421_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121243_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121244_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121245_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121246_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX507215_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ410500_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667891_PreC_P-B      tgctcaagcctccgagctgtgccttgggtggctttggggcatggacattg
KU667659_PreC_P-B      tgttcaggcctccaagctgtgccttgggtggctttggggcatggacattg
KU668167_PreC_P-B      tgttcaagcctctaagctgtgccttgggtggctttagggcatggacatta
KU667492_PreC_P-B      tgtacaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667859_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667936_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667840_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668367_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576387_PreC_P-B      tgtttaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668132_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668169_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668308_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667619_PreC_P-B      tgttcaagcctccaagctgtgccttgggtgactttggggcatggacgttg
KU668103_PreC_P-B      tgttcaagcctccaagctgtgccttgggtgactttggggcatggacgttg
KU667938_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667422_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667540_PreC_P-B      tgttcaagcctccgagctgtgcctggggtggctttggggcatggacattg
KU667438_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667493_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667569_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667460_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667469_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667508_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667412_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668358_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668318_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668330_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667448_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667955_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667996_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668289_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668076_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668009_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667879_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667700_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668299_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667980_PreC_P-B      tgttcaagcctacaagctgtgccttgggtggctttggggcatggacattg
KU668300_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668307_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667640_PreC_P-B      tgttcaagcctccaagcagtgccttgggcggctttggggcatggacattg
KU668305_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcgtggacattg
KU667957_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667812_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668304_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcacggacattg
KU667740_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF568475_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667506_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668014_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667586_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667968_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667647_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667455_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668165_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667787_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667473_PreC_P-B      tgatcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667817_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667481_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667701_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667794_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667768_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU564825_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU564826_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KJ803786_PreC_P-B      tgttcaagcctccaagttgtgccttgggtggctttagggcatggacattg
KX276783_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576101_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576106_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576114_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576111_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576113_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576108_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576109_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576112_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576105_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctgtagggcatggacattg
KU576107_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatgaacattg
GQ924646_PreC_P-B      tgttcaagcctccgagctgtgccttgagtggctttagggcatggacattg
MG372436_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276786_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576180_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576636_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576338_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576165_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576173_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576185_PreC_P-B      tgttcaagcctccaagctgtgcctcgggtggctttaggacatggacattg
KX276785_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803805_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ801506_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JQ341488_PreC_P-B      tgttcaagcctcyaagctgtgccttgggtggctttagggcatggacattg
KX276784_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY217362_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803808_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073836_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX504533_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576921_PreC_P-B      tattcaagcctccaagctgtgccttgagtggctttaggacatggacattg
KU668232_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668261_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668241_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668270_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668252_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668222_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668342_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668353_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668333_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EU158262_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ787477_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173385_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576293_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576301_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF480353_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480349_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480341_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480343_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480363_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480351_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480337_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggccttggggcatggacattg
AF480344_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480342_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480356_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480355_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggcttaggggcatggacattg
AF480339_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480357_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480345_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480338_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480362_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480364_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480348_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480346_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480359_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480360_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480361_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480352_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480350_PreC_P-B      tgttcgagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480358_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480354_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480340_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF480347_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173362_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ144602_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY167094_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667546_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939679_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667739_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803820_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX026883_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689551_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173368_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667555_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689513_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689514_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667708_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667686_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386634_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815747_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815748_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF233237_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU305547_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668101_PreC_P-B      tgttcaagcctccaagctgtgcctcgggtggctttagggcatggacattg
KU667869_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667860_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577120_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815778_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ924644_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815783_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815777_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815776_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815775_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815773_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815772_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815774_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815779_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815781_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815782_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815757_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF674503_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU595031_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173357_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668100_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577121_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577117_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386683_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577111_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577115_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667695_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668097_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668098_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668102_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939667_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF674465_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU919172_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU919173_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM011499_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrggrcatggacattg
KX276858_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrggrcatggacattg
HM011475_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatyg
JQ027313_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276794_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571375_PreC_P-B      ggttcaagcgtgcaagctgtgccttgggtggttttaggacatggacattg
KX276787_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276779_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KX276802_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571325_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276796_PreC_P-B      ttttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
EU564822_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU564824_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU564823_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276807_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ027330_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
JQ027331_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
AB073832_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341495_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341492_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803797_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM011483_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571358_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803773_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KX276772_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
JQ801494_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacatcg
JQ341498_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
KX276816_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatyg
AY206387_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667549_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668293_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576749_PreC_P-B      tgttcaagcctccaagctgtgccttgggtgactttagggcatggacattg
KU667539_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576628_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatgg
KU576145_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576736_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667528_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667517_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668302_PreC_P-B      tgttcaagcctccaagcagtgccttgggtggctttagggcatggacattg
KU576418_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KU576416_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KU576415_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KU576414_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KU576417_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
KU668150_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU668188_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU668171_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU668195_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
FJ562311_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX276790_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY689402_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KY689501_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
KY689502_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
FJ032342_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
HM011473_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571337_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
HM011471_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MG571353_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571376_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667531_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276774_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttgggacatggacattg
MG571336_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939675_PreC_P-B      ttttcaagcctccaagctgtgccttaggtggctttagggcatggacatcg
HM011474_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU939661_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY167093_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
HM011504_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KY689483_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073824_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276799_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576600_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803825_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ924624_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ341466_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttagggcatggacattg
MG571351_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689444_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924632_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ801474_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MG571354_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667858_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY269105_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ995803_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KX276782_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576148_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576146_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803821_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386608_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY269102_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576848_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576753_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576765_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576632_PreC_P-B      tgttcaagcctccaagctgtgccttgggtgactttggggcatggacattg
KU576703_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576626_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576641_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576856_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576854_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576843_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576754_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576693_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576692_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576637_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576845_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576766_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576681_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576647_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576630_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576240_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576619_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576620_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576629_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576633_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576640_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576645_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576656_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576698_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576704_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576714_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576738_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576748_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576751_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576874_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576623_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX276808_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU919171_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689481_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KM875427_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276788_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF157021_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF157022_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276814_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276809_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ562296_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacatyg
AJ627225_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KY689417_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173373_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ904357_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JQ341487_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
JQ341476_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341469_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX276803_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341468_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924648_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341467_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
KY881861_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggcttttgggcatggacattg
KU667956_PreC_P-B      tgttaaagcctccaagctgtgccttgggcggctttggggcatggacattg
KU576950_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
EF494381_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
FJ751766_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ751769_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803756_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY167098_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY596105_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB555499_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939670_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
FJ386660_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667905_PreC_P-B      tgttcaggcctccaagctgtgccttgggtggctttagggcatggacattg
KU667597_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667519_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667972_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667570_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576392_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667578_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576393_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571333_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ023631_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX026879_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
JX429911_PreC_P-B      tgttcaagcctccaagctatgccttgggtggctttgggacatggacattg
KP406172_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406170_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406175_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406169_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406168_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP406174_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924640_PreC_P-B      tgttcaagcctccaagctgtgccttggttggctttggggcatggacattg
GQ924605_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993704_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU939633_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
EU939634_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AF282918_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
X97851_PreC_P-B        tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341497_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386688_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571367_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF674422_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB302945_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB302942_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB302944_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
AB302943_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MG571339_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576778_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576237_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689453_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571338_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571321_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU668012_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX504531_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ040157_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689555_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341479_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341475_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571360_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX276777_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
KU668258_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacactg
GQ377610_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY269091_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571368_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668234_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667551_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC492739_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY167101_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ924647_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073821_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576990_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ040138_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
DQ448622_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173384_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY596103_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KC774376_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173383_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173379_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY596104_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173377_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173380_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562219_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562237_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562303_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ755833_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803784_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MG571340_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY417926_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ803796_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ410490_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774415_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562262_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY167100_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU939673_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY269120_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667507_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgaggcatggacattg
JQ341472_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ843165_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ562234_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF461360_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MF674506_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571323_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815574_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815577_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815578_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU306677_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306679_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU306680_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU306678_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
EU306681_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571373_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562236_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ562224_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341494_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341491_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
JQ341481_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571374_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571372_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MG571361_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667560_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576322_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttggggcatggacattg
KU576051_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576024_PreC_P-B      tgttcaagcttccaagctgtgccttgggtggctttggggcatggacattg
KU575981_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX504538_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacactg
GU815639_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ562257_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306699_PreC_P-B      tgttcaagcctccaagctgtgcctggggtggctttggggcatggacattg
AF121247_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KY689491_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY470956_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY596109_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF335748_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386654_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF494380_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993711_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993705_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggccattg
JQ341459_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674391_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774396_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576186_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JX870001_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX507213_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ040169_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386636_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993699_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ924631_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571334_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668093_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815701_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815699_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815706_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815710_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815707_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689408_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
JQ341501_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341485_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341473_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341462_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571349_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963816_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667823_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU577081_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576940_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576022_PreC_P-B      tgttcaagcctccaagctgtgcctcgggtggctttggggcatggacattg
KJ173298_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774413_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX869998_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661479_PreC_P-B      tgttcaagcctcccagctgtgccttgggtggctttggggcatggacattg
GQ924611_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470960_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470961_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963842_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963843_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963844_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963845_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963846_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963847_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963848_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963849_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963850_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963851_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963852_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963853_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963828_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963829_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963830_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963831_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963832_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963833_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963834_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963835_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963836_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963837_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963838_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963839_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963840_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963841_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963855_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173403_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173404_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ144564_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ144594_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341477_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668027_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667702_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386676_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ144550_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY800389_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB246339_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB287328_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575927_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575922_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575982_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575976_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575959_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576740_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575983_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575979_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575975_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU575973_PreC_P-B      tgttcaagcccccaagctgtgccttgggtggctttggggcatggacattg
AF100309_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575945_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575974_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575978_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575980_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575984_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575928_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF335746_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF335754_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689553_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667676_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668124_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668061_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576792_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgaggcatggacattg
KU576794_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576788_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576783_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576782_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576781_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576780_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576777_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576784_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576785_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576793_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668115_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668133_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668149_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF479684_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121248_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576389_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576390_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576391_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576394_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JQ341483_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattg
MG571348_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY596110_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF233231_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963824_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963854_PreC_P-B      tgtgcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963825_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963814_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963815_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963817_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963818_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963820_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963821_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963822_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963823_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963826_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963827_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963819_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964158_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964154_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964168_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964153_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964159_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964160_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964167_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964156_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964157_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964161_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964162_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964163_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964166_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963960_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963962_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963963_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963964_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963965_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963968_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963969_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963970_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963971_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963972_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963973_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963974_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963975_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963961_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963966_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963967_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964111_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964113_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964115_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964120_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964108_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964119_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964109_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964110_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964112_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964114_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964116_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964118_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964121_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964122_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU964117_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173339_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173340_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF134945_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF134946_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689554_PreC_P-B      tgttcaagcctccaagctgtgccttggggggctttggggcatggacattg
KY689538_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689508_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341490_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341489_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341484_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MH663473_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571371_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571364_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964164_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668108_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668099_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU577003_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576040_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggcttcggggcatggacattg
KP148582_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148332_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803764_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774404_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774393_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX507210_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ801471_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815572_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924606_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377561_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU796071_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306703_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY766463_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY269095_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY167097_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AF233235_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121251_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB073833_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073831_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148366_PreC_P-B      tgctcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386582_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU439021_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ448623_PreC_P-B      tgttcaagcctgcaagctgtgccttgggtggctttggggcatggacattg
JQ341460_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341461_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341510_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341482_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341470_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341465_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341496_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM392084_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ475340_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993700_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993701_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993702_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MH061283_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836861_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ801524_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815712_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815587_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ787444_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386584_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815739_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815722_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatgggcattg
GU815700_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815696_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815695_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815680_PreC_P-B      tgttcaagcctccaagttgtgccttgggtggctttggggcatggacattg
GU815705_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815709_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815688_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB205119_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815679_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815681_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815683_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815684_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815685_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815686_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815687_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815689_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815691_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815692_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815693_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815694_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815697_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815698_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815702_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815703_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815704_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815708_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815711_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815713_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815715_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815716_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815717_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815718_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815719_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815720_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815721_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815723_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815724_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815725_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815726_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815727_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815728_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815729_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815730_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815731_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815732_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815733_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815734_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815735_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815736_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815737_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815738_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815740_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815741_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815742_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815743_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815744_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815745_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815746_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ410507_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ410516_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ410517_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073827_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815610_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815612_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815609_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815605_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815599_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815589_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815584_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
GU815583_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815591_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815594_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815579_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815581_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815585_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815586_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815588_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815590_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815593_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815595_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815596_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815597_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815598_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815601_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815602_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815603_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815604_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815606_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815607_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815608_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815611_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815613_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815614_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815600_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX661483_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377639_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148342_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148348_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173389_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173390_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB300364_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073834_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571342_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ801507_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB471854_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB471855_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ040170_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ032357_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ032358_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576053_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576054_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU577004_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576052_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576044_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576042_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576041_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576038_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576026_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774411_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX978431_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX429900_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576039_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576045_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576043_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815678_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815677_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815676_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815673_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815669_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815668_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815664_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815662_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815659_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815657_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815646_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815641_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815640_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815635_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815627_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815629_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815630_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GU815616_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815617_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815618_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815620_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815621_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815622_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815623_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815624_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815625_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815626_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815628_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815631_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815632_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815633_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815634_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815636_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815637_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815638_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815642_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815643_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815644_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815645_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815647_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815648_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815649_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815650_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815651_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815652_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815653_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815654_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815656_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815658_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815660_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815661_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815663_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815665_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815666_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815667_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815670_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815672_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815674_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815675_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815619_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173386_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EF473975_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ448626_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881721_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881722_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881723_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881724_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881725_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881726_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881727_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881728_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881729_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881730_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881731_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881732_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881733_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881734_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881735_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881740_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881741_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881745_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881746_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881747_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881752_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881753_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881756_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881757_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881759_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881760_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881761_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881778_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881779_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576873_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576869_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576866_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576867_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576870_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576871_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576872_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576868_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510641_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510649_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510652_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX429897_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924634_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510642_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510655_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510646_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510648_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510656_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510644_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510653_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510658_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ562322_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306696_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306695_PreC_P-B      tgttcaagcctccaagctctgccttgggtggctttggggcatggacattg
EU306698_PreC_P-B      tgttcaagcctccaagctctgccttgggtggctttggggcatggacattg
EU306697_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY217359_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY217360_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815760_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ518812_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377537_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689479_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MK052965_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG826153_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571366_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MG571362_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571347_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571346_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571322_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674485_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX765856_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963951_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668069_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576325_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KR152339_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148581_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148364_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148345_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148335_PreC_P-B      tgttcaagcctccaagctgtgccctgggtggctttggggcatggacattg
KP148329_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KM392072_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774388_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774382_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX869999_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX429899_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ040171_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ040125_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815558_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcgtggacattg
GQ924607_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377625_PreC_P-B      tgttcaagcctccaaactgtgccttgggtggctttggggcatggacattg
GQ377547_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ386684_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386666_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386610_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386583_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU796067_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU570069_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU522067_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU439020_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306712_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306707_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306702_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ448621_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ448619_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ144591_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY220698_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY167089_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF121249_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF100308_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB287329_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB246340_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
AB073840_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667427_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668002_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KJ173399_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173400_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173382_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173413_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173374_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK075117_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173369_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173370_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173363_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173364_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815761_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggccttggggcatggacattg
GU815764_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggccttggggcatggacattg
DQ144561_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ144598_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ144560_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ144597_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668116_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668058_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668037_PreC_P-B      tgttcaagcctccaagctgtgcctcgggtggctttggggcatggacattg
KU668046_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306711_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173375_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173376_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148323_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148334_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148314_PreC_P-B      tgttcaagcctccaagctgtgccttgggtgactttggggcatggacattg
DQ448625_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774409_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148363_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148356_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148333_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148326_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148321_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377641_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148317_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148322_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148325_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148361_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148318_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148319_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148320_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148324_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148327_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148328_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148330_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148331_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148357_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148359_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148360_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148362_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148365_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148341_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AP011084_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576328_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576324_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576321_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576319_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576326_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576327_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576320_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993709_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ448624_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KR232337_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173416_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173417_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173397_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173398_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU796068_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173422_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173423_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924603_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689413_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571356_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571328_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674426_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470962_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470954_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY470953_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964165_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU964155_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963987_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963956_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963949_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148579_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173356_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173355_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774416_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774387_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774381_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774375_PreC_P-B      tgttcaagcccccaagctgtgccttgggtggctttggggcatggacattg
KC774363_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510659_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX429908_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ801514_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ801479_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ040173_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN827419_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JN406371_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF412801_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815780_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815765_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815754_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815753_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815752_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815751_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815573_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815554_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815550_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU451682_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU434372_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924627_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924610_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924608_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ855522_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377638_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
GQ377588_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377587_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377542_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386668_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386655_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ386642_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023569_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU570071_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU570070_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU439023_PreC_P-B      tgttcaagcctccaagctgcgccttgggtggctttggggcatggacattg
EU306709_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306705_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU139543_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993708_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993703_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993697_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993696_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ975271_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ448628_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ144599_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY596102_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY293309_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073828_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963799_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963800_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963801_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963802_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963803_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963804_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963805_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963806_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963807_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963808_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963809_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963810_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963811_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963812_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963813_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148336_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148338_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148339_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148343_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148347_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173409_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173410_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173405_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173406_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173359_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173360_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173352_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173354_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836857_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836874_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774394_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148344_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815749_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815750_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815755_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815756_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815759_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815762_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815766_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815767_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815768_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815769_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815770_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815771_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815552_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815564_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815548_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815549_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815551_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815553_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815555_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815556_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815557_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815559_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815560_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815561_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815562_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815563_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815565_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815566_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815567_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815568_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815569_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815570_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815571_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815575_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU815576_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU434373_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963976_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963977_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963978_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963979_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963980_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963981_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963982_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963983_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963984_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963985_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963986_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963988_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963989_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ855532_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963945_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963946_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963947_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963948_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963950_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963952_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963953_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963954_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963955_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963957_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963958_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU963959_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377569_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774398_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377566_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377568_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU439018_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU439022_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306700_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306701_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306704_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306706_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306708_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU306710_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU305548_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JX429902_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY518556_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148583_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MK052962_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB675676_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377629_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148340_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB195933_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ924653_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571369_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073829_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB195934_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB195935_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ448627_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
EU350409_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377612_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774399_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC774403_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173343_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173345_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173365_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173366_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173424_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173425_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803763_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674427_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674449_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571344_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571365_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510643_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510647_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510650_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510651_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510654_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510657_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC510660_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB073826_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY269115_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ448620_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377558_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ377643_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU357842_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF775480_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF775484_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF899335_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ688405_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173351_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173353_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173361_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173367_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173381_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173387_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173388_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173407_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173408_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173414_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173415_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148346_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148349_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KP148580_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674512_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG571355_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY269135_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576069_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576070_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU667763_PreC_P-B      cgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU667836_PreC_P-B      tgttcaagcccccaagctgtgccttgagtggctttagggcatggacattg
KU667813_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU667774_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU667800_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU667827_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU667729_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU667752_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU667788_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
AB334303_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB355454_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB334302_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB334300_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB334301_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB334299_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB048705_PreC_P-B      tgttcaagcctccaagttgtgccttgggtggctttggggcatggacattg
KU679959_PreC_P-B      tgttcaagcctccaagcagtgccttgggtggctttggggcatggacattg
FJ023620_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023617_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023618_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023573_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ667207_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF775482_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JF775483_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023630_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023629_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023628_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023627_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023613_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023610_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023608_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023605_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023607_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023609_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023611_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023612_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023614_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
FJ023606_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667929_PreC_P-B      tgtttaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576380_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576385_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576379_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576381_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576383_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576773_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
JQ341515_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576064_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576495_PreC_P-B      tgttcaagccttcaagctgtgccttgggtggctttagggcatggacatcg
KU576501_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU576500_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU576496_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU576507_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU576277_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576279_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY689468_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatyg
KU576618_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576624_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU576660_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU668105_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576653_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576648_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576654_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576655_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576016_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU576020_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU576015_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KU576018_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcg
KY689496_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU668059_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576979_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668335_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667445_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576980_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668344_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576975_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668345_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668323_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576978_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576982_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576983_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576984_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576985_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576981_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576420_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576397_PreC_P-B      tgttccagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668287_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576467_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667778_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668265_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576493_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668316_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667777_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667780_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668274_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576411_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576402_PreC_P-B      tgttcaaacctccaagctgtgccttgggtggctttagggcatggacattg
KU576499_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576398_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668337_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668306_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576413_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576408_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576407_PreC_P-B      tgttcaggcctccaagctgtgccttgggtggctttagggcatggacattg
KU576395_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668297_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576406_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576470_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668256_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576466_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576401_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576399_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576400_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576412_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576419_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667520_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576386_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689404_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689503_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576088_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667516_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576087_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576090_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576096_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU576100_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU576086_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576085_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576157_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576084_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576153_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668157_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU576986_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668277_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU667420_PreC_P-B      tgttcaagcccccaagctgtgccttgagtggctttagggcatggacattg
KU668170_PreC_P-B      tgttcaagcctctaagctgtgccttgggtggctttagggcatggacattg
KU668357_PreC_P-B      tgttcaagcctctaagctgtgccttgggtggctttagggcatggacattg
KU668366_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU668193_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU576598_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU576988_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU576989_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU576606_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttagggcatggacattg
KU576597_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576609_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577107_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576746_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689451_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689426_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggrcatggacatyg
KY689520_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
KU576283_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576280_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576287_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576292_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576289_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576291_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU577088_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667671_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667672_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576290_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689523_PreC_P-B      tgttcaagcctccaakctgysccttgggtggctttggggcatggacattg
AY269097_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689423_PreC_P-B      ttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU667874_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667896_PreC_P-B      tgttcaagcctccaagctgtgtcttgggtggctttggggcatggacattg
KU576638_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576639_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatgg
KU575966_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575971_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576522_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU577089_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ377158_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576691_PreC_P-B      tgttcaagcctccaagctgtgccttgagtggctttgggacatggacattg
KC774419_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668173_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667577_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggtatggacattg
KY689445_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KY689488_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576132_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575938_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KU575941_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggccttagggcatggacattg
KU668008_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667993_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667447_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU575942_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU575937_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU575940_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881864_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KU668216_PreC_P-B      tgttcaagcctccaagttgtgccttgggtggctttggggcatggacattg
AY269110_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689557_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667952_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcgtggacattg
KU576460_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ803801_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF164967_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667733_PreC_P-B      tgttcaagcctccaagctgtgccttgggcggctttagggcatggacattg
KU575921_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667605_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU668324_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
JX661482_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GU827630_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667590_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667407_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689410_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689505_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689506_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689507_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576191_PreC_P-B      tgttcaagcctctaagctgtgccttaggtggctttagggcatggacattg
KF165906_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576970_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576968_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576969_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689564_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689433_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576331_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576189_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689458_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576251_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576255_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576254_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689448_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689534_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrggrcatggacattg
KU668336_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667439_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU667568_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU668250_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576150_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576155_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576149_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576154_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576151_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB908303_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB908299_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB908300_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB908304_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836847_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KC836865_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836872_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689472_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689546_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689517_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AF335751_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU576152_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU575953_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KU575977_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689480_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689563_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689443_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836830_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836843_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY689477_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattg
KJ173297_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836853_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576188_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ341530_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576309_PreC_P-B      tgctcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY269100_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836841_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836863_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KC836864_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AY269131_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU576310_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667457_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KF165328_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173341_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KJ173342_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667484_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KU667515_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KX276827_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrrggcatggacattg
JQ027311_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
GQ924641_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KX276820_PreC_P-B      tgttcaagcctccaagcygtgccttgggtggctttaggrcatggacattg
GQ924635_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993684_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AY800391_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
AY800392_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcg
AB976562_PreC_P-B      tgcacaagcctcttaactttgccttgggtggctttagggcatggacattg
JQ341493_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MG826152_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
MF674492_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
KX765854_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF674478_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
MF674436_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
MF674439_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ924656_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY689484_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
KY689556_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcg
GQ924638_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
LC349868_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276830_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AP011094_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
HM011467_PreC_P-B      tgttcaagcctccgagctgtgccttgggtggctttaggrcatggacattg
KX276824_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacatyg
GQ924628_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB115551_PreC_P-B      tgttcaagcctccaagctgtgtcttgggtggctttgggccatggacattg
MF674476_PreC_P-B      tgttcaagcctccaagctgtgtcttgggtggctttgggccatggacattg
KX276817_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttrggrcatggacattg
KJ803819_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
GQ924639_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttaggacatggacattg
AB219429_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993683_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KX276828_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AB100695_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
DQ993687_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB713531_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
JQ027316_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttgggacatggacattg
LC349877_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AB219427_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttagggcatggacattg
AP011093_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KF167010_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
FJ023633_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
GQ855526_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AP011086_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
AP011087_PreC_P-B      tattcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674407_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
MF674481_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttggggcatggacattg
KY881956_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881955_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881949_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881951_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881958_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881945_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881957_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881948_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881946_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881947_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttagggcatggacattg
KY881950_PreC_P-B      tgttcaagcctccaagctgtgccttgggtggctttag