HBVdb

Dataset for nucleotide sequence PreC of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                              *              *             *    
ATGCAACT---TT---TTCACCTCTGCCTAATCATCTCaTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGG
nnnnnnnn   nn   n             g       t           c   t           g             
t                                     c                                         
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
               *                                                             *  
GTGGCTTTgGGgCATGGACATTGACcCgTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC------TTTTTTGCCTT
        a  a         c   aac                 ca cac   a              g  c  a   a
                         g t                     tg                            g
                           a                                                   c

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CTGACTTCTTTCCTTCTaTTCGAGATCTcCTCGACACCGCCtCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACAT
    t  t  c  gaacg g  g  c  t  a  t     taaa   t ac    a  a  t  g  a  c  t     c
                g           g           ag c                                    
                            a                                                   

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *                                   *                                       
TGTTCACCTCACCATACgGCACTCAGGCAAGCTATTcTGTGTTGGGGTGAGTTgATGAATCTAGCCACCTGGGTGGGAAG
 tca gga   t  c  a  ta          ag cg a  c    tg  a  a    c t g  t           tga
      t             g           c   t c       a                  a           c  
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                                                                              
TAATTTGGAAGAtCCAGCATCCAGGGAATTAGTAGTCaGCTATGTCAAcGTTAATATGGGCCTAAAAaTCAGACAAcTAT
c     ac c  c att c  tc a  tgcga    tgat     t  tac   c     aa g  gc t  g   t  c
         t        g        cc       a                        t     t        a   
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                 *              
TGTGGTTTCACATTTCCTGTCTTACTTTTGGgAGAGAAACTGTTCTTGAATATTTGGTGTCTTTTGGAGTGTGGATTCGC
 a        tc    t   a c  c     a a   cgtg  c  c  g        c  c  c           c   
                         g           t                    a                     
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                  *                                                             
ACTCCTCCTGCaTAtAGACCACcAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGA------CGAaG
  a  catcc t  c  g  gga  nn         c    c  g        g   g  a  a           ga c 
      t    c         t                                                      c   
      g                                                                         

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
AGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTC
gt     a                      a            c a        a         c     a  ac     
 c                                                                              
                                                                                

       650       660 
....:....|....:....|.
                     
GGGA---ATCTCA-ATGTTAG
   g    c ct     c---
                    a
                     
© 1998-2022Legal notice