HBVdb

Dataset for nucleotide sequence PreC of genotype B

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                           *              *             *      *
ATGCAACTTT---TTCACCTCTGCCTAATCATCTCaTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTG
nnnnnnnnnn   n             g       t           c   t           g                
t                                  c                                            
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *    *                                                             *     
GCTTTgGGgCATGGACATTGACcCgTATAAAGAATTTGGAGCTTCTGTGGAGTTACTCTC------TTTTTTGCCTTCTG
     a  a         c   aac                 ca  tc                     c  a  ga   
                      g t                     ag                            g   
                        a                                                   c   

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
ACTTCTTTCCTTCtATTCGAGATCTcCTCGACACCGCCtCTGCTCTGTATCGGGAGGCCTTAGAGTCTCCGGAACATTGT
 t  t     gaagg g  g  c  t  a  t     taaa  ct act      a  t  g  a  c  t       tc
             c     c     g           ag c                             a         
                         a                                                      

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                                   *                    *                   * 
TCACCTCACCATACgGCACTCAGGCAAGCTATTcTGTGTTGGGGTGAGTTgATGAATCTAGCCACCTGGGTGGGAAGTAA
a gga   t  c  a  ta          ag cg a  c    tg  a  a    c t g  tt      a   tgac  
                             c   t         a           g      a           c     
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TTTGGAAGAtCCAGCATCCAGGGAAtTAGTAGTCaGCTATGTCAAcGTTAATATGGGCCTAAAAaTCAGACAAcTATTGT
   ac c  c att c  tc a  tgcga    tgat     t  tac   c     aa g  gc t  g   t  c a 
      t        g        cc       a                       tt     t        a      
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                               *              *                 
GGTTTCACATTTCCTGTCTTACTTTTGGgAGAGAAACTGTTCTTGAATATTTGGTGTCTTTTGGAGTGTGGATTCGCACT
       tc    t  ca c tc     a a   cgtg  c  c  g        c  c              c     a
             a        g           t                    a                        
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *     *                                                                
CCTCCTGCaTAtAGACCACcAAATGCCCCTATCTTATCAACACTTCCGGAAACTACTGTTGTTAGA------CGAaGAGG
  catcc t  c     gga  nn         c       g        g   g  a  a           ga c gt 
   t a  c         t                                                      c    c 
   g                                                                            

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                  *             
CAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGGTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGG
    a  t                   a            c a        a         c     a  ac        
                                                                                
                                                                                

       650        
....:....|....:...
                  
A---ATCtCA-ATGTTAG
g    c ct      ---
                 a
                  
© 1998-2020Legal notice