HBVdb

Dataset for nucleotide sequence PreC of genotype B

[Download (right click)] [Alignment] [Repertoires]

3018 sequence(s)

>gnl|hbvcds|AB010289_PreC_P-B Feature FT:CDS AB010289_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgccgctgctctgtatcgggaagcattagaatctcctgaacattgctcacctcac
cacacagcactaaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB010290_PreC_P-B Feature FT:CDS AB010290_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctacggagttaatctcttttttgcctgctgacttctttc
cgtcggtgcgagaccttctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacatcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcctccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB010291_PreC_P-B Feature FT:CDS AB010291_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactacggagttaatctcttttttgcctgctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacatcac
cacacagcactcaggcaagctactctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcctccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB010292_PreC_P-B Feature FT:CDS AB010292_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-4). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactactgagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcctccagggatctagtagtcaattatgttaacactaccacgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AB014366_PreC_P-B Feature FT:CDS AB014366_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 07D07HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagatctcctagatactgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcaatcaggcaagctattctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcagacaattattgtggttccata
tttcctgtcttacttttggaagaaccactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB031266_PreC_P-B Feature FT:CDS AB031266_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-3). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB031267_PreC_P-B Feature FT:CDS AB031267_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacatatttcacctcac
catacggcactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB033554_PreC_P-B Feature FT:CDS AB033554_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate RTB299). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcctcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AB033555_PreC_P-B Feature FT:CDS AB033555_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAD744). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcctcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccccgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB048705_PreC_P-B Feature FT:CDS AB048705_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagttgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctattcgagatctcctcgacaccgcctccgccctgtatcgggaggccttagagtctccggaacattgctcacctcac
cataccgcactcaggcaagctatactgtgttggggggagttaatgaatctggcaacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB073821_PreC_P-B Feature FT:CDS AB073821_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaygaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AB073822_PreC_P-B Feature FT:CDS AB073822_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacstataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073823_PreC_P-B Feature FT:CDS AB073823_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi35). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB073824_PreC_P-B Feature FT:CDS AB073824_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgcctgctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggggagttaatgaatctagccacctgggtgggaagtaatttggatga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagcaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccgcaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073825_PreC_P-B Feature FT:CDS AB073825_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctcccgaacattgtacagctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacc
tgtcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073826_PreC_P-B Feature FT:CDS AB073826_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073827_PreC_P-B Feature FT:CDS AB073827_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073828_PreC_P-B Feature FT:CDS AB073828_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073829_PreC_P-B Feature FT:CDS AB073829_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK38). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073830_PreC_P-B Feature FT:CDS AB073830_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH57). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttctgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcrgctatgtcaacgttaatatgggcctaaaamtcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacrcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AB073831_PreC_P-B Feature FT:CDS AB073831_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH61). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073832_PreC_P-B Feature FT:CDS AB073832_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=639 residues).
mtgcaactttttcacctctgcctaatcatctcttgtycatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttc
ctkctgtacgagatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtwcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcagccagggaattagtagtcaactatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgycttacttttggragacaaactgtccttgaatatttggtctcttttggagtgtggattcgcactcctcctcca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|AB073833_PreC_P-B Feature FT:CDS AB073833_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073834_PreC_P-B Feature FT:CDS AB073834_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073835_PreC_P-B Feature FT:CDS AB073835_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctgttcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073836_PreC_P-B Feature FT:CDS AB073836_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw25). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatgtttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaggtaatttgaacga
tcaagcatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacg
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB073837_PreC_P-B Feature FT:CDS AB073837_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ku1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgttaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073838_PreC_P-B Feature FT:CDS AB073838_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ho7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgccctgtatcgggaagcattagaatctcctgaacattgctcagctcac
cacacagcactcaggcaagctrttctgtgctggggggaattaacgactctagstacctgggtgggcaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccgccc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaygcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB073839_PreC_P-B Feature FT:CDS AB073839_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw174). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggatttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagcgattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacg
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073840_PreC_P-B Feature FT:CDS AB073840_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw36). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctggatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaagataagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB073841_PreC_P-B Feature FT:CDS AB073841_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggaataaaactaagacaattattgtggtttcacc
tttcctgtcttatgtttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB073842_PreC_P-B Feature FT:CDS AB073842_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw11). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagatctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattgtgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AB073843_PreC_P-B Feature FT:CDS AB073843_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacatcac
cacacagcactcaggcaagctattctgtgctggggggaattaacgactctaggtacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073844_PreC_P-B Feature FT:CDS AB073844_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-T11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctmgataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagctctcaggcaagctattctgtgctgggtggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcttaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgctag
>gnl|hbvcds|AB073845_PreC_P-B Feature FT:CDS AB073845_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtkgagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctactagataccgctgctgctctgtatcgggaagccttggaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctgggtggaattaatgacgctagctacctgggtgggtaataatttagaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctccc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073846_PreC_P-B Feature FT:CDS AB073846_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgggacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccacgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB073847_PreC_P-B Feature FT:CDS AB073847_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Fu53). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttc
cgtcgatacgagacctcctagataccactgctgctctgtatcgggaagccttagaatctcctgaacattgctcagctcac
cacacagcaatcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtagtaatttacaaga
tcaagcgtccagggatctagtagtcaattatgttaacattaacatgggcctaaagttcaggcaattattgtggtttcaca
tgtcctgtattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073848_PreC_P-B Feature FT:CDS AB073848_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagctttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggaaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB073849_PreC_P-B Feature FT:CDS AB073849_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na101). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggaattactctcttttttgcctcaagacttctttc
cgtcgattcgagacctcctagataccgctgctgcactgtatcgggawgccttagaatctcctgaacattgcacacctcac
cacacagcactcaggcaagctattctgtgttggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggacctagtagtcaattatgttaacactaatatgggcctaaagctcaggcaattattgtggtttcacn
tntcctgtcttatgtttggaagggaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaacttstgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB073850_PreC_P-B Feature FT:CDS AB073850_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na102). Complete genome. [Hepadnaviridae] (length=639 residues).
acgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagatctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgtacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagacga
tccagcgtctagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgctag
>gnl|hbvcds|AB073851_PreC_P-B Feature FT:CDS AB073851_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctatc
cgtcggtgcgggacctcctagacaccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctgttctgtgctggggggaattaatgactctagctacctgggtgggtaacaatttagacga
tccagcgtccagggacctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073852_PreC_P-B Feature FT:CDS AB073852_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttaatctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgcgactgctctgtatcgggacgccttagaatctcctgaacattgcacacctcac
cacacagcactcaggcaagctgttctgtgttggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|AB073853_PreC_P-B Feature FT:CDS AB073853_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagatctcctagataccgccgctgctctgtttcgggatgccttagaatctcctgaacattgctcacctcac
cacacagcaatcaggcaagctatcgtgtgctggggggaagtaatgactctagcttcctgggtgggtaataatttacaaga
tccagcatccagggacctagtagtcgattatgttaacactcacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtattatttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttga
>gnl|hbvcds|AB073854_PreC_P-B Feature FT:CDS AB073854_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgggacctcctagataccgcttctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
catacagcaatcaggcaagctattctatgctgggtggaattaatgactctagcttcctgggtgggtcagaatttacaaga
tcaagcgtccagggacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttgaaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttga
>gnl|hbvcds|AB073855_PreC_P-B Feature FT:CDS AB073855_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry34). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgggacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagcttttctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggacctagtggtcaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AB073856_PreC_P-B Feature FT:CDS AB073856_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry46). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgatccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgggacctcctagacaccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagctctcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagacga
tccagcgtccagggacctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacg
tttcttgtattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaatccttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcataagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB073857_PreC_P-B Feature FT:CDS AB073857_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry48). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcctactgacttctttc
cgtcggtgcgggacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcaatcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagagacctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtattacttttggaagagatactgttctagaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccactgttag
>gnl|hbvcds|AB073858_PreC_P-B Feature FT:CDS AB073858_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Shin). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgcggagttactctcttttttgcctgctgacttctatc
cgtcggtgcgagacctcctagataccgctactgctctatatcgggaagccttagaatctcctgaacattgcacagctcat
cacacagcactcaggcaagctattctgtgctggggagaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtctagggatctagtagtaaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatcccaatgttaa
>gnl|hbvcds|AB100695_PreC_P-B Feature FT:CDS AB100695_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH133). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgaattctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagagcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcagccatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccccccttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB106884_PreC_P-B Feature FT:CDS AB106884_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactttcttttttgcctcctgacttctttc
cgtcggcgagagacctcctagataccgccgctgctctgtatcgggaagccttagaatctcctgaacattgctcaccccac
cacacagcactcaggcaagctrttctgtgctggggggaattaatgactctagctacctgggtgggtaataatttrcaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttatgtttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB115551_PreC_P-B Feature FT:CDS AB115551_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgaattctgcctagtcatctctcgttcatgtcctactgttcaagcctccaagctgtgtcttgggtggct
ttgggccatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccctctgacttttttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB117759_PreC_P-B Feature FT:CDS AB117759_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195933_PreC_P-B Feature FT:CDS AB195933_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195934_PreC_P-B Feature FT:CDS AB195934_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB195935_PreC_P-B Feature FT:CDS AB195935_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205119_PreC_P-B Feature FT:CDS AB205119_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205120_PreC_P-B Feature FT:CDS AB205120_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205121_PreC_P-B Feature FT:CDS AB205121_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF720-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgcggctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctatcctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB205122_PreC_P-B Feature FT:CDS AB205122_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcacctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctacggagttactctcttttttaccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtggtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttgttgaatatttggtgtcttttggagtgtggattcgcactcctactcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB212625_PreC_P-B Feature FT:CDS AB212625_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1026). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
ctactattcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB212626_PreC_P-B Feature FT:CDS AB212626_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1022). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgcctcgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB219426_PreC_P-B Feature FT:CDS AB219426_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4014, PNN1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB219427_PreC_P-B Feature FT:CDS AB219427_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4075, PNN2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacc
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB219428_PreC_C-B Feature FT:CDS AB219428_PreC_C-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4076, PNN3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB219429_PreC_P-B Feature FT:CDS AB219429_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4101, PNN4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcac
catacggctctcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaaga
tccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaacttttgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgca
tataggccaccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB219430_PreC_P-B Feature FT:CDS AB219430_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4148, PNN5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatcttctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcctcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB231909_PreC_P-B Feature FT:CDS AB231909_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VH10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctgctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcacccaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtttcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB241116_PreC_P-B Feature FT:CDS AB241116_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC03). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtggtcggctatgtcaatgttaatatgggcctaaaactcagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB241117_PreC_P-B Feature FT:CDS AB241117_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC05). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtggtcggctatgtcaatgttaatatgggcctaaaactcagacaactgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246339_PreC_P-B Feature FT:CDS AB246339_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcata
tttcctgtcttacttttgggagagaaactgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246340_PreC_P-B Feature FT:CDS AB246340_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246341_PreC_P-B Feature FT:CDS AB246341_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagatctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcctccagggatctagtagtcaattatgttaacactaatatgggcctaaagatcaggcaattattgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB246342_PreC_P-B Feature FT:CDS AB246342_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB246343_PreC_P-B Feature FT:CDS AB246343_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctgggtggaattaatgactctagctacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacg
tttcctgccttatgtttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287314_PreC_P-B Feature FT:CDS AB287314_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska433). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttc
cgtcggttcgagatctcctagacaccgcagctgctttgtatcgggaagccttagagtctcctgaacattgctctcctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagagacctagtagttaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287315_PreC_P-B Feature FT:CDS AB287315_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttc
cgtcggttcgagatctcctagacaccgcagctgctttgtatcgggaagccttagagtctcctgaacattgctctcctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagagacctagtagttaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287316_PreC_P-B Feature FT:CDS AB287316_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska427). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggttcgagatctcctagacaccgcatctgctttgtatcgggaagccttggagtctcctgaacattgcacttctcac
catacggcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcatccagagacctagtagttaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtatttgctttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagtcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287317_PreC_P-B Feature FT:CDS AB287317_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska416). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacttataaagaatttggagctactgtggagttactctctttcttgcctgatgacttctttc
cgtcggtgcgagatctcctagacaccgccgctgctttgtatcgggaagccttagagtgtcctgaacatcgctcgcctcac
catacagcaatcaggcaagctattgtgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaaga
tccagcatccagagatctagtagttaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtattatctttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaatacttccggaaactactgttgttagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287318_PreC_P-B Feature FT:CDS AB287318_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgcggagttactctctttcttgcctaatgacttctttc
cgtcggttcgagatctcctagacaccgccgctgctttgtatcgggaagccttagagtctcctcaacattgctcgcctcac
catacagcaatcaggcaagctgtgttgtgctggggggaattaatgactctagcttcctgggtgaataataatttacaaga
tccagcatccagagacctagtagttaattatgttaacactcacatggcactaaagatcaggcaattattgtggtttcacg
tttcctgtattatgtttgggagaaacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287319_PreC_P-B Feature FT:CDS AB287319_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttc
cgtcggtgcgagatctcctagacaccgcctctgctctgtatcgggaagccttagagtctcctgaacattgctcgcctcac
catacagcaatcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtagtaatttagacga
tccagcatccagagacctagtagtcaattatgtcaacattaacatgggactaaagatcaggcaattattgtggtttcacc
tttcctgtattacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287320_PreC_P-B Feature FT:CDS AB287320_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacttataaagaatttggagcttctgtggagttactctctttcctgccttctgacttctttc
cgtcggttcgagatctcctagacaccgccactgctttgtatcgggaagccttagagtctcctgaacattgctcggctcac
catacagcactcaggcaagctattgtgtgctggggggaattaacgaccctaggtacctgggtgggtaataatttacaaga
tccagcatccagagaccaagtagtcaattatgttaacactaacatgggactaaagattagacaattattgtggtttcata
tttcctgtattacctttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB287321_PreC_P-B Feature FT:CDS AB287321_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgcctgctgacttctatc
cgtcggttcgagatctcctagataccgccgctgctttgtatcgggaagccttagagtctcctgaacattgctcgccccat
catacagcactcaggcaagctattttatgctgggtggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcagacaattattgtggtttcaca
tttcctgtcttacctttggaagagagactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctattattagacgacgaggcaggagccctagaag
aagaactccctcgcctcgcagacccagatctcaatcaccgcgtcgcagaagatctcaatctcggggaccccaatgttag
>gnl|hbvcds|AB287322_PreC_P-B Feature FT:CDS AB287322_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggttcgagatctcctagataccgcctctgctttgtatcgagaagccttagagtctcctgaacattgctctgctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttaaatga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcagacaattattgtggtttcaca
tttcctgtcttacctttggaagagagactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287323_PreC_P-B Feature FT:CDS AB287323_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagctactgtggagttactctctttcttgcctactgacttctatc
cgtcggttcgagatctcctagataccgcctctgctttgtatcgggaagccttagagtcttctgaacattgcacgcctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcatccagagacctggtagttaattatgttaacactaacatggggctgaagatcagacaattattgtggtttcaca
tttcctgtcttacctttgggagacaagttgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagaccaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287324_PreC_P-B Feature FT:CDS AB287324_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-5). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgcggagttactctctttcttgccttctgacttctttc
cgtcggctcgagatctcctagataccgcctctgctttgtttcgggaagccttagagtctcctgaacattgctcatctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcagacaattattgtggtttcaca
tttcctgtatttcctttgggagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgatgcaggtccactggaag
aagaactccctcgcctcgcagaccaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287325_PreC_P-B Feature FT:CDS AB287325_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgcctactgacttctttc
catcggttcgagatctcctagataccgcctctgcgttgtatcgggaagccttagagtctcctgaacattgctcgcctcac
catacagcactcaggcaagctattttgtgctggggggaattaacgactctaggtacctgggtgggtaataatttacaaga
tccagcatccagagaccaagtagtcaattatgttaacactaatatgggactaaagatcagacaattattgtggtttcacg
tttcctgtcttacctttggaagagagactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287326_PreC_P-B Feature FT:CDS AB287326_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A44). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcat
catacagcactcaggcaagctattctgtgctgggtggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB287327_PreC_P-B Feature FT:CDS AB287327_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A53). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccctagaatctcctgaacattgctcacctcac
catacagcactcaggcaagctgttctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgccttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagacctgcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgcaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB287328_PreC_P-B Feature FT:CDS AB287328_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcata
tttcctgtcttacttttgggagagaaactgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB287329_PreC_P-B Feature FT:CDS AB287329_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba A55). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggaattactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300364_PreC_P-B Feature FT:CDS AB300364_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300370_PreC_P-B Feature FT:CDS AB300370_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctcaggacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgttggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB300371_PreC_P-B Feature FT:CDS AB300371_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcctcctgacttctttc
cgaacatacgagacctcctagatactgctgctgctttgtatcgggatgccttagaatctcctgagcactgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggatgtaatgaatctagccacctgggtgggcactaatttacaaga
ttcagggtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatgaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaaccgttcttgaatatttggggtcttttggagtgtggattcgcactcctcctgcc
tacagaccacaaaatgcccctatcttatcaactcttccggaaactactgttgttagacaacgaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgctag
>gnl|hbvcds|AB302095_PreC_P-B Feature FT:CDS AB302095_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcacctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgctgagttactctcttttttgcctcctgacttctttc
cgtcggcgcgagacctcctcgataccactgctgctctgtatcgggaagccttagaatctcctgaacattgctcatctcac
cacacagccctcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcacg
tttcctgtattatgtttggaagagacactgttgttgaatttttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB302942_PreC_P-B Feature FT:CDS AB302942_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3837NN). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaaga
tcaagcatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tatagaccaccaaatgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB302943_PreC_P-B Feature FT:CDS AB302943_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3639NN). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaaga
tcaagcatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB302944_PreC_P-B Feature FT:CDS AB302944_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaaga
tcaagcatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tatagaccaccaaatgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB302945_PreC_P-B Feature FT:CDS AB302945_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3643NN). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccttac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaaga
tcaagcatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tatagaccaccaaatgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB334299_PreC_P-B Feature FT:CDS AB334299_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggagcattgctcacctcac
catacagccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaaga
cccagcatcaagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtctcacatttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB334300_PreC_P-B Feature FT:CDS AB334300_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaaga
cccagcatccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtctcacatttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB334301_PreC_P-B Feature FT:CDS AB334301_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagacctcctcgacaccgcctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaaga
cccagcatccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtctcacatttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB334302_PreC_P-B Feature FT:CDS AB334302_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 16UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgggacctccttgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagccctcaggcaagctgttctgtgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaaga
cccagcatccagagaattagtagtcagttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcata
tttcctgtctcacatttggaagagaaacggttcttgaatatttggtgtcctttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB334303_PreC_P-B Feature FT:CDS AB334303_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctcctcgacaccgcctcagcgttgtatcgggaagccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctgttctgtgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaaga
cccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctgaaaattagacaactattgtggtttcaca
tttcctgtctcacatttggaagagaaacagttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB355453_PreC_P-B Feature FT:CDS AB355453_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctactgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB355454_PreC_P-B Feature FT:CDS AB355454_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 29UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagatctcctcgacaccgcctcagcgttgtatcgggaagccttagagtctccggaacattgttcacctcac
catacagccctcaggcaagctgttctgtgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaaga
cccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctgaaaattagacaactattgtggtttcaca
tttcctgtctcacatttggaagagaaacagttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB355455_PreC_P-B Feature FT:CDS AB355455_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 33UC). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcacttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatctagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcttgtcttacttttggaagagaaactgttcttgaatatttagtttcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB362933_PreC_P-B Feature FT:CDS AB362933_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctgctgacttttatc
cgtcggtgcgagacctcttagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcaatcaggcaagctgttctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaaga
tccagcatccagggatctagtagttaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB365445_PreC_P-B Feature FT:CDS AB365445_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggcaatttggaaga
tcaaggatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacagctattgtggtttcaca
tttcctgtcttatgtttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctgctgca
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB368295_PreC_P-B Feature FT:CDS AB368295_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatcttctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttgtgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctacgtcaatgttaatatgggcctaaaaatcaggcaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471854_PreC_P-B Feature FT:CDS AB471854_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-F). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB471855_PreC_P-B Feature FT:CDS AB471855_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-C). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB493827_PreC_P-B Feature FT:CDS AB493827_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcganatcttctcaaccccgttttggttttgtatcggggggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctactgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB493833_PreC_P-B Feature FT:CDS AB493833_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaattatatcttgttcatgtcctactgggcaagcctccaacctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctgttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB493835_PreC_P-B Feature FT:CDS AB493835_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgatgccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaaggaatctagccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB555498_PreC_P-B Feature FT:CDS AB555498_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA41). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacggcaatcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaagtcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|AB555499_PreC_P-B Feature FT:CDS AB555499_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA62). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggaaagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AB642093_PreC_P-B Feature FT:CDS AB642093_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgcctywkgacttctttc
cgtcggtgcgrgatctcctagatacygcykytgctctgtatcgggatgccttagaatctccwgaacattgctcacckcac
catacagcactcaggcaagctatcctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagayga
tccagcatccagggacctagtagtcaattatgttaacactmatatgggcctaaagatcaggcaattattgtggtttcacc
tttcctgtattwsttttggaasggacaccgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccascaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgagtcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgctag
>gnl|hbvcds|AB642094_PreC_P-B Feature FT:CDS AB642094_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB642101_PreC_P-B Feature FT:CDS AB642101_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgcctcaggacttctatc
cgtcggtgcgggatctcctcgataccgctgctgctctctatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagatactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB675676_PreC_P-B Feature FT:CDS AB675676_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10A37). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713527_PreC_P-B Feature FT:CDS AB713527_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctagctacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713528_PreC_P-B Feature FT:CDS AB713528_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgaatatttggtctcttttggggtgtggattcgcacccctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713529_PreC_P-B Feature FT:CDS AB713529_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv68). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgggccttgggtggct
ttggggcatggacattgacccgggggaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacgccgcctctgctctgtatcgggaggccttaaagtctccagaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatcccgggatttgatagtcagctaagtcaatgttaatatgggcctaaaaatcagaccactattgtggtttcaca
tttcctgtcttaattttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcaagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713530_PreC_P-B Feature FT:CDS AB713530_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv94). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaacttctccaccttagcctcatcatctcaggttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaagcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatgccgggatttgatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcaagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713531_PreC_P-B Feature FT:CDS AB713531_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv98). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgagatcttctcgacaccgcctccgctttgtatcgggaggccttagagtctccggaacactgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctctttcggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB713532_PreC_P-B Feature FT:CDS AB713532_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv132). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctagctacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcaaacaactattgggggttccca
ttttcggtcgtacttttagaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB828708_PreC_P-B Feature FT:CDS AB828708_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HB12-0626). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctackgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactacggaattactctcttttttgcctattgacttctttc
cgtcggtgcgagatctcctagataccgctgctgctttgtatcgggaagccttagaatctcctgaacattgctcagctcac
cacacagcactcaggcaagctgttctatgctggggggaattaatgactctagctacctgggtgggtaataatttagacga
tccagcgtccagggatttagtagtcaattatgttaacactaacatgggcytaaagatcaggcaattattgtggtttcaca
tttcctgtmttatgtttggaagagawactgttcttgaatwtttggtgtcttttggagtgtggattcgcactcctcctscm
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB900095_PreC_P-B Feature FT:CDS AB900095_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctccttgatactgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcatctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactttagctacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgccttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB900096_PreC_P-B Feature FT:CDS AB900096_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgtaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagacaccgctgctgctctgtatcgggaagccttagaatctcctgaacatgtctcacctcac
cacacagctctcaggcaagctgttttgtgctggggggaattaatgactctagctacctgggtgggtggtaatctagacga
tccagcctccagggacctagtagtcaattatgttaacactaacatgggcttaaagaccaggcaattattgtggtttcaca
tttcctgtctcacttttggaagagacgttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttattagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgtcag
>gnl|hbvcds|AB900097_PreC_P-B Feature FT:CDS AB900097_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
ttgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgttgagttactctcttttttgcctgctgacttttttc
cttcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccctagaatctcctgaacattgctcacctcat
cacacagcaatcaggcaagctgttctgtgctggctggaattaatgactctagctaactgggtgggcaataatttacaaga
tccagcatctagggatatggtagtcaattatgttaacactaacatgggtctaaagatcaggcaattactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgccgacgcaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgttag
>gnl|hbvcds|AB900098_PreC_P-B Feature FT:CDS AB900098_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgycgagttavtctcttttttgccttctgacttctttc
cgtcggtgcgagatctcctagataccgctgctgctctgtatcgggaagcyttagaatctcctgaacattgttcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagccacctgggtgggtaataatttgcaaga
tccagcatccagggatctagtagtcaattatgttaacactaayatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcatttggagtgtggattcgcactcctcctccc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB900102_PreC_P-B Feature FT:CDS AB900102_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctatc
cgtcggtgcgggaccttctagacaccgctactgctctgtatcgggaagccttagaatctcctgaacattactcacctcac
cacacagcactaaggcaagctattttgtgctggggggaattaatgaatctagctamctgggtgggtaataatttacaaga
tccagcctccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcctatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttgg
>gnl|hbvcds|AB900103_PreC_P-B Feature FT:CDS AB900103_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggrcatggacatcgacccttataaagaatttggagcttctgcggagttactctcttttttgcctcatgacttctttc
cgtcggcgcgagacctcctagataccgctgctgctctgtaccgggaagcattagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaacgactctaggtacctgggtgggtaataatttacaaga
tcaagcatccagggatctagtagtcaattatgttgacactaacatgggcctaaagatcagacaattattgtggtttcaca
tctcttgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctcca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|AB900104_PreC_P-B Feature FT:CDS AB900104_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgagaagccttagaatctcctgaacattgcacacctcat
cacacagcactcaggcaagctattctgtgctgggtggaattaatgactctagcttcctgggtgggcaataatttgcaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB900105_PreC_P-B Feature FT:CDS AB900105_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgttgagttactctcttttttgcctgctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcagctcac
catacagcaatcaggcaagctattctgtgctggggagaattaatgactctagcttcctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtattacttttggaagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB900106_PreC_P-B Feature FT:CDS AB900106_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccattataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgcgactgctctgtatcgggaagccttagaatctcctgaacattgcacatctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggcaataatttacaaga
tcccgcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcatgtcttacttttggaagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB900107_PreC_P-B Feature FT:CDS AB900107_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgccactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctacttcggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagatcttctagataccgccgctgctctgtatcgggaagccttagaatctcctgaacattgctcagctcac
cacacagcactcaggcaagctgttctgtgctggggggaattaatgactctagccacctgggtgggtaataatttacaaga
tccagcatccagggacctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB900108_PreC_P-B Feature FT:CDS AB900108_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cgtcggtgcgagacctcctagataccgctactgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcaatcaggcaagcttttctgtgctggggggaattaatgactctagctacctgggtgggtgataatttagacga
tccagcgtccaggaatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtattacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccgatgttag
>gnl|hbvcds|AB900110_PreC_P-B Feature FT:CDS AB900110_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcaatcaggcaagctattatatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccatcatccagggaagcagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgca
tatagaccagcaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB900111_PreC_P-B Feature FT:CDS AB900111_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=642 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctatc
cgtcggtgcgagatctcctagataccgccgctgctctgtatcgggatgcattagaatctcctgaacattgctcagctcac
cacacagcactcaggcaagctgttctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagacga
tccagcatccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatacttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggatcgatcccaatgtt
ag
>gnl|hbvcds|AB900112_PreC_P-B Feature FT:CDS AB900112_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
acgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctcaagacttctatc
cgtcggtgcgagacctcctagataccgcttctgctctgtatcgggaagccttagaatctcctgaacattgctctcctcac
cacacagcaatcaggcaagctattctrtgctggggggaattaatgactctagctacctgggtgggtaataatttagacga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggttccaca
tttcctgtcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|AB908299_PreC_P-B Feature FT:CDS AB908299_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagagactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB908300_PreC_P-B Feature FT:CDS AB908300_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattaatagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagagactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB908303_PreC_P-B Feature FT:CDS AB908303_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctctggaacattgttcacctcac
catacagcactcaggcaagctattctttgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagagactgttcttgagtatttggcgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB908304_PreC_P-B Feature FT:CDS AB908304_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagagactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|AB931168_PreC_P-B Feature FT:CDS AB931168_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1P_HB11-1417). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagctactggcgagttactctcttttttgcctcgtgacttctttc
cgtcggcgcaagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcatatcac
cacacagcactcaggcaagctattctgtgctggggggaattaacgaatctaggtacctgggtgggtaacaatttacaaga
tcaaccgtccagggatctagtagtcaattatgttaacactaacatgggtctgaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB931169_PreC_P-B Feature FT:CDS AB931169_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1S_HB11-1418). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagctactggcgagttactctcttttttgcctcgtgacttctttc
cgtcggcgcaagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcatatcac
cacacagcactcaggcaagctattctgtgctggggggaattaacgaatctaggtacctgggtgggtaacaatttacaaga
tcaaccgtccagggatctagtagtcaattatgttaacactaacatgggtctgaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AB976562_PreC_P-B Feature FT:CDS AB976562_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AK8). Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttaacctatgccttatcctctctcgttcatgtcctaatgcacaagcctcttaactttgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctgctgttcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtttcttttggagtgtggattcgcactcctgttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcagggcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF100308_PreC_P-B Feature FT:CDS AF100308_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcggggggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggcgagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF100309_PreC_P-B Feature FT:CDS AF100309_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccatcatccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121243_PreC_P-B Feature FT:CDS AF121243_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121244_PreC_P-B Feature FT:CDS AF121244_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/15122). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121245_PreC_P-B Feature FT:CDS AF121245_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/16091). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121246_PreC_P-B Feature FT:CDS AF121246_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/IK29902). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121247_PreC_P-B Feature FT:CDS AF121247_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/719). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgccttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121248_PreC_P-B Feature FT:CDS AF121248_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/139-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AF121249_PreC_P-B Feature FT:CDS AF121249_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121250_PreC_P-B Feature FT:CDS AF121250_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/6395). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AF121251_PreC_P-B Feature FT:CDS AF121251_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/9873). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattttgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AF157020_PreC_P-B Feature FT:CDS AF157020_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattagagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaacatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggatttgcactcctcctgca
tatagaccacccaatgcccctatcttatcaacacttccggatactactgttgttagacgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157021_PreC_P-B Feature FT:CDS AF157021_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaacgttaacatgggcttaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatgtggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggatactactgttattagacgccgaggcaggccccctagaag
aagaactccctcgcctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157022_PreC_P-B Feature FT:CDS AF157022_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaacgttaacatgggcttaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggatactactgttgttagacgaagaggcaggccccctagaag
aagaactccctcgcctcgcagaagaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157023_PreC_P-B Feature FT:CDS AF157023_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcaccgctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157024_PreC_P-B Feature FT:CDS AF157024_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF157025_PreC_P-B Feature FT:CDS AF157025_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|AF233231_PreC_P-B Feature FT:CDS AF233231_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV147c). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggtgcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagataactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagactaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttgg
>gnl|hbvcds|AF233234_PreC_P-B Feature FT:CDS AF233234_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV259c). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF233235_PreC_P-B Feature FT:CDS AF233235_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV263c). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF233237_PreC_P-B Feature FT:CDS AF233237_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV4c). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagccattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF282917_PreC_P-B Feature FT:CDS AF282917_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctactgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatagttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggtagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggccaaaatttcagacaactattgtggtttcaca
tttcctgtctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF282918_PreC_P-B Feature FT:CDS AF282918_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggtagtaatttgcaaga
tccagcatccagggaactagtagtcagttatgtcaacgctaatatgggcctaaagatcaggcaactattgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335738_PreC_P-B Feature FT:CDS AF335738_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcccaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcactgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335740_PreC_P-B Feature FT:CDS AF335740_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335741_PreC_P-B Feature FT:CDS AF335741_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335746_PreC_P-B Feature FT:CDS AF335746_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattatggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagagg
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335748_PreC_P-B Feature FT:CDS AF335748_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattcagtgttggggtgaggtgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattatggtttcaca
tttcctgtcttacatttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335751_PreC_P-B Feature FT:CDS AF335751_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctcgggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF335754_PreC_P-B Feature FT:CDS AF335754_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattatggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF461360_PreC_P-B Feature FT:CDS AF461360_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttcagca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF461362_PreC_P-B Feature FT:CDS AF461362_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH10). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AF479684_PreC_P-B Feature FT:CDS AF479684_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3c). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgttctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagaraaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacggagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480337_PreC_P-B Feature FT:CDS AF480337_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcc
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctagtctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgtcgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480338_PreC_P-B Feature FT:CDS AF480338_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactcccttgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480339_PreC_P-B Feature FT:CDS AF480339_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagttgtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480340_PreC_P-B Feature FT:CDS AF480340_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480341_PreC_P-B Feature FT:CDS AF480341_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatttcatcgacaccgcctctgctctgtatcgggaggccttagagtcttcggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480342_PreC_P-B Feature FT:CDS AF480342_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-8). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480343_PreC_P-B Feature FT:CDS AF480343_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-9). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacctgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagagattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480344_PreC_P-B Feature FT:CDS AF480344_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-11). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcagacaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480345_PreC_P-B Feature FT:CDS AF480345_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480346_PreC_P-B Feature FT:CDS AF480346_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-13). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcctacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480347_PreC_P-B Feature FT:CDS AF480347_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-14). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480348_PreC_P-B Feature FT:CDS AF480348_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-15). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaacttttacacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480349_PreC_P-B Feature FT:CDS AF480349_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-16). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcacgtcttacttttgggagagaaactgttcttgaatatttggtgtctcttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480350_PreC_P-B Feature FT:CDS AF480350_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-17). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcgagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480351_PreC_P-B Feature FT:CDS AF480351_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctaaccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaagtctcaatcgccgcgtcgcagaggatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480352_PreC_P-B Feature FT:CDS AF480352_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-19). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtctcttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480353_PreC_P-B Feature FT:CDS AF480353_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactctttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaaaatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|AF480354_PreC_P-B Feature FT:CDS AF480354_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-21). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgttctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480355_PreC_P-B Feature FT:CDS AF480355_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-22). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
taggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480356_PreC_P-B Feature FT:CDS AF480356_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-23). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480357_PreC_P-B Feature FT:CDS AF480357_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-24). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaacttttccacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480358_PreC_P-B Feature FT:CDS AF480358_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-25). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480359_PreC_P-B Feature FT:CDS AF480359_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-27). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactctttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480360_PreC_P-B Feature FT:CDS AF480360_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-28). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactctttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480361_PreC_P-B Feature FT:CDS AF480361_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggtgtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480362_PreC_P-B Feature FT:CDS AF480362_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-30). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480363_PreC_P-B Feature FT:CDS AF480363_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcccgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF480364_PreC_P-B Feature FT:CDS AF480364_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 414-32). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactctttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtatatagaatttcgagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttacagtctccggaacattgttcacctcac
catacggcactcaggcaagatattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaacaatcagacgactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627225_PreC_P-B Feature FT:CDS AJ627225_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19749). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgcggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacatcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggacga
tcaagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM888201_PreC_P-B Feature FT:CDS AM888201_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BM1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggaccttctgtggagttactttcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgtccttgaatatttggtgtcttttggagtgtggattcgcactcctcctgta
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011084_PreC_P-B Feature FT:CDS AP011084_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccccaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011085_PreC_P-B Feature FT:CDS AP011085_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcctcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011086_PreC_P-B Feature FT:CDS AP011086_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacactgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacccccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011087_PreC_P-B Feature FT:CDS AP011087_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacactgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011088_PreC_P-B Feature FT:CDS AP011088_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011089_PreC_P-B Feature FT:CDS AP011089_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttcttcc
cgtctattcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtctcacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011090_PreC_P-B Feature FT:CDS AP011090_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacttgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011091_PreC_P-B Feature FT:CDS AP011091_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtttcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011092_PreC_P-B Feature FT:CDS AP011092_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011093_PreC_P-B Feature FT:CDS AP011093_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctctgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtattacttttggaagagaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcaggca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011094_PreC_P-B Feature FT:CDS AP011094_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacc
tttcctgtcttatgtttggaagagawactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgca
tatagaccatcaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011095_PreC_P-B Feature FT:CDS AP011095_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AP011096_PreC_P-B Feature FT:CDS AP011096_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY033072_PreC_P-B Feature FT:CDS AY033072_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY033073_PreC_P-B Feature FT:CDS AY033073_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY163869_PreC_P-B Feature FT:CDS AY163869_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMClx-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgcaaga
tccagcatccagggaagtagtagtcggctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaaccaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgttag
>gnl|hbvcds|AY163870_PreC_P-B Feature FT:CDS AY163870_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU001). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgcaaga
tccagcatccagggaagtagtagtcggctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaaccaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgttag
>gnl|hbvcds|AY167089_PreC_P-B Feature FT:CDS AY167089_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167093_PreC_P-B Feature FT:CDS AY167093_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIa). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cctctgttcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacga
tccagcatcccgggacgcagtagtcagctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgaatatttggtgtcttttggagtgtggatgcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaaggcgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167094_PreC_P-B Feature FT:CDS AY167094_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcntcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccggcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgnggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacnaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctnaatgttag
>gnl|hbvcds|AY167097_PreC_P-B Feature FT:CDS AY167097_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AY167098_PreC_P-B Feature FT:CDS AY167098_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IVa). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccattcgagagcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagagaattagtagtcagttatgtcaacgttaatgcgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167100_PreC_P-B Feature FT:CDS AY167100_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggcagtaatttggacga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY167101_PreC_P-B Feature FT:CDS AY167101_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcagctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|AY167102_PreC_P-B Feature FT:CDS AY167102_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vc). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccctagagtctccggaacatttaacacctcac
catacggcgctcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtctcacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AY206375_PreC_P-B Feature FT:CDS AY206375_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaagcagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206383_PreC_P-B Feature FT:CDS AY206383_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcagctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcaatcaggcaagctgttctgtgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacagctattgtggtttcaca
tttcctgtcttatgtttgggagacaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggagactactgttgttagagcaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY206387_PreC_P-B Feature FT:CDS AY206387_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgggatctgctcgacaccgcctctgctctctatcgggaggctttagagtctccggaacattgttcacctcac
catacggctctcaggcaagctattcaatgttggggtgaggtgatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctttcttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcctatcaacgcttccggaaactactgttgttagacggagatgcaggtcccctagaag
aggaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AY206390_PreC_P-B Feature FT:CDS AY206390_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtctgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggacttagtagtcagctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcccccccca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcag
>gnl|hbvcds|AY206391_PreC_P-B Feature FT:CDS AY206391_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgcacacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagacga
tccagcatccagggaagtagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcacg
tttcctgtcttatgtttggaagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctcaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AY217355_PreC_P-B Feature FT:CDS AY217355_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A6-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgccctgtatcgggaggccttagagtctccggaacattggtcacctcac
catacggcactcaggcaagctattgtgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaatcatccagggatttagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY217356_PreC_P-B Feature FT:CDS AY217356_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A9-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattggtcacctcac
catacggcactcaggcaagctattgtgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaatcatccagggatttagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY217357_PreC_P-B Feature FT:CDS AY217357_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1r-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcgttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217358_PreC_P-B Feature FT:CDS AY217358_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcgttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217359_PreC_P-B Feature FT:CDS AY217359_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Q6-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217360_PreC_P-B Feature FT:CDS AY217360_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217361_PreC_P-B Feature FT:CDS AY217361_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttgaactctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY217362_PreC_P-B Feature FT:CDS AY217362_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-4). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttgacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgatttttttc
cttccattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY217364_PreC_P-B Feature FT:CDS AY217364_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 586). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttgaactctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctggacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgaattaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY220697_PreC_P-B Feature FT:CDS AY220697_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tatagaccgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220698_PreC_P-B Feature FT:CDS AY220698_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tatagaccgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220703_PreC_P-B Feature FT:CDS AY220703_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttccgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY220704_PreC_P-B Feature FT:CDS AY220704_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttaccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY238972_PreC_P-B Feature FT:CDS AY238972_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU023). Partial genome (Contains: HBx, LHBs, MHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtctgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggacttagtagtcagctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcaca
tctcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcccccctca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|AY269091_PreC_P-B Feature FT:CDS AY269091_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 30). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcatactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269093_PreC_P-B Feature FT:CDS AY269093_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
tttcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269095_PreC_P-B Feature FT:CDS AY269095_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctctc
cttctattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactgttgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269097_PreC_P-B Feature FT:CDS AY269097_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcgtttttgccttctgatttctttc
cttctattcgtgatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccaca
tttcctgtcttacgtttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269100_PreC_P-B Feature FT:CDS AY269100_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 52). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcatactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269102_PreC_P-B Feature FT:CDS AY269102_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 50). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcatactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcgtctgttgagttactctcttttttgccttctgacttctttc
cttctgctcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcaatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcgactatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttattagacaaagaggcaggtccactagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269105_PreC_P-B Feature FT:CDS AY269105_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 47). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactactgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctgccgca
tatagaccatcaaatgcccctatcttatcaacacttccggaaactgctgttgttagatgcagaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269108_PreC_P-B Feature FT:CDS AY269108_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 44). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcatactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgagagcttctcgacaccgcctctgctcagtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatttagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269109_PreC_P-B Feature FT:CDS AY269109_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 43). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcatactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttagagcttcagtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagagaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaacaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269110_PreC_P-B Feature FT:CDS AY269110_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 42). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcctctgctgagttactctcttttttgccttctgacttctttc
ctaatattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269115_PreC_P-B Feature FT:CDS AY269115_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 11). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269120_PreC_P-B Feature FT:CDS AY269120_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 16). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaacttttttacctctgcctaatcatctcatgttcatgttctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctcacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactccacctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269128_PreC_P-B Feature FT:CDS AY269128_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 36). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcatactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagccattctgtgctggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccctcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccagctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaaatactgttgttagacaaagaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttta
>gnl|hbvcds|AY269131_PreC_P-B Feature FT:CDS AY269131_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY269135_PreC_P-B Feature FT:CDS AY269135_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate mutant 25). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY293309_PreC_P-B Feature FT:CDS AY293309_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY518556_PreC_P-B Feature FT:CDS AY518556_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 57-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596102_PreC_P-B Feature FT:CDS AY596102_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596103_PreC_P-B Feature FT:CDS AY596103_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|AY596104_PreC_P-B Feature FT:CDS AY596104_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgatctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccggcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596105_PreC_P-B Feature FT:CDS AY596105_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-5). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttccattcgagagcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagagaattagtagtcagttatgtcaacgttaatgcgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY596106_PreC_P-B Feature FT:CDS AY596106_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaacatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596109_PreC_P-B Feature FT:CDS AY596109_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcatctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tatcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|AY596110_PreC_P-B Feature FT:CDS AY596110_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgttgagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattaatagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY596111_PreC_P-B Feature FT:CDS AY596111_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-3). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcatctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacga
tcccgcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaaatattgtggtttcaca
tttcctgtcttacttttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttattagacaacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AY596112_PreC_P-B Feature FT:CDS AY596112_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgctgagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY766463_PreC_P-B Feature FT:CDS AY766463_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY800389_PreC_P-B Feature FT:CDS AY800389_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041024). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacccttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY800391_PreC_P-B Feature FT:CDS AY800391_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041026). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccgtataaagaatttggagcttctttggagttactctcttttttaccttctgacttctttc
cttctattcgagaccttctcgacaccgccaatgctatgtttcgggaggccttagagtctcctgaacattgttcgcatcat
catacggcactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgttaatgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaaaagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY800392_PreC_P-B Feature FT:CDS AY800392_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041027). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccgtataaagaatttggagcttctttggagttactctcttttttaccttctgacttctttc
cttctattcgagaccttctcgacaccgccaatgctatgtttcgggaggccttagagtctcctgaacattgttcgcatcat
catacggcactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgttaatgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaaaagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D00329_PreC_P-B Feature FT:CDS D00329_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccctataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgggacctcctagataccgtctctgctctgtatcgggaagccttaaaatctcctgagcattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttggaaga
tccagcatcccgggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaactatggtggtttcaca
tttcctgtcttacttttggaagagaaactgttctggaatatttggtatcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|D00330_PreC_P-B Feature FT:CDS D00330_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccggcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D00331_PreC_C-B Feature FT:CDS D00331_PreC_C-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcctcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacgtttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|D23678_PreC_P-B Feature FT:CDS D23678_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-HBVYS2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cgtcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctcaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttacaaga
tccagcgtccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|D23679_PreC_P-B Feature FT:CDS D23679_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-HBVMS2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cttcggtgcgagacctcctagataccgctgctgctctgtatcgggaagccttagaatctcctgaacattgctcacctcac
cacacagcactcaggcaagctattctgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcctccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|D50521_PreC_P-B Feature FT:CDS D50521_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cgtcggtgcatgacctcctagataccgcttctgctttgtatcgggaagccttagaatctcctgaacattgctcacctcat
cacacagcaatcaggcaagctattctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaaga
tccagcgtccagggaactagtagtcaattatgttaacactcacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcggtctagggaacctcaatgttag
>gnl|hbvcds|D50522_PreC_P-B Feature FT:CDS D50522_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cgtcggtgcatgacctcctagataccgcttctgctttgtatcgggaagccttagaatctcctgaacattgctcacctcat
cacacagcaatcaggcaagctattctgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaaga
tccagcgtccagggaactagtagtcaattatgttaacactcacatgggcctaaagatcaggcaattattgtggtttcaca
tttcctgtattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcggtctagggaacctcaatgttag
>gnl|hbvcds|DQ144543_PreC_P-B Feature FT:CDS DQ144543_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-A14). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcccctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144544_PreC_P-B Feature FT:CDS DQ144544_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgtcaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcccgggaatctcaatgttag
>gnl|hbvcds|DQ144545_PreC_P-B Feature FT:CDS DQ144545_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-B3). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144546_PreC_P-B Feature FT:CDS DQ144546_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-C2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144548_PreC_P-B Feature FT:CDS DQ144548_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-E4). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctattttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144550_PreC_P-B Feature FT:CDS DQ144550_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-21). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctctc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccccac
catacggcactcaggcgagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcacagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144551_PreC_P-B Feature FT:CDS DQ144551_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-F3). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtatggattcgcgctcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144552_PreC_P-B Feature FT:CDS DQ144552_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq1-G2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcccctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144554_PreC_P-B Feature FT:CDS DQ144554_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgtcaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcccgggaatctcaatgttag
>gnl|hbvcds|DQ144555_PreC_P-B Feature FT:CDS DQ144555_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-B10). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcccctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144556_PreC_P-B Feature FT:CDS DQ144556_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-C6). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttgaagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144557_PreC_P-B Feature FT:CDS DQ144557_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-D2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144558_PreC_P-B Feature FT:CDS DQ144558_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-10). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctattttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144559_PreC_P-B Feature FT:CDS DQ144559_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-11). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttagcaacacttccggaaactactgttgttagacgaagagacaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144560_PreC_P-B Feature FT:CDS DQ144560_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaacttgttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcaagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144561_PreC_P-B Feature FT:CDS DQ144561_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-E2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacccgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcattgttag
>gnl|hbvcds|DQ144564_PreC_P-B Feature FT:CDS DQ144564_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-24). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctagaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144565_PreC_P-B Feature FT:CDS DQ144565_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq2-25). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatctggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144567_PreC_P-B Feature FT:CDS DQ144567_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-A17). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144569_PreC_P-B Feature FT:CDS DQ144569_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-C2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgctcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctattttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144570_PreC_P-B Feature FT:CDS DQ144570_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-D3). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggccatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgcgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144574_PreC_P-B Feature FT:CDS DQ144574_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-13). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcata
tttcctgtcttacttttgggagggaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144575_PreC_P-B Feature FT:CDS DQ144575_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-18). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctattttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144576_PreC_P-B Feature FT:CDS DQ144576_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-21). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144578_PreC_P-B Feature FT:CDS DQ144578_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq3-25). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144579_PreC_P-B Feature FT:CDS DQ144579_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctggcttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144581_PreC_P-B Feature FT:CDS DQ144581_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-B14). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctacaaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcgctcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144582_PreC_P-B Feature FT:CDS DQ144582_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-7). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgtccttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144583_PreC_P-B Feature FT:CDS DQ144583_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-C4). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttctcacctctgcctaatcatctcatgtccatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144584_PreC_P-B Feature FT:CDS DQ144584_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-14). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaactagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144585_PreC_P-B Feature FT:CDS DQ144585_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-13). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgcgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144586_PreC_P-B Feature FT:CDS DQ144586_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-D2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144587_PreC_P-B Feature FT:CDS DQ144587_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-17). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaactttgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgtgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144589_PreC_P-B Feature FT:CDS DQ144589_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-23). Partial genome (Contains: HBc, HBx). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttagcaacacttccggaaactactgttgttagacgaagagacaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144590_PreC_P-B Feature FT:CDS DQ144590_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-24). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatctggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144591_PreC_P-B Feature FT:CDS DQ144591_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-26). Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagatgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144592_PreC_P-B Feature FT:CDS DQ144592_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-30). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttgaagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144593_PreC_P-B Feature FT:CDS DQ144593_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq4-32). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144594_PreC_P-B Feature FT:CDS DQ144594_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctagaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144595_PreC_P-B Feature FT:CDS DQ144595_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-A6). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttgaagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144596_PreC_P-B Feature FT:CDS DQ144596_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-B2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggagaccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaacttctgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144597_PreC_P-B Feature FT:CDS DQ144597_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-C3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaacttgttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcaagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144598_PreC_P-B Feature FT:CDS DQ144598_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-D7). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacccgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcattgttag
>gnl|hbvcds|DQ144599_PreC_P-B Feature FT:CDS DQ144599_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-7). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144600_PreC_P-B Feature FT:CDS DQ144600_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-9). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattggcacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagtcgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144602_PreC_P-B Feature FT:CDS DQ144602_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-12). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactatcgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ144606_PreC_P-B Feature FT:CDS DQ144606_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cq5-F2). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtagtttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ361535_PreC_P-B Feature FT:CDS DQ361535_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CRP-228). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacgcctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggttatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcaca
tctcctgtcttacttttggaagagagactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ377158_PreC_P-B Feature FT:CDS DQ377158_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WJT31). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttccgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtgatttcaca
tctcctgtcttacttttggaagagaaactgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448619_PreC_P-B Feature FT:CDS DQ448619_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448620_PreC_P-B Feature FT:CDS DQ448620_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYF). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448621_PreC_P-B Feature FT:CDS DQ448621_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-HQY). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatttcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448622_PreC_P-B Feature FT:CDS DQ448622_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-JSM). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctttatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttttagaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448623_PreC_P-B Feature FT:CDS DQ448623_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-LMX). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctgcaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448624_PreC_P-B Feature FT:CDS DQ448624_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-QSA). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcattccatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448625_PreC_P-B Feature FT:CDS DQ448625_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-TXB). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcacctttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448626_PreC_P-B Feature FT:CDS DQ448626_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-XLB). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggggaattgatgaatctagccacctgggtgggaagtaatttggaaga
tccatcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448627_PreC_P-B Feature FT:CDS DQ448627_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZFL). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ448628_PreC_P-B Feature FT:CDS DQ448628_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZX). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttag
>gnl|hbvcds|DQ463787_PreC_P-B Feature FT:CDS DQ463787_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgcctgctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctttgtatcgagaagccttagagtctcctgaacattgctcgcatcac
catacagcaatcaggcaagctgttttgtgctggggggaattaatgactctagcttcctgggtgggtagtaatttagacga
tccagcatccagagacctagtagtcaattatgttaacattaacatgggactaaagatcaggcaattattgtggtttcacc
tttcctgtattacctttgggaaagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463788_PreC_P-B Feature FT:CDS DQ463788_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_1979). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccgctgctttgtatcgggaagccttagagtctcctgaacattgctcgtctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttgggagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ463789_PreC_P-B Feature FT:CDS DQ463789_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_1979). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggcgctactgtggagttactctcttttttgcctactgacttctttc
cgtcggttcgagatctcctagacaccgccgctgctttgtttcgggaagccttagagtcccctgaacattgctcacctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tcaagcatccagagacctagtagtcaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacg
tttcctgtattatctttgggagagacattgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ463790_PreC_P-B Feature FT:CDS DQ463790_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_1979). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccactgctttgtatcgggaagccttagagtcttctgaacattgctcgtatcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttagacga
tccagcttccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtatcacc
tttcctgtcttacctttgggagagacactgttcatgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ463791_PreC_P-B Feature FT:CDS DQ463791_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_1979). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgcatctgctttgtatcgggaagccttagagtctcctgaacattgctcgcctcac
catacagcaatcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttacaaga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtattacctttggaagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463792_PreC_P-B Feature FT:CDS DQ463792_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_1979). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctctgtatagggaagccttagagtctccggaacattgctcggctcac
catacagcactcaggcaagctattttgtgctggggcgaattaatgactctagctacctgggtgggtaataatttagacga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacaccgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463793_PreC_P-B Feature FT:CDS DQ463793_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_1979). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagcttctgcgcagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccactgctttgtatcgagaagccttagagtctcctgaacatgtctcgcctcac
catacagcactcaggcaagccattttgtgctggggggacttaatgactctagctacatgggtgggtaataatttagaaga
tccagcatccagagacctagtagtcaattatgttaacaataccacgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|DQ463794_PreC_P-B Feature FT:CDS DQ463794_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_1979). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagctactgcggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccgctgctttgtatcgggaagccttagagtctcctgaacattgctcgcatcac
catacagcactcaggcaagctatcttatgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacg
tttcctgtcttacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|DQ463795_PreC_P-B Feature FT:CDS DQ463795_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctttgtttcgagaagctttagagtctcctgaacattgctcgcctcac
catacagcaatcaggcaagctgttttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttagacga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactgaagatcaggcaattattgtggtttcaca
tttcctgtattatctttgggagaagcactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463796_PreC_P-B Feature FT:CDS DQ463796_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggagcttctgtggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccactgctttgtttcgagaagccttagagtctcctgaacattgctctcctcac
catacagcaatcaggcaagccattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttagacga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtattatctttgggaaagacactgttcttgaatatttggtgtcatttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463797_PreC_P-B Feature FT:CDS DQ463797_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggcgctactgtggagttactctcttttttgcctactgacttctttc
cgtcggttcgagatctcctagacaccgccgctgctttgtttcgggaagccttagagtcccctgaacattgctcacctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tcaagcatccagagacctagtagtcaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacg
tttcctgtattatctttgggagagacattgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463798_PreC_P-B Feature FT:CDS DQ463798_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctttgtatcgggaagccttagagtctcctgaacattgttcggctcac
catacagcaatcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtagtaatttaaatga
tccagcttccagagacctagtagtcaattatgttaacattaacatgggactaaagatcaggcaattattgtggtatcaca
tttcctgtattacctttgggagagacactgttctcgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|DQ463799_PreC_P-B Feature FT:CDS DQ463799_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtgaacttactctctttcttgcctgctgacttctttc
cgtcggttcgggatctcctagacaccgcatctgctttgtatcgggaagccttagagtctcctgaacattgctcgcctcac
catacagcaatcaggcaagctattttgtgctgggggcaattaatgactttagcgtcctgggtgggtaataatttacaaga
tccagcatccagagacctagtagtcgattatgttaacaataacatgggactaatgatcaggcaattattgtggtttcacc
tgtcctgcattacctttggacaagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactccacccgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463800_PreC_P-B Feature FT:CDS DQ463800_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctctgtatagggatgccttggagtctccggaacattgctcggctcac
catacagcaatcaggcaagctattttgtgctggggcgaattaatgactctagctacctgggtgggtaataatttagacga
tccagcatccagagacctagtagtcaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtattacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ463801_PreC_P-B Feature FT:CDS DQ463801_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_2004). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgcggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccactgctttgtatcgagaagccttagagtctcctgaacatgtctcgcctcac
catacagcactcaggcaagccattttgtgctggggggacttaatgactctagctacatgggtgggtaataatttagaaga
tccagcatccagagacctagtagtcaattatgttaacaataccacgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttgggagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|DQ463802_PreC_P-B Feature FT:CDS DQ463802_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagcttctgtggagttactctctttcttgcctgctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctttgtatcgggaagccttagagtctcctcaacattgctcgcctcac
catacggcaatcaggcaagctattttatgctggggggaattaatgactctagcttcctgggtgggtaataatttagacga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacc
tttcctgtattacctttggaaaagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ904357_PreC_P-B Feature FT:CDS DQ904357_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattatggtttcaca
tttcctgtctttcttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaag
aagagctccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ975271_PreC_P-B Feature FT:CDS DQ975271_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatggggctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993680_PreC_P-B Feature FT:CDS DQ993680_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 268). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttcttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatcctgggaattattagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccacaaaatgcccctatcttatgaagacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993681_PreC_P-B Feature FT:CDS DQ993681_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 290). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagtaactctcttttttgcctactgactactttc
cttctattcgagatcttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|DQ993682_PreC_P-B Feature FT:CDS DQ993682_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 479). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgactaccttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcccgaatcttgggaaatagtaggcacctatgtcaatggtagcctggggctaagaggcagaccactattgcggtttcaca
tttcctgtcgtacttttggaagagaaactgttcgtgaatattgggggtcttttggaatgcgggttcccactcctactgaa
tatcgaccacccaaggccaatatcttatcaacacttccggaaaataccgctgttagacgaatatgcaggtcccctataag
aagaactccctcgcctcgcagactaagggctcattcgccgcgacggagaagatctcaatctcgggaagcttaatgtcat
>gnl|hbvcds|DQ993683_PreC_P-B Feature FT:CDS DQ993683_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 82). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgcatcaagaatttggatcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccaggatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacgtttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|DQ993684_PreC_P-B Feature FT:CDS DQ993684_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 336). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctacccacctgggtgggaagtaatttggaaga
cccagcatcatggaaattattagccacctgtcggaacgttaaaatgggcccaaaaattagccaactattgtggtttcaca
tttcctggcttatgtttgggagagaaactgttctggaatatttggggtcttttggagtgtggattcgcactcctactgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993685_PreC_P-B Feature FT:CDS DQ993685_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 554). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgcataaagaatttggagcttctgtggagtaactctcttatttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctggggaatctcaatgttag
>gnl|hbvcds|DQ993686_PreC_P-B Feature FT:CDS DQ993686_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 342). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatcctgggactttttagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993687_PreC_P-B Feature FT:CDS DQ993687_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 700). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggatcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtccgctatgttaatgttaatatgggcctaaaacttacacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993694_PreC_P-B Feature FT:CDS DQ993694_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 234). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993696_PreC_P-B Feature FT:CDS DQ993696_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 452b1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttaacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993697_PreC_P-B Feature FT:CDS DQ993697_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 940b1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttaacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgatccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993698_PreC_P-B Feature FT:CDS DQ993698_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0327-ETCvs3TC-Naive). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttgaactctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcgcctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtagtttcaca
tttcctgtctcactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993699_PreC_P-B Feature FT:CDS DQ993699_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0226-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttgaactctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacttgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993700_PreC_P-B Feature FT:CDS DQ993700_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0725-ETC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993701_PreC_P-B Feature FT:CDS DQ993701_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0210-ETCvs3TC-Brack). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993702_PreC_P-B Feature FT:CDS DQ993702_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0919-ETCvs3TC-Naive). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993703_PreC_P-B Feature FT:CDS DQ993703_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 236-0526-Nature1.2-Sero). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993704_PreC_P-B Feature FT:CDS DQ993704_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-1127-Nature3.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcaattatgtcaacgttaatgtgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagagtggattcgcactcctcctgca
taaagaccaccaaatgcccctatattatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaaa
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993705_PreC_P-B Feature FT:CDS DQ993705_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0625-Nature3.4-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggccattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatgtgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgataa
>gnl|hbvcds|DQ993706_PreC_P-B Feature FT:CDS DQ993706_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0402-Nature3.3-unSero). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993707_PreC_P-B Feature FT:CDS DQ993707_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-O218-Nature3.2-unSero). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagaggctccggaacattgttcacctcac
catacggcactcaggcaagctcttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993708_PreC_P-B Feature FT:CDS DQ993708_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-1228-Naive). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattccagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993709_PreC_P-B Feature FT:CDS DQ993709_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-0127-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctctcgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993710_PreC_P-B Feature FT:CDS DQ993710_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0718-ETC). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttgaactctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcgcctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtagtttcaca
tttcctgtctcactttcgggagagaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ993711_PreC_P-B Feature FT:CDS DQ993711_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 221-1120-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacctttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|DQ995801_PreC_P-B Feature FT:CDS DQ995801_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-6). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgtccaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ995802_PreC_P-B Feature FT:CDS DQ995802_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H293-16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattattcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagttagctatgtcaacgttaatatgggactaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagacaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|DQ995803_PreC_P-B Feature FT:CDS DQ995803_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C265-15). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgactcctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcaatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaca
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccttagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|DQ995804_PreC_P-B Feature FT:CDS DQ995804_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1691-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggaattgatctcttttttgcctgctgacttctttc
cttctgttcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgtacacctcac
catacagcaatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggtggtaatttggacga
tccagcatcaagagaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaaattttgtggtttcaca
tttcatgtctcacttttgggagagccactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tataggccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagagtcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|DQ995805_PreC_P-B Feature FT:CDS DQ995805_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-2.5KB). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatcccctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgctggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaaccgttactgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggagactactgttgttagatgcagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatttgga
>gnl|hbvcds|EF134945_PreC_P-B Feature FT:CDS EF134945_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF134946_PreC_P-B Feature FT:CDS EF134946_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473971_PreC_P-B Feature FT:CDS EF473971_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggactaaaaatcagacaactattgtggtttcacg
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473972_PreC_P-B Feature FT:CDS EF473972_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctagtgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattttgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
ccctgcatcccgggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473973_PreC_P-B Feature FT:CDS EF473973_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgactcctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgggttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgcccggtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473974_PreC_P-B Feature FT:CDS EF473974_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctccacaccgcctctgctttgaatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgggttggggtgagttaatgaatctagccacctgggtgggaagaaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagagtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgtcgggtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473975_PreC_P-B Feature FT:CDS EF473975_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473976_PreC_P-B Feature FT:CDS EF473976_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaaacatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagacccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF473977_PreC_P-B Feature FT:CDS EF473977_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD048East). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaattcggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctgacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcatacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF494380_PreC_P-B Feature FT:CDS EF494380_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW836). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgagtctagccacctgggtgggaagtaatttggatga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttag
>gnl|hbvcds|EF494381_PreC_P-B Feature FT:CDS EF494381_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW936). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagctaccgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggccctcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF494382_PreC_P-B Feature FT:CDS EF494382_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TWD347). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgccaatgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccaggatctagagaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatttttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacaaagaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcaccgcgtcgcaaaagatctcaatctcgggactctcaatgttag
>gnl|hbvcds|EU139543_PreC_P-B Feature FT:CDS EU139543_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU158262_PreC_P-B Feature FT:CDS EU158262_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G116). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttsamctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
cccagcatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU158263_PreC_P-B Feature FT:CDS EU158263_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G108). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
cacacggcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacga
tccagcatccagggaattggtagtcggctatgtcaacgttaatatgggactaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttgggaaagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctcaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|EU305547_PreC_P-B Feature FT:CDS EU305547_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-481). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagccattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU305548_PreC_P-B Feature FT:CDS EU305548_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-673). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306677_PreC_P-B Feature FT:CDS EU306677_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306678_PreC_P-B Feature FT:CDS EU306678_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306679_PreC_P-B Feature FT:CDS EU306679_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggcttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306680_PreC_P-B Feature FT:CDS EU306680_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggcttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306681_PreC_P-B Feature FT:CDS EU306681_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgggaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306695_PreC_P-B Feature FT:CDS EU306695_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctctgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306696_PreC_P-B Feature FT:CDS EU306696_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcacccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306697_PreC_P-B Feature FT:CDS EU306697_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306698_PreC_P-B Feature FT:CDS EU306698_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctctgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttactttcgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306699_PreC_P-B Feature FT:CDS EU306699_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatcacatgttcatgtcctactgttcaagcctccaagctgtgcctggggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatttcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgtgttgatgaatctagccacctgggtgggaagtaatttggaaaa
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306700_PreC_P-B Feature FT:CDS EU306700_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306701_PreC_P-B Feature FT:CDS EU306701_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306702_PreC_P-B Feature FT:CDS EU306702_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaggaatttggagcttctgtggagttactctcttttctgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306703_PreC_P-B Feature FT:CDS EU306703_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatggcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306704_PreC_P-B Feature FT:CDS EU306704_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306705_PreC_P-B Feature FT:CDS EU306705_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagaatctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306706_PreC_P-B Feature FT:CDS EU306706_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306707_PreC_P-B Feature FT:CDS EU306707_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcgctcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306708_PreC_P-B Feature FT:CDS EU306708_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306709_PreC_P-B Feature FT:CDS EU306709_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaccattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306710_PreC_P-B Feature FT:CDS EU306710_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306711_PreC_P-B Feature FT:CDS EU306711_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgacttatttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU306712_PreC_P-B Feature FT:CDS EU306712_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccacctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330989_PreC_P-B Feature FT:CDS EU330989_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-74). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccctagagtctccggagcattgttcacctcac
catacggcgctcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330990_PreC_P-B Feature FT:CDS EU330990_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-146). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccctagagtctccggagcattgttcacctcac
catacggcgctcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330992_PreC_P-B Feature FT:CDS EU330992_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-6). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330994_PreC_P-B Feature FT:CDS EU330994_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-10). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330995_PreC_P-B Feature FT:CDS EU330995_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-80). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacgccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtgaattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330996_PreC_P-B Feature FT:CDS EU330996_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-81). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgccctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagccaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgcggattcgcactacccccgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330997_PreC_P-B Feature FT:CDS EU330997_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-216). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
taggggcatggacattgacccgtataaaggatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330998_PreC_P-B Feature FT:CDS EU330998_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1043). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU330999_PreC_P-B Feature FT:CDS EU330999_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1044). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU331000_PreC_P-B Feature FT:CDS EU331000_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1045). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU331001_PreC_P-B Feature FT:CDS EU331001_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1046). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU350409_PreC_P-B Feature FT:CDS EU350409_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BTO5856). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439018_PreC_P-B Feature FT:CDS EU439018_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439020_PreC_P-B Feature FT:CDS EU439020_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439021_PreC_P-B Feature FT:CDS EU439021_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctrmctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgctag
>gnl|hbvcds|EU439022_PreC_P-B Feature FT:CDS EU439022_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU439023_PreC_P-B Feature FT:CDS EU439023_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgcgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU487256_PreC_P-B Feature FT:CDS EU487256_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatgctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttactttcgggagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactcctaccgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU487257_PreC_P-B Feature FT:CDS EU487257_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient14). Complete genome. [Hepadnaviridae] (length=639 residues).
ttgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtgccgttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatggggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacga
tccagcatccagggaagtagtagtcaactatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522066_PreC_P-B Feature FT:CDS EU522066_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4N). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522067_PreC_P-B Feature FT:CDS EU522067_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4T). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagtgactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522072_PreC_P-B Feature FT:CDS EU522072_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8N). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtccactagaag
aagaactccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522073_PreC_P-B Feature FT:CDS EU522073_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catactgcgatcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacaaagaggcaggtccactagaag
aagaactccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522074_PreC_P-B Feature FT:CDS EU522074_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttaggacatggacatcgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctaatattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catactgcgctcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccacatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU522075_PreC_P-B Feature FT:CDS EU522075_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgtgatctcctcgacaccgcctctgctctgtatcggaaggccttagagtctccggaacattgttcacctcac
catactgcgatcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacaaagaggcaggtccactagaag
aagaactccctcgcctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU547563_PreC_P-B Feature FT:CDS EU547563_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MC06). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttttttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaacttggaaga
tccagcatccagggaattagtagtcggttatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacc
tttcctgtcttatgtttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtcccttagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU564822_PreC_P-B Feature FT:CDS EU564822_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TA). Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacggcgctcaggcaagctattcaatgttggggtgaagtaatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaatcagtagttagctatgtcaacattaatatgggcctcaaaatgagacaactattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctccagca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|EU564823_PreC_P-B Feature FT:CDS EU564823_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TB). Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacggcgctcaggcaagctattcaatgttggggtgaagtaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaatcagtagttagctatgtcaacattaatatgggcctcaaaatgagacaactattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctccagca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|EU564824_PreC_P-B Feature FT:CDS EU564824_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10N). Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcac
catacggcgctcaggcaagctattcaatgttggggtgaagtaatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaatcagtagttagctatgtcaacattaatatgggcctcaaaatgagacaactattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctccagca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|EU564825_PreC_P-B Feature FT:CDS EU564825_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11T). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
ttgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggctctcaggcaagctgttgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgtaaatatgggccttaaaatcagacaactattgtggttccaca
tttcctgtctcacttttgggagacaaactgttcttgactatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU564826_PreC_P-B Feature FT:CDS EU564826_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11N). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatcttctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcac
catacggcgctcaggcaagctgttgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgtaaatatgggccttaaaatcagacaactattgtggttccaca
tttcctgtctcacttttgggagacatattgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccctaatgttag
>gnl|hbvcds|EU570069_PreC_P-B Feature FT:CDS EU570069_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttcagacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttggacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570070_PreC_P-B Feature FT:CDS EU570070_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcacccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570071_PreC_P-B Feature FT:CDS EU570071_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4-B24). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagaatctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU570075_PreC_P-B Feature FT:CDS EU570075_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11-S142). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaag
aagaactccctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|EU579441_PreC_P-B Feature FT:CDS EU579441_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccatcaaatgcccctatcttatcaacacttccggaaaatactgttgttagaccaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU589335_PreC_P-B Feature FT:CDS EU589335_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142-5). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctatgtttcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaacatactgttgttagataaagacgcaggtcccctggaag
aagaactccctcgcctcgccgaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|EU595031_PreC_P-B Feature FT:CDS EU595031_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660224_PreC_P-B Feature FT:CDS EU660224_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-12N). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttactttcgggagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactcctatcgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660230_PreC_P-B Feature FT:CDS EU660230_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660231_PreC_P-B Feature FT:CDS EU660231_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatcgggaagccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660232_PreC_P-B Feature FT:CDS EU660232_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU660233_PreC_P-B Feature FT:CDS EU660233_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796066_PreC_P-B Feature FT:CDS EU796066_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcgattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgctcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU796067_PreC_P-B Feature FT:CDS EU796067_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796068_PreC_P-B Feature FT:CDS EU796068_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcctctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU796071_PreC_P-B Feature FT:CDS EU796071_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU881997_PreC_P-B Feature FT:CDS EU881997_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU881998_PreC_P-B Feature FT:CDS EU881998_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaacttttttacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU882002_PreC_P-B Feature FT:CDS EU882002_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient20). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU882003_PreC_P-B Feature FT:CDS EU882003_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaaatatggtggtttcaca
tttcctgtcttacatttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU882004_PreC_P-B Feature FT:CDS EU882004_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacatttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919171_PreC_P-B Feature FT:CDS EU919171_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient29). Complete genome. [Hepadnaviridae] (length=639 residues).
ttgcaattttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggatcatgtttcagctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacaacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcgatgttag
>gnl|hbvcds|EU919172_PreC_P-B Feature FT:CDS EU919172_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919173_PreC_P-B Feature FT:CDS EU919173_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgagaagccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU919175_PreC_P-B Feature FT:CDS EU919175_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacggcaatcaggcaagctattctctgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|EU919176_PreC_P-B Feature FT:CDS EU919176_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacggcaatcaggcaagctattctctgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|EU939559_PreC_P-B Feature FT:CDS EU939559_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C67). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctattgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|EU939633_PreC_P-B Feature FT:CDS EU939633_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C181). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatgcgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939634_PreC_P-B Feature FT:CDS EU939634_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C19). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatgcgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactattgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939635_PreC_P-B Feature FT:CDS EU939635_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B125). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctcctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaaga
tgcagcatccagggaattagtagtcggctatgtcaacgttaatatgggcttaaaactcatacaactattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939636_PreC_P-B Feature FT:CDS EU939636_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgcctcctgacttttatc
cttctattcgagatctcctcgataccgcctctgctctatatcgggaggccttagagtctccggaacattgtacagctcat
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaggcaatttggaaga
tcccgcatccagagaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttattagacgaagaagcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttag
>gnl|hbvcds|EU939637_PreC_P-B Feature FT:CDS EU939637_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C13). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcgctcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|EU939638_PreC_P-B Feature FT:CDS EU939638_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttc
cttctgttcgagatctsctcgacaccgcctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939639_PreC_P-B Feature FT:CDS EU939639_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C28). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacatcgacccgtataaagaatttggagcatctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagctacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939660_PreC_P-B Feature FT:CDS EU939660_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C34). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctcgacaccgctactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939661_PreC_P-B Feature FT:CDS EU939661_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C40). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcctactgacttctttc
cttctattcgagatctcctcgacaccgcaactgctctgtatagggaggccttagagtctccggaacattgctcatatcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaagcagtagttagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggaaggaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagacgaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939663_PreC_P-B Feature FT:CDS EU939663_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C74). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggcagtaatttggaaga
tcaagcatccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939664_PreC_P-B Feature FT:CDS EU939664_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C85). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttcgktggarttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgtgaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU939665_PreC_P-B Feature FT:CDS EU939665_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C129). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggrcatggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggagttagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggtgtgtggattcgcactcctcctcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaagaaggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939666_PreC_P-B Feature FT:CDS EU939666_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C150). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939667_PreC_P-B Feature FT:CDS EU939667_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C171). Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaagcagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU939669_PreC_P-B Feature FT:CDS EU939669_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaggcatccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939670_PreC_P-B Feature FT:CDS EU939670_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C189). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacccctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgagggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|EU939671_PreC_P-B Feature FT:CDS EU939671_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C201). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tcaagcatccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939672_PreC_P-B Feature FT:CDS EU939672_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939673_PreC_P-B Feature FT:CDS EU939673_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C219). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939674_PreC_P-B Feature FT:CDS EU939674_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tcaagcatccagggacttagtagtcggttatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939675_PreC_P-B Feature FT:CDS EU939675_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C235). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacttttcaagcctccaagctgtgccttaggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgccgctgctctgtatcgggaggccttggagtctcccgaacattgttcagctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
cttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggagtgtactgttgttagacaacgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939676_PreC_P-B Feature FT:CDS EU939676_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D54). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU939677_PreC_P-B Feature FT:CDS EU939677_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D95). Complete genome. [Hepadnaviridae] (length=639 residues).
atggaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctttggagttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
cacacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacc
tttcctgtcttatgtttgggagagagactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaagcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|EU939678_PreC_P-B Feature FT:CDS EU939678_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D106). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatcgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcgctcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaagtaatttgcaaga
tcaagcatccagggacttagtagtcaactatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcacg
tttcctgtcttatgtttggaagagacactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tataggccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|EU939679_PreC_P-B Feature FT:CDS EU939679_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D134). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcggctcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023569_PreC_P-B Feature FT:CDS FJ023569_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-0081). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactatcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023573_PreC_P-B Feature FT:CDS FJ023573_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-0469). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctctttattgccttctgatttctttc
catctattcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023575_PreC_P-B Feature FT:CDS FJ023575_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-0990). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgataccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatcttgctacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgct
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023576_PreC_P-B Feature FT:CDS FJ023576_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-1046). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtatgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ023605_PreC_P-B Feature FT:CDS FJ023605_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023606_PreC_P-B Feature FT:CDS FJ023606_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023607_PreC_P-B Feature FT:CDS FJ023607_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023608_PreC_P-B Feature FT:CDS FJ023608_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactggtcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023609_PreC_P-B Feature FT:CDS FJ023609_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023610_PreC_P-B Feature FT:CDS FJ023610_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccggggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023611_PreC_P-B Feature FT:CDS FJ023611_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023612_PreC_P-B Feature FT:CDS FJ023612_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023613_PreC_P-B Feature FT:CDS FJ023613_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggaaatcccaatgttag
>gnl|hbvcds|FJ023614_PreC_P-B Feature FT:CDS FJ023614_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3692). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023617_PreC_P-B Feature FT:CDS FJ023617_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3718). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctattcgagaccttctcgacaccgcatcagccctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagcagttttgtgttggggggagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtaaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatcccaatgttag
>gnl|hbvcds|FJ023618_PreC_P-B Feature FT:CDS FJ023618_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3718). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctattcgagaccttctcgacaccgcatcagccctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtaaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023620_PreC_P-B Feature FT:CDS FJ023620_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3718). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctattcgagaccttctcgacaccgcatcagccctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagcagttttgtgttggggggagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtaaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacaattccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023627_PreC_P-B Feature FT:CDS FJ023627_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3979). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcgctcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023628_PreC_P-B Feature FT:CDS FJ023628_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3979). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggcgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023629_PreC_P-B Feature FT:CDS FJ023629_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3979). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ023630_PreC_P-B Feature FT:CDS FJ023630_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M04-3979). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctatacgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcgctcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaattccaatgttag
>gnl|hbvcds|FJ023631_PreC_P-B Feature FT:CDS FJ023631_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2_C04-1213). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcatc
tttcctgtcttacctttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaaactgctgttgttagatcaagagtcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023632_PreC_P-B Feature FT:CDS FJ023632_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0254). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctatgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023633_PreC_P-B Feature FT:CDS FJ023633_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0583). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023634_PreC_P-B Feature FT:CDS FJ023634_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-1358). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023635_PreC_P-B Feature FT:CDS FJ023635_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0467). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023636_PreC_P-B Feature FT:CDS FJ023636_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0876). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattctatgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023637_PreC_P-B Feature FT:CDS FJ023637_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0013). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagttgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtacagggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatcttgctacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aaggactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ023638_PreC_P-B Feature FT:CDS FJ023638_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0465). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatcttgctacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032342_PreC_P-B Feature FT:CDS FJ032342_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcctctgcggagttaatctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaggtaatttgcaaga
tcaagcatccagggatttagtagtcaactatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcagcacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ032344_PreC_P-B Feature FT:CDS FJ032344_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaag
aagaactccctcgcctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|FJ032349_PreC_P-B Feature FT:CDS FJ032349_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggttatgtcaacgttaatatgggcctaaaactcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032352_PreC_P-B Feature FT:CDS FJ032352_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-3). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttccttc
cttctattcgagatctcctcgacaccgcctccgctctgtatagggaggccttagagtctccagaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032353_PreC_P-B Feature FT:CDS FJ032353_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctcttcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctccgctctgtatagggaggccttagagtctccagaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttgggaga
tccagcatccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032354_PreC_P-B Feature FT:CDS FJ032354_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctccgctctgtatagggaggccttagagtctccagaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032357_PreC_P-B Feature FT:CDS FJ032357_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ032358_PreC_P-B Feature FT:CDS FJ032358_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctatggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagg
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349236_PreC_P-B Feature FT:CDS FJ349236_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagacccccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386582_PreC_P-B Feature FT:CDS FJ386582_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1765). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386583_PreC_P-B Feature FT:CDS FJ386583_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1780). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386584_PreC_P-B Feature FT:CDS FJ386584_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1798). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcgctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386600_PreC_P-B Feature FT:CDS FJ386600_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1893). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaaaatggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386608_PreC_P-B Feature FT:CDS FJ386608_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1998). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtagagttactctcttttttgccttctgacttctttc
cttccatacgagatctcctcgacaccgcctctgctctgtttcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgagtctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttattgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttag
>gnl|hbvcds|FJ386610_PreC_P-B Feature FT:CDS FJ386610_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2000). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctnttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386615_PreC_P-B Feature FT:CDS FJ386615_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggactcagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386634_PreC_P-B Feature FT:CDS FJ386634_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2392). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386636_PreC_P-B Feature FT:CDS FJ386636_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1813). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacmcstataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386642_PreC_P-B Feature FT:CDS FJ386642_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1829). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386648_PreC_P-B Feature FT:CDS FJ386648_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2419). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctttggagttactctcttttttgccttctgacttctttc
cttctatacgagatctcctcgacaccgccgctgctctgtatcgggaggccttagagtctccggtacattgtacacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcttgtcttacttttgggagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggattctcaatgttag
>gnl|hbvcds|FJ386654_PreC_P-B Feature FT:CDS FJ386654_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S51). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ386655_PreC_P-B Feature FT:CDS FJ386655_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S121). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386656_PreC_P-B Feature FT:CDS FJ386656_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctatgtttcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaag
aagaactccctcgcctcgccgaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttag
>gnl|hbvcds|FJ386658_PreC_P-B Feature FT:CDS FJ386658_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S185). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtagagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacggcactcaggcaagctattctatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacc
tttcctgtcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccatcaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386660_PreC_P-B Feature FT:CDS FJ386660_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S221). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggacttagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ386666_PreC_P-B Feature FT:CDS FJ386666_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S367). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386668_PreC_P-B Feature FT:CDS FJ386668_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S395). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386669_PreC_P-B Feature FT:CDS FJ386669_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S411). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggacga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386675_PreC_P-B Feature FT:CDS FJ386675_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggttatgtcaacgttaatatgggcctaaaactcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386676_PreC_P-B Feature FT:CDS FJ386676_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1055). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctactctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386680_PreC_P-B Feature FT:CDS FJ386680_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1244). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcaactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaacttttgtggtttcaca
tttcctgtctaacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|FJ386681_PreC_P-B Feature FT:CDS FJ386681_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1336). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttaa
>gnl|hbvcds|FJ386682_PreC_P-B Feature FT:CDS FJ386682_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1416). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ386683_PreC_P-B Feature FT:CDS FJ386683_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1450). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386684_PreC_P-B Feature FT:CDS FJ386684_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1554). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ386688_PreC_P-B Feature FT:CDS FJ386688_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1632). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtctttcttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ518811_PreC_P-B Feature FT:CDS FJ518811_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcttctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ518812_PreC_P-B Feature FT:CDS FJ518812_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagcaacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562219_PreC_P-B Feature FT:CDS FJ562219_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacccctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562222_PreC_P-B Feature FT:CDS FJ562222_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I14). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattctgtgttggggggagttgatgaatctagctacctgggtgggaagtaatttggaaga
tcaagcatccagggaattggtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgaaaaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562224_PreC_P-B Feature FT:CDS FJ562224_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I16). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562231_PreC_P-B Feature FT:CDS FJ562231_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I44). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562234_PreC_P-B Feature FT:CDS FJ562234_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I49). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacggtcatatgggcctaaaactcagacaactattgtggtttcaca
tttcttgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562236_PreC_P-B Feature FT:CDS FJ562236_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I51). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctacggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcatgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562237_PreC_P-B Feature FT:CDS FJ562237_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I53). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgctgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562240_PreC_P-B Feature FT:CDS FJ562240_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I65). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaacctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562246_PreC_P-B Feature FT:CDS FJ562246_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I74). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcytgttcatgtcctactkttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacmcgtataaagaatttggagcttctgtggarttactctcttttttgccttcygacttytttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcatatcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtggtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttactttcgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactccacctgca
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562253_PreC_P-B Feature FT:CDS FJ562253_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I86). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactccgacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562254_PreC_P-B Feature FT:CDS FJ562254_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I87). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|FJ562257_PreC_P-B Feature FT:CDS FJ562257_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I96). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562259_PreC_P-B Feature FT:CDS FJ562259_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I106). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacggcactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaaga
tccacaatccagggaagcagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562260_PreC_P-B Feature FT:CDS FJ562260_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I107). Complete genome. [Hepadnaviridae] (length=639 residues).
ttgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatygacacstataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctcctcgacaccgccaatgctctgtatcgggagtccttagagtctccggaacattgttcagatcac
catacggcaatcaggcacgctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgttattgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562262_PreC_P-B Feature FT:CDS FJ562262_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I111). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562289_PreC_P-B Feature FT:CDS FJ562289_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I160). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562296_PreC_P-B Feature FT:CDS FJ562296_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I171). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacatygacccgtataaagaatttggagcttctgyggagttactctcktttttgccttctgacttctttc
cttctrttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtctttcttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttattagaggaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562303_PreC_P-B Feature FT:CDS FJ562303_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I189). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgctgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562311_PreC_P-B Feature FT:CDS FJ562311_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I202). Complete genome. [Hepadnaviridae] (length=639 residues).
ttgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaaggatccagggatttagtagtcggatatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcttgtcttacttttgggagacaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcg
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagagggagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ562312_PreC_P-B Feature FT:CDS FJ562312_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I203). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgtctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgccgctgctttgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggactaaaactcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ562316_PreC_P-B Feature FT:CDS FJ562316_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I208). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacttataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ562321_PreC_P-B Feature FT:CDS FJ562321_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I214). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatcttctcgacaccgccactgctctgtatcgggatgccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ562322_PreC_P-B Feature FT:CDS FJ562322_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I216). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ592177_PreC_P-B Feature FT:CDS FJ592177_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ667207_PreC_P-B Feature FT:CDS FJ667207_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Mars_RJ_8803658). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
catctattcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgtcaatatgggcctaaaaattagacaacttttatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|FJ751766_PreC_P-B Feature FT:CDS FJ751766_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacggcacttaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccccatcttatcaacacttccggaaactgctattgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ751767_PreC_P-B Feature FT:CDS FJ751767_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, LHBs, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ751769_PreC_P-B Feature FT:CDS FJ751769_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=634 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaacttagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccccatcttatcaacacttccggaaactactattgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaat
>gnl|hbvcds|FJ755833_PreC_P-B Feature FT:CDS FJ755833_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttcttcc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagg
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccccatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatga
>gnl|hbvcds|FJ787444_PreC_P-B Feature FT:CDS FJ787444_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S208-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcata
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787475_PreC_P-B Feature FT:CDS FJ787475_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tcaagcatccagggatttagtagtcggctatgttaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcacccctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787476_PreC_P-B Feature FT:CDS FJ787476_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-3). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatttgagatctcctcgacaccgccactgctttgtatcgggaggccttggagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tcaagcatccagggatttagtagtcggctatgttaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtatcttttggagtgtggattcgcacccctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ787477_PreC_P-B Feature FT:CDS FJ787477_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LWM-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggaaatttggatga
tcaagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ899779_PreC_P-B Feature FT:CDS FJ899779_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaggcatccagggatttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899784_PreC_P-B Feature FT:CDS FJ899784_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899785_PreC_P-B Feature FT:CDS FJ899785_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttc
cttctgttcgagacctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggatga
tccagcatccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899786_PreC_P-B Feature FT:CDS FJ899786_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-7). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactcccttttttaccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggatga
tccagcatccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899787_PreC_P-B Feature FT:CDS FJ899787_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttaccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtatgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacga
tccagcatccagggaattagtagtcggccatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgtcgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899790_PreC_P-B Feature FT:CDS FJ899790_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tcaagcatccagggacttagtagtcggttatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ899791_PreC_P-B Feature FT:CDS FJ899791_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tcaagcatccagggacttagtagtcggttatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctggaatatttggtgtcttttggagtgtggattcgcactcctcctcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358136_PreC_P-B Feature FT:CDS GQ358136_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHB134). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcctcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctccagca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358137_PreC_P-B Feature FT:CDS GQ358137_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY001). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcccctctgcctaaacatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcc
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagaagaaggtatcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358138_PreC_P-B Feature FT:CDS GQ358138_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY041). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacttgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358139_PreC_P-B Feature FT:CDS GQ358139_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT032). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaaacatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacacagcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcaccgcgtcgcagaagatttcaatctcggtaatctcaatgttag
>gnl|hbvcds|GQ358140_PreC_P-B Feature FT:CDS GQ358140_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT020). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358141_PreC_P-B Feature FT:CDS GQ358141_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY009). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggcgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctgacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358142_PreC_P-B Feature FT:CDS GQ358142_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LAR070). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcgacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358143_PreC_P-B Feature FT:CDS GQ358143_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CBL027). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
ccccgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtctgacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactagtgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358144_PreC_P-B Feature FT:CDS GQ358144_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcccctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatagggaggccttagaatctccggaacattgttcacctcac
catacggcactcaggaaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaataagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358145_PreC_P-B Feature FT:CDS GQ358145_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI04). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtcaccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggggagttgatgaatctagcaacctggttgggaagtaatttgaaaga
cccagcatccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaataagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagaggaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358146_PreC_P-B Feature FT:CDS GQ358146_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI35). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctaatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggggagttgatgaatctagcaacctggttgggaagtaatttgaaaga
cccagcatccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaataagacaattgttgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358147_PreC_P-B Feature FT:CDS GQ358147_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI43). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggat
ttggggcatggacattgacccgtataaagaatttggagcttctgtggaggtactctcttttttgccttctgactcctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggggagttgatgaatctagcaacctggttgggaagtaatttgaaaga
cccagcatccagggaattagtagtcagttatgttaatgttaatatgggcctaaaaataagacaattattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgcctcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358148_PreC_P-B Feature FT:CDS GQ358148_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ALO36). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcatctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccaaggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaaaagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctattttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358149_PreC_P-B Feature FT:CDS GQ358149_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN001). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagagactgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358150_PreC_P-B Feature FT:CDS GQ358150_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN009). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagagaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358151_PreC_P-B Feature FT:CDS GQ358151_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN011). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagaccttctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ358152_PreC_P-B Feature FT:CDS GQ358152_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN037). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagagactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377519_PreC_P-B Feature FT:CDS GQ377519_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J16). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377525_PreC_P-B Feature FT:CDS GQ377525_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J24). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatcttctcgacaccgcctctgctctccatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcccgcatccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377537_PreC_P-B Feature FT:CDS GQ377537_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J48). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377542_PreC_P-B Feature FT:CDS GQ377542_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J61). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377547_PreC_P-B Feature FT:CDS GQ377547_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J78). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcata
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377550_PreC_P-B Feature FT:CDS GQ377550_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J81). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttcggacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcccgcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|GQ377558_PreC_P-B Feature FT:CDS GQ377558_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J89). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377561_PreC_P-B Feature FT:CDS GQ377561_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J96). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgttaacgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377566_PreC_P-B Feature FT:CDS GQ377566_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J101). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377567_PreC_P-B Feature FT:CDS GQ377567_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J102). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|GQ377568_PreC_P-B Feature FT:CDS GQ377568_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J103). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377569_PreC_P-B Feature FT:CDS GQ377569_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J105). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377582_PreC_P-B Feature FT:CDS GQ377582_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J131). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctgctcgacaccgctactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggctctcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377587_PreC_P-B Feature FT:CDS GQ377587_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J138). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377588_PreC_P-B Feature FT:CDS GQ377588_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J141). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377606_PreC_P-B Feature FT:CDS GQ377606_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J171). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactgaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377610_PreC_P-B Feature FT:CDS GQ377610_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J177). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacgcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggtctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctccggca
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377612_PreC_P-B Feature FT:CDS GQ377612_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J180). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377622_PreC_P-B Feature FT:CDS GQ377622_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J207). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377625_PreC_P-B Feature FT:CDS GQ377625_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J222). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaaactgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377629_PreC_P-B Feature FT:CDS GQ377629_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J234). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377638_PreC_P-B Feature FT:CDS GQ377638_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J250). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377639_PreC_P-B Feature FT:CDS GQ377639_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J251). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggggagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377641_PreC_P-B Feature FT:CDS GQ377641_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J254). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377643_PreC_P-B Feature FT:CDS GQ377643_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J258). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ377644_PreC_P-B Feature FT:CDS GQ377644_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J294). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtcgagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcaatcaggcaatgtattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggttatgtcaacgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaagacgcaggtcccctagaag
aagaactccatcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ475340_PreC_P-B Feature FT:CDS GQ475340_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KOR36HCC). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ855522_PreC_P-B Feature FT:CDS GQ855522_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 23). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ855526_PreC_P-B Feature FT:CDS GQ855526_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 103). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=637 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtaagctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacctaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatcacaatctccggaatctcaatgtt
>gnl|hbvcds|GQ855532_PreC_P-B Feature FT:CDS GQ855532_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate migrant 210). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924603_PreC_P-B Feature FT:CDS GQ924603_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924605_PreC_P-B Feature FT:CDS GQ924605_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttctngaatanttggtntcttttggagtgtggattcgcactcntcctgca
tatagaccnccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcncctcgcagrcgaaggtctcaatcgccgcgtggcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924606_PreC_P-B Feature FT:CDS GQ924606_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgntctgtatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattstgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924607_PreC_P-B Feature FT:CDS GQ924607_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M13). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatggccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924608_PreC_P-B Feature FT:CDS GQ924608_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M15). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924610_PreC_P-B Feature FT:CDS GQ924610_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M19). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccggtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924611_PreC_P-B Feature FT:CDS GQ924611_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M28). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattmtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924617_PreC_P-B Feature FT:CDS GQ924617_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M34). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgagtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatacgggatcttctcgacaccgcttctgctctgtatcgggaggcattagagtctccggaacattgttcacatcac
catacggcactcaggcaagctattctgtgctggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgaagcaggtcccttagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|GQ924621_PreC_P-B Feature FT:CDS GQ924621_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M39). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttagaaga
cccagcatccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924624_PreC_P-B Feature FT:CDS GQ924624_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M42). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgcatcgggaggccttagagtctccggaacactgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tcctgcatccagggaattagtagtcagctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatacttggtgtcwtttggagtgtggattcgcactcctcctgca
tacagaccaccaaatgcccctatcttatccactcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924625_PreC_P-B Feature FT:CDS GQ924625_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M43). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcgtctaccgagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagctacctgggtgggaggtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|GQ924626_PreC_P-B Feature FT:CDS GQ924626_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M47). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctgatgacttctttc
cttctgttcgagatcttcttgacactgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagagaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcacr
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924627_PreC_P-B Feature FT:CDS GQ924627_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M48). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924628_PreC_P-B Feature FT:CDS GQ924628_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M50). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgcacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
ccaagcatccagggatttagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgtccttgaatatctggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ924630_PreC_P-B Feature FT:CDS GQ924630_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M52). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgcctgttgacttctatc
cttctattcgagatctcctcgacaccgcctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcattaaggcaagctattgtgtgttggggtgagttggtgaatctagccacctgggtgggaggtaatttggaaga
tcaagcatccagggaattagtagtcggctatgtcaacggtaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggcttcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ924631_PreC_P-B Feature FT:CDS GQ924631_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M53). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccggcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924632_PreC_P-B Feature FT:CDS GQ924632_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M54). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccctataaagaatttggagcttctgtgcagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatgtttcagctcac
catacggctctcaggcaagctattctgtgttggggtgagttaatgaacctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggatttagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagacaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|GQ924634_PreC_P-B Feature FT:CDS GQ924634_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M57). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattttgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924635_PreC_P-B Feature FT:CDS GQ924635_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M67). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttccgtggagttactctcttttttgcctactgacttctttc
cttctgttcgagatctgctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
ccccgcatccagggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtattacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcaggcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacaaggaagcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatttcaatgtcgggaatgtcaatgttag
>gnl|hbvcds|GQ924637_PreC_P-B Feature FT:CDS GQ924637_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M69). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacatctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatcttcttgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catactgcgctcaggcaagctattgtgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
cccagcatccagggatttagtagtcagctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtattacttttggaagagaaattgttcttgaatatttggtctctttcggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactgctgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|GQ924638_PreC_P-B Feature FT:CDS GQ924638_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M70). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctccgccctgtttcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
cccagcatccagggaatcagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacc
tttcctgtcttacttttggaagagaagttgttcttgaatatttggtctctttcggagtgtggattcgcactccttctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagaggacgaggcaggtcccctagaag
aagaactccctcgcgtcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924639_PreC_P-B Feature FT:CDS GQ924639_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M71). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatcttctcgacaccgcctccgccctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctctttcggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaattactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcgtcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924640_PreC_P-B Feature FT:CDS GQ924640_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M72). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttggttggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgggatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggggagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924641_PreC_P-B Feature FT:CDS GQ924641_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M76). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcttctgcggagttactctcttttttgcctactgacttctatc
cttctgttcgagatcttctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctatgttggggtgaattgatgaatctagccacctgggtgggaggtaatttggaaga
ccaagcatccagggaatcagtagtcagatatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtattacttttggaagagaaattgttgttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggagtgtgctgttgttagtcgaaggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatgtagggaacctcaatgttag
>gnl|hbvcds|GQ924644_PreC_P-B Feature FT:CDS GQ924644_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M79). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctggggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924645_PreC_P-B Feature FT:CDS GQ924645_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M82). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctctaagctgtgccttgggtggct
ttagggcatggacattgacccatataaagaatttggagcttctacggagttactctcttttttgccttctgacttttttc
cttctattcgagatcttctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacactgtacacctcac
catacggcgctcaggcaagctattctgtgttggggtgagttaatgaatcttgccacctgggtggggagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tctcctgtcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcaggca
tatagaccatcaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaagcaggtcccttagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ924646_PreC_P-B Feature FT:CDS GQ924646_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M83). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccgagctgtgccttgagtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatagggaggccttagaatctccggaacattgttcagctcac
catacggcactcaggcaagctgttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggacttagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgga
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|GQ924647_PreC_P-B Feature FT:CDS GQ924647_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
ctgctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaagcaatagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaactactgttgttagaggaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924648_PreC_P-B Feature FT:CDS GQ924648_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatatttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagccatgtcaacgttaatatgggcctaaaaatgagacaaatattgtggtttcaca
tttcctgtctttgttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924651_PreC_P-B Feature FT:CDS GQ924651_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M88). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924653_PreC_P-B Feature FT:CDS GQ924653_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M90). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924654_PreC_P-B Feature FT:CDS GQ924654_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M91). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ924656_PreC_P-B Feature FT:CDS GQ924656_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M93). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgatccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctgtccgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggagcattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tcaagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgccttgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ924660_PreC_P-B Feature FT:CDS GQ924660_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M74). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctccgctttgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatctggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccaca
tttcttgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|GU357842_PreC_P-B Feature FT:CDS GU357842_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C4371). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU434372_PreC_P-B Feature FT:CDS GU434372_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 011-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU434373_PreC_P-B Feature FT:CDS GU434373_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 209-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU451682_PreC_P-B Feature FT:CDS GU451682_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pLL-EGFP). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcctctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815548_PreC_P-B Feature FT:CDS GU815548_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815549_PreC_P-B Feature FT:CDS GU815549_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815550_PreC_P-B Feature FT:CDS GU815550_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatcccgggaatctcaatgttag
>gnl|hbvcds|GU815551_PreC_P-B Feature FT:CDS GU815551_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815552_PreC_P-B Feature FT:CDS GU815552_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815553_PreC_P-B Feature FT:CDS GU815553_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815554_PreC_P-B Feature FT:CDS GU815554_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcaactatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815555_PreC_P-B Feature FT:CDS GU815555_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815556_PreC_P-B Feature FT:CDS GU815556_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815557_PreC_P-B Feature FT:CDS GU815557_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815558_PreC_P-B Feature FT:CDS GU815558_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcgtggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctcctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815559_PreC_P-B Feature FT:CDS GU815559_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815560_PreC_P-B Feature FT:CDS GU815560_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815561_PreC_P-B Feature FT:CDS GU815561_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815562_PreC_P-B Feature FT:CDS GU815562_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815563_PreC_P-B Feature FT:CDS GU815563_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815564_PreC_P-B Feature FT:CDS GU815564_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815565_PreC_P-B Feature FT:CDS GU815565_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815566_PreC_P-B Feature FT:CDS GU815566_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815567_PreC_P-B Feature FT:CDS GU815567_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815568_PreC_P-B Feature FT:CDS GU815568_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815569_PreC_P-B Feature FT:CDS GU815569_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815570_PreC_P-B Feature FT:CDS GU815570_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815571_PreC_P-B Feature FT:CDS GU815571_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815572_PreC_P-B Feature FT:CDS GU815572_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-1). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaagctactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU815573_PreC_P-B Feature FT:CDS GU815573_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-2). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815574_PreC_P-B Feature FT:CDS GU815574_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815575_PreC_P-B Feature FT:CDS GU815575_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815576_PreC_P-B Feature FT:CDS GU815576_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815577_PreC_P-B Feature FT:CDS GU815577_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815578_PreC_P-B Feature FT:CDS GU815578_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatgtgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815579_PreC_P-B Feature FT:CDS GU815579_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815581_PreC_P-B Feature FT:CDS GU815581_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815583_PreC_P-B Feature FT:CDS GU815583_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815584_PreC_P-B Feature FT:CDS GU815584_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815585_PreC_P-B Feature FT:CDS GU815585_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815586_PreC_P-B Feature FT:CDS GU815586_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815587_PreC_P-B Feature FT:CDS GU815587_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtatgaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaaattggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815588_PreC_P-B Feature FT:CDS GU815588_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815589_PreC_P-B Feature FT:CDS GU815589_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-8). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctatttgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815590_PreC_P-B Feature FT:CDS GU815590_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815591_PreC_P-B Feature FT:CDS GU815591_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815593_PreC_P-B Feature FT:CDS GU815593_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815594_PreC_P-B Feature FT:CDS GU815594_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815595_PreC_P-B Feature FT:CDS GU815595_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815596_PreC_P-B Feature FT:CDS GU815596_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815597_PreC_P-B Feature FT:CDS GU815597_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815598_PreC_P-B Feature FT:CDS GU815598_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815599_PreC_P-B Feature FT:CDS GU815599_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatacttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815600_PreC_P-B Feature FT:CDS GU815600_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-7). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcctttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815601_PreC_P-B Feature FT:CDS GU815601_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815602_PreC_P-B Feature FT:CDS GU815602_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815603_PreC_P-B Feature FT:CDS GU815603_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815604_PreC_P-B Feature FT:CDS GU815604_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815605_PreC_P-B Feature FT:CDS GU815605_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815606_PreC_P-B Feature FT:CDS GU815606_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815607_PreC_P-B Feature FT:CDS GU815607_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815608_PreC_P-B Feature FT:CDS GU815608_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815609_PreC_P-B Feature FT:CDS GU815609_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattggcccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815610_PreC_P-B Feature FT:CDS GU815610_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaaccccttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815611_PreC_P-B Feature FT:CDS GU815611_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-6). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815612_PreC_P-B Feature FT:CDS GU815612_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcccctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815613_PreC_P-B Feature FT:CDS GU815613_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815614_PreC_P-B Feature FT:CDS GU815614_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815616_PreC_P-B Feature FT:CDS GU815616_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-11). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815617_PreC_P-B Feature FT:CDS GU815617_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815618_PreC_P-B Feature FT:CDS GU815618_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815619_PreC_P-B Feature FT:CDS GU815619_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctatcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815620_PreC_P-B Feature FT:CDS GU815620_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815621_PreC_P-B Feature FT:CDS GU815621_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815622_PreC_P-B Feature FT:CDS GU815622_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815623_PreC_P-B Feature FT:CDS GU815623_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815624_PreC_P-B Feature FT:CDS GU815624_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-7). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815625_PreC_P-B Feature FT:CDS GU815625_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815626_PreC_P-B Feature FT:CDS GU815626_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815627_PreC_P-B Feature FT:CDS GU815627_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggatttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815628_PreC_P-B Feature FT:CDS GU815628_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815629_PreC_P-B Feature FT:CDS GU815629_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815630_PreC_P-B Feature FT:CDS GU815630_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815631_PreC_P-B Feature FT:CDS GU815631_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815632_PreC_P-B Feature FT:CDS GU815632_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815633_PreC_P-B Feature FT:CDS GU815633_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815634_PreC_P-B Feature FT:CDS GU815634_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-10). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815635_PreC_P-B Feature FT:CDS GU815635_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgcgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815636_PreC_P-B Feature FT:CDS GU815636_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815637_PreC_P-B Feature FT:CDS GU815637_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815638_PreC_P-B Feature FT:CDS GU815638_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815639_PreC_P-B Feature FT:CDS GU815639_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcat
catacggcactcaggcaagctattctgtgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815640_PreC_P-B Feature FT:CDS GU815640_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactcccttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815641_PreC_P-B Feature FT:CDS GU815641_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaaggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815642_PreC_P-B Feature FT:CDS GU815642_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815643_PreC_P-B Feature FT:CDS GU815643_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815644_PreC_P-B Feature FT:CDS GU815644_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815645_PreC_P-B Feature FT:CDS GU815645_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815646_PreC_P-B Feature FT:CDS GU815646_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1.D1.5-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggattaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815647_PreC_P-B Feature FT:CDS GU815647_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2.D1.5-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815648_PreC_P-B Feature FT:CDS GU815648_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3.D1.5-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815649_PreC_P-B Feature FT:CDS GU815649_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4.D1.5-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815650_PreC_P-B Feature FT:CDS GU815650_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5.D1.5-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815651_PreC_P-B Feature FT:CDS GU815651_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6.D1.5-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815652_PreC_P-B Feature FT:CDS GU815652_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7.D1.5-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815653_PreC_P-B Feature FT:CDS GU815653_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8.D1.5-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815654_PreC_P-B Feature FT:CDS GU815654_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 9.D1.5-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815656_PreC_P-B Feature FT:CDS GU815656_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11.D1.5-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815657_PreC_P-B Feature FT:CDS GU815657_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12.D1.5-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcccgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815658_PreC_P-B Feature FT:CDS GU815658_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815659_PreC_P-B Feature FT:CDS GU815659_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctggcttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815660_PreC_P-B Feature FT:CDS GU815660_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815661_PreC_P-B Feature FT:CDS GU815661_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815662_PreC_P-B Feature FT:CDS GU815662_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcgatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815663_PreC_P-B Feature FT:CDS GU815663_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815664_PreC_P-B Feature FT:CDS GU815664_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgcgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815665_PreC_P-B Feature FT:CDS GU815665_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815666_PreC_P-B Feature FT:CDS GU815666_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815667_PreC_P-B Feature FT:CDS GU815667_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815668_PreC_P-B Feature FT:CDS GU815668_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggcgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815669_PreC_P-B Feature FT:CDS GU815669_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgagtctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815670_PreC_P-B Feature FT:CDS GU815670_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815672_PreC_P-B Feature FT:CDS GU815672_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815673_PreC_P-B Feature FT:CDS GU815673_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttaggcgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815674_PreC_P-B Feature FT:CDS GU815674_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815675_PreC_P-B Feature FT:CDS GU815675_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815676_PreC_P-B Feature FT:CDS GU815676_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcagcgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815677_PreC_P-B Feature FT:CDS GU815677_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagttattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815678_PreC_P-B Feature FT:CDS GU815678_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggtttaaaaatcagacaactattgtggtttaaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815679_PreC_P-B Feature FT:CDS GU815679_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815680_PreC_P-B Feature FT:CDS GU815680_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagttgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815681_PreC_P-B Feature FT:CDS GU815681_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815683_PreC_P-B Feature FT:CDS GU815683_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815684_PreC_P-B Feature FT:CDS GU815684_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815685_PreC_P-B Feature FT:CDS GU815685_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815686_PreC_P-B Feature FT:CDS GU815686_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815687_PreC_P-B Feature FT:CDS GU815687_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815688_PreC_P-B Feature FT:CDS GU815688_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaaccttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815689_PreC_P-B Feature FT:CDS GU815689_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815691_PreC_P-B Feature FT:CDS GU815691_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815692_PreC_P-B Feature FT:CDS GU815692_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815693_PreC_P-B Feature FT:CDS GU815693_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815694_PreC_P-B Feature FT:CDS GU815694_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-4). Complete genome. [Hepadnaviridae] (length=632 residues).
tttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggc
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctat
tcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacgg
cactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagca
tccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctg
tcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815695_PreC_P-B Feature FT:CDS GU815695_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccgaaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815696_PreC_P-B Feature FT:CDS GU815696_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
cctacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815697_PreC_P-B Feature FT:CDS GU815697_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815698_PreC_P-B Feature FT:CDS GU815698_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815699_PreC_P-B Feature FT:CDS GU815699_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctatgttgggttgaattaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815700_PreC_P-B Feature FT:CDS GU815700_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcgc
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815701_PreC_P-B Feature FT:CDS GU815701_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctatgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815702_PreC_P-B Feature FT:CDS GU815702_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815703_PreC_P-B Feature FT:CDS GU815703_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815704_PreC_P-B Feature FT:CDS GU815704_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815705_PreC_P-B Feature FT:CDS GU815705_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815706_PreC_P-B Feature FT:CDS GU815706_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctatgttgggttgaattaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815707_PreC_P-B Feature FT:CDS GU815707_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaaccccttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctatgttgggttgaattaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815708_PreC_P-B Feature FT:CDS GU815708_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815709_PreC_P-B Feature FT:CDS GU815709_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815710_PreC_P-B Feature FT:CDS GU815710_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctatgttgggttgaattaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815711_PreC_P-B Feature FT:CDS GU815711_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815712_PreC_P-B Feature FT:CDS GU815712_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggagaccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatacccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815713_PreC_P-B Feature FT:CDS GU815713_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815715_PreC_P-B Feature FT:CDS GU815715_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815716_PreC_P-B Feature FT:CDS GU815716_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815717_PreC_P-B Feature FT:CDS GU815717_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815718_PreC_P-B Feature FT:CDS GU815718_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815719_PreC_P-B Feature FT:CDS GU815719_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815720_PreC_P-B Feature FT:CDS GU815720_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815721_PreC_P-B Feature FT:CDS GU815721_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815722_PreC_P-B Feature FT:CDS GU815722_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatgggcattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815723_PreC_P-B Feature FT:CDS GU815723_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815724_PreC_P-B Feature FT:CDS GU815724_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815725_PreC_P-B Feature FT:CDS GU815725_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815726_PreC_P-B Feature FT:CDS GU815726_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815727_PreC_P-B Feature FT:CDS GU815727_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815728_PreC_P-B Feature FT:CDS GU815728_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815729_PreC_P-B Feature FT:CDS GU815729_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815730_PreC_P-B Feature FT:CDS GU815730_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815731_PreC_P-B Feature FT:CDS GU815731_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815732_PreC_P-B Feature FT:CDS GU815732_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815733_PreC_P-B Feature FT:CDS GU815733_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815734_PreC_P-B Feature FT:CDS GU815734_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815735_PreC_P-B Feature FT:CDS GU815735_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815736_PreC_P-B Feature FT:CDS GU815736_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815737_PreC_P-B Feature FT:CDS GU815737_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815738_PreC_P-B Feature FT:CDS GU815738_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815739_PreC_P-B Feature FT:CDS GU815739_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttagtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815740_PreC_P-B Feature FT:CDS GU815740_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815741_PreC_P-B Feature FT:CDS GU815741_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-4). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815742_PreC_P-B Feature FT:CDS GU815742_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815743_PreC_P-B Feature FT:CDS GU815743_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815744_PreC_P-B Feature FT:CDS GU815744_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815745_PreC_P-B Feature FT:CDS GU815745_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815746_PreC_P-B Feature FT:CDS GU815746_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815747_PreC_P-B Feature FT:CDS GU815747_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaataggggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815748_PreC_P-B Feature FT:CDS GU815748_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaataggggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815749_PreC_P-B Feature FT:CDS GU815749_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815750_PreC_P-B Feature FT:CDS GU815750_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815751_PreC_P-B Feature FT:CDS GU815751_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgaggtctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815752_PreC_P-B Feature FT:CDS GU815752_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggcctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815753_PreC_P-B Feature FT:CDS GU815753_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815754_PreC_P-B Feature FT:CDS GU815754_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttgcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815755_PreC_P-B Feature FT:CDS GU815755_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815756_PreC_P-B Feature FT:CDS GU815756_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815757_PreC_P-B Feature FT:CDS GU815757_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815759_PreC_P-B Feature FT:CDS GU815759_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815760_PreC_P-B Feature FT:CDS GU815760_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815761_PreC_P-B Feature FT:CDS GU815761_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcc
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815762_PreC_P-B Feature FT:CDS GU815762_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815764_PreC_P-B Feature FT:CDS GU815764_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcc
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815765_PreC_P-B Feature FT:CDS GU815765_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaaccccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815766_PreC_P-B Feature FT:CDS GU815766_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815767_PreC_P-B Feature FT:CDS GU815767_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-5). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815768_PreC_P-B Feature FT:CDS GU815768_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815769_PreC_P-B Feature FT:CDS GU815769_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815770_PreC_P-B Feature FT:CDS GU815770_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815771_PreC_P-B Feature FT:CDS GU815771_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815772_PreC_P-B Feature FT:CDS GU815772_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815773_PreC_P-B Feature FT:CDS GU815773_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-11). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815774_PreC_P-B Feature FT:CDS GU815774_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815775_PreC_P-B Feature FT:CDS GU815775_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggtaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815776_PreC_P-B Feature FT:CDS GU815776_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-21). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctattgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815777_PreC_P-B Feature FT:CDS GU815777_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcatcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815778_PreC_P-B Feature FT:CDS GU815778_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattaatagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815779_PreC_P-B Feature FT:CDS GU815779_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-4). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815780_PreC_P-B Feature FT:CDS GU815780_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccatcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815781_PreC_P-B Feature FT:CDS GU815781_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815782_PreC_P-B Feature FT:CDS GU815782_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU815783_PreC_P-B Feature FT:CDS GU815783_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-9). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaaccccttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagcaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU827630_PreC_P-B Feature FT:CDS GU827630_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CMC104L). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggacga
cccagcatctagggaattagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgct
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011466_PreC_P-B Feature FT:CDS HM011466_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctatc
cttctattcgagatctcctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgtctctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcg
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|HM011467_PreC_P-B Feature FT:CDS HM011467_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttaggrcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcagctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtyaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaaytactgttgttagaggacgcaggtcccctagaagaag
aactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011469_PreC_P-B Feature FT:CDS HM011469_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatkkttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaayttggaaga
cccarcatccagggaagcagtagtcggctatgttaatgttaatatgggcctaaaactcagacaattattgtggtttcacr
tttcctgtcttacktttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggrayctcaatgttag
>gnl|hbvcds|HM011470_PreC_P-B Feature FT:CDS HM011470_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcacgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcagacaagttattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaagtcagacaactattgtggtttcaca
tttcttgtcttacttttgggagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011471_PreC_P-B Feature FT:CDS HM011471_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccgtataaagaatttggagcgtctattgagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgakttratgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaatcagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgtccttgaatatttggtgtcttttggagtgtggatgcgcactccccctgca
tacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|HM011473_PreC_P-B Feature FT:CDS HM011473_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
aygcractttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctymtgacttctntc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgkgtgttggggtgaggtaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgataatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactrctgttattagacmaagaggcaggwcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttaa
>gnl|hbvcds|HM011474_PreC_P-B Feature FT:CDS HM011474_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
ctgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgayttctttc
cttccgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcaatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtctcacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcctctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagamgatctcartctcgggaatcycaatgttag
>gnl|hbvcds|HM011475_PreC_P-B Feature FT:CDS HM011475_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacatygacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgccwctgctttgtatcgggaggccttagagtctccrgaacattgyacwcctcac
catacggcactcaggcaagctattstrtgytggggtgagttaatgaayctagccacctgggtgggargwaatytggaaga
tcmakcatccagggamkyagtagttrgctatgtcaacgttaatatgggcctaaaamtcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtttggattcgcactcctattgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaamtactgttrttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaayctcaatgttag
>gnl|hbvcds|HM011476_PreC_P-B Feature FT:CDS HM011476_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctattgagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaacctagccacctgggtgggaggtaatttggacga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaacaattgtggtttcata
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagaggaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011477_PreC_P-B Feature FT:CDS HM011477_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
acgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtgragttactctcttttttgccttctgacttctttc
cttctgwtsragatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattatacacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggargtaatttggaaga
tccagsatcccgggaagcagtagtcaactatgtcaacgttaatatgggcataaaaatcagacaactwttgtggtttcaca
tttcctgtcttacttttggaarammkackgttcttgaatatttggtctcttttggagtgtggatkcgcactcctcctgca
tatagrccacaaaatgcccctatcttatcwacrcttccggaaactactgttrttagacaaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgttgcagaagatctcaatctcgggaacctcgatgttar
>gnl|hbvcds|HM011478_PreC_P-B Feature FT:CDS HM011478_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcaygtcctactgttcaagcctccragctgtgccttgggtggct
ttaggacatggacattgacccatataaagaatttggagcttctgyksagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgckctgtatcgggaggccttagagtctccggaacattgctcagctcac
catacggcactcaggcaagctattttgtgttggggtgagttaatgaatctcgccacctgggtgggaagtaatttggaaga
tccatcatccagggaagcagtagtcagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttgggagagatactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctwctgca
tatagaccaccaaatgcccctatcttgtcaacacttccggaaactactgttgttagaggaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011480_PreC_P-B Feature FT:CDS HM011480_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccagaacattgttcagctcac
catacagcactcaggcaagctattctgtgttggggtgagttaacgaatctagccacctgggtgggaggtaatttggaaga
tcaagcatccagggaattagtagtcggttatgtcaacgataatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtttcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011482_PreC_P-B Feature FT:CDS HM011482_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
aygcaactttttcacctctgcctratcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacrydtataaagaatttggagcttctgtggagttactctcttttttgcctmmwgacttctwtc
cywmtgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacagyactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaaga
tcmagsatccagggamkyagtagtcasctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttayktttgggagagaaactgttcttgaatatttggtgtcttttggggtgtggattcgcactcctmctgca
tatagaccascaaatgcccctatcttatcaacacttccggaaactactgttrttagaggaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011483_PreC_P-B Feature FT:CDS HM011483_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgcggagttactctcttttttgcctyttgayttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcac
catacggcactcaggcaagccattctgtgttggggtgagttaatgaatctagccacctgggtgggargtaatttgcaaga
tcmascatccagggamtyagtagtcaactatgtcaacgttaatatgggcmtaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggmrakmaactgttcttgaatwtttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacmaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagakgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgytag
>gnl|hbvcds|HM011484_PreC_P-B Feature FT:CDS HM011484_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttc
cttctgttcgagatctcctcgacaccgccnctgctctgtatcgggaggccttagagtctccggaacattgtacasctcac
cayacrgcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaaga
tccmrcatccagggaagyagtagtcaactatgtcaacgttaacatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttatgtttgggagagamrytgttcttgaatatttggtctcttttggagtgtggatycgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacacttccggaaactrctgttrttagacgaagaagcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttag
>gnl|hbvcds|HM011487_PreC_P-B Feature FT:CDS HM011487_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctgatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagctaccacggagttagtctcttttttgccttctgatttctttc
cttctattcgagatcttcttgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacggctctcaggcaagctrttctctgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacga
tccagcatccagggaattggtagtcggctatgtcaatgttaatatgggcataaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctcca
tataggccaccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgcggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011490_PreC_P-B Feature FT:CDS HM011490_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctgttgagttactctcttttttgccttctgacttctttc
cttctatacgggatcttctcgacaccgcttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catactgcaatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
ccaagcatcccgggaattagtagtcggctatgtcaatgttaatatgggcataaaactcagacaactnttgtggtttcaca
tttcctgtattacttttggaagagawactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctgctcca
tatagaccaccaaatgcccctatcttatcaacacttccggagattactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011492_PreC_P-B Feature FT:CDS HM011492_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaaga
ccaagcctcccgggatttagtagtcggctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011494_PreC_P-B Feature FT:CDS HM011494_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacstataaagaatttggagcttctgtggagttactctcttttttgccttckgacttctttc
cttctrttcgagatctcctcgacaccgccwctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcgctcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctmctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggwcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctmaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011496_PreC_P-B Feature FT:CDS HM011496_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgyaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggrcatggayatygacacstataaagaatttggagcytctgcggagttactctcttttttgccttctgacttctttc
ctaatattcgagatctwctcgacaccgccaatgctctgtatcgrgaggccttrgagtctccggaacactgyacacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
ccaatcatccagggatttagtagtcggctatgtcaatgttaatatgggcctgaaactcagacaactattgtggttycaca
tttcttgccttacttttggaaaagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttag
>gnl|hbvcds|HM011499_PreC_P-B Feature FT:CDS HM011499_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
mtgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrggrcatggacattgacccgtataaagaatttggagcttctgtggagttamtctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatwkttcasctcac
catacggcrctcaggcaagctattctgtgttggggtgagttgrtgaatctagccacctgggtgggaagtaatttggamga
cccagcatccagggaakyagtagtcrgctatgtyaatgkyaatatgggcctaaaaatcaggcawctattgtggtttcaca
tttcctgtcttacttttggaaragamactgttcttgaatatttggtrtcttttggagtgtggattcgcactcctcctsca
tatagaccrccaaatgcccctatcttatcaacacttccggaaaytrctgttgttagacracgaggcaggwcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratccmamtgttag
>gnl|hbvcds|HM011503_PreC_P-B Feature FT:CDS HM011503_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctgctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgtwcacctcac
catacggcactcaggcaagcyattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaagttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgtksttagacgaaggggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamcctcaatgttag
>gnl|hbvcds|HM011504_PreC_P-B Feature FT:CDS HM011504_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatgtttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggaaga
tcctgcatccagggaattagtagtcagttatgtcaacgttaatatgggcctaaaaatcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaaatgcccctatcttatcaacgcttccggaaacttgtgttgttagacaaagaggcaggtccactagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttag
>gnl|hbvcds|HM153811_PreC_P-B Feature FT:CDS HM153811_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 712005001256). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggaattactctcttttttgccttctgacttctttc
cttctattcgagatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattggtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|HQ700546_PreC_P-B Feature FT:CDS HQ700546_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BC_NC_AM263). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcc
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
ctaatattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtsggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatatcaatgttag
>gnl|hbvcds|HQ700548_PreC_P-B Feature FT:CDS HQ700548_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1031A). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactaaggcaagctattctgtgttggggcgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HQ700549_PreC_P-B Feature FT:CDS HQ700549_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1098A). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcata
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtctcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF412801_PreC_P-B Feature FT:CDS JF412801_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVJSTZ3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF436921_PreC_P-B Feature FT:CDS JF436921_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SZ7). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcac
catacggcaatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaactcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaatgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF775480_PreC_P-B Feature FT:CDS JF775480_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF775482_PreC_P-B Feature FT:CDS JF775482_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggcagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF775483_PreC_P-B Feature FT:CDS JF775483_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B6). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgccttctgatttctttc
cgtctattcgagaccttctcgacaccgcatcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagcagttttgtgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaaga
ccctgcctccagggatttggtagtcagctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgca
tacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF775484_PreC_P-B Feature FT:CDS JF775484_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B10). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF899335_PreC_P-B Feature FT:CDS JF899335_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN406371_PreC_P-B Feature FT:CDS JN406371_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WHUB1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacatgggtgggaagtaatttggaaga
tccagcatcccgggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN792893_PreC_P-B Feature FT:CDS JN792893_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2004). Non-functional genomic sequence. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgcggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccactgctttgtatcgagaagccttagagtctcctgaacatgtctcgcctcac
catacagcactcaggcaagccattttgtgctggggggacttaatgactctagctacatgggtgggtaataatttagaaga
tccagcatccagagacctagtagtcaattatgttaacaataccacgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttgggagagacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctcgggaatcctaatgttag
>gnl|hbvcds|JN792894_PreC_P-B Feature FT:CDS JN792894_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MN2009). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgcggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccgctgcgttgtatcgggaagccttagagtctcctgaacattgctcgtatcac
catacagcactcaggcaagccattttgtgctggggggaattaatgactctagcttcatgggtgggtaataatttacaaga
tccagcatccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtttcacg
tttcctgtcttacctttgggagaaacactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagagg
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaa
>gnl|hbvcds|JN792895_PreC_P-B Feature FT:CDS JN792895_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacatcgacccttataaagaatttggcgctactgtggagttactctcttttttgcctactgacttctttc
cgtcggttcgagatctcctagacaccgccgctgctttgtttcgggaagccttagagtcccctgaacattgctcacctcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tcaagcatccagagacctagtagtcaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcacg
tttcctgtattatctttgggagagacattgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN792896_PreC_P-B Feature FT:CDS JN792896_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KM2009). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggcgctactgtggagttactctcttttttgcctactgacttctttc
cgtcggttcgagatctcctagacaccgccgctgctttgtttcgggatgccttagagtcccctgaacattgctcacctcac
catacagcaatcaggcaagccattttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagaaga
tcaagcatccagagacctagtagtcaattatgttaacactcatatgggactaaagatcaggcaattattgtggtttcacg
tttcctgtattatctttgggagagacattgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN792897_PreC_P-B Feature FT:CDS JN792897_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2009). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctctgtatagggatgccttggagtctccggaacattgctcgcctcac
catacagcaatcaggcaagctattttgtgctggggcgaattaatgactctagctacctgggtgggtaataatttagacga
tccagcatccagagacctagtagtcaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtattacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN792898_PreC_P-B Feature FT:CDS JN792898_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IT2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctctttcttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctctgtatagggatgccttggagtctccggaacattgctcggctcac
catacagcaatcaggcaagctattttgtgctggggcgaattaatgactctagctacctgggtgggtaataatttagacga
tccagcatccagagacctagtagtcaattatgttaacactcacatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtattacctttgggagagatactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttag
>gnl|hbvcds|JN792899_PreC_P-B Feature FT:CDS JN792899_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AT2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgcctctgctttgtatcgggaagccttagagtctcctgaacattgttcggctcac
catacagcaatcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtagtaatttaaatga
tccagcttccagagacctagtagtcaattatgttaacattaacatgggactaaagatcaggcaattattgtggtatcaca
tttcctgtattacctttgggagagacactgttctcgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN792900_PreC_P-B Feature FT:CDS JN792900_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AT2009). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttc
cgtcggttcgggatctcctagacaccgccactgctttgtatcgggaagccttagagtctactgaacattgctcgtatcac
catacagcactcaggcaagctattttgtgctggggggaattaatgactctagcttcctgggtgggtaataatttagacga
tccagcttccagagacctagtagtcaattatgttaacactaacatgggactaaagatcaggcaattattgtggtatcacc
tttcctgtcttacctttgggagagacactgttcacgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaag
aagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JN792901_PreC_P-B Feature FT:CDS JN792901_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AD2009). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactacggagttactctctttcttgccttctgacttctatc
cgtcggttcgagatctcctagacaccgccgctgctttgtatcgagatgccttagagtctcctgaacattgctcgcctcac
catacagcactcaggcaagctgctttgtgctggggggaattaatgactctagctacctgggtgggtaataatttaaacga
tccagcatccagagacctagtagtaaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagagg
aagaactccctcgcctcgcagacgacgatctaaatctccgcgtcgcagaagatctcactctcgggaatcccaatgttag
>gnl|hbvcds|JN792902_PreC_P-B Feature FT:CDS JN792902_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AD2004). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctagtcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccttataaagaatttggagctactacggagttactctcttttttgccttctgacttctttc
cgtcggttcgagatctcctagacaccgccgctgctttgtatcgagatgccttagagtctcctgaacattgctcgcctcac
catacagcactcaggcaagctgctttgtgctggggggaattaatgactctagctacctgggtgggtaataatttagacga
tccagcatccagagacctagtagtaaattatgttaacactaatatgggactaaagatcaggcaattattgtggtttcaca
tttcctgtcttacctttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaag
aagaactccctcgcctcgcagacgacgatctaaatctccgcgtcgcagaagatctcactctcgggaatcccaatgttag
>gnl|hbvcds|JN827419_PreC_P-B Feature FT:CDS JN827419_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2539). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagcaattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ027311_PreC_P-B Feature FT:CDS JQ027311_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atacaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctgygmmrttactctcttttttgcctgctgacttctttc
cttctgttcacgaccttctcgacaccgccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcamtcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaggtaatttggamga
cccasmatccagagaattagtagtcggctatgttaatgttaatatgggcctaaaaytcagacaactattgtggtttcaca
tctcctgtcttayktttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacmaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagkcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcycaatgttag
>gnl|hbvcds|JQ027312_PreC_P-B Feature FT:CDS JQ027312_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgayccgtataaagaatttggagcttctgtggagttamtctcttttttgcctactgacttctttc
ctartgttcgagatcttctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgtacacctcac
cacacggcactcaggcaagttattttgtgttggggtgagttaatgaatttagccacctgggtgggaagcaatttggacga
tcmaacatccagggaagcagtagtcaactatgtcaacgttaatatgggcctaaaaaccagacaactrttatggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttrgtgtcttttggagtgtggattcgcactcctccygsa
tatagaccacmaaatgcccctatcttatcaacacttccggaaactgctgttgttagacraagakgcaggtccyctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttag
>gnl|hbvcds|JQ027313_PreC_P-B Feature FT:CDS JQ027313_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggmgcttcakyggagttactctcttttttgcctsmtgayttctttc
cttcgaytcgagatctcmtcgacaccgcctctgctctgtaycgggaggccttagagtctcckgaacattgttcacatcac
catacggcrctcaggcaagctattctgtgttgggtkgagttaatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaattagtagtcaaccatgtcaacrttaatatgggcmtaaaaatcagacaactaytgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgamtwtttggtgtcttttggagtgtggattcgcactcctcckgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ027315_PreC_P-B Feature FT:CDS JQ027315_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacctgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctactcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggctctcaggcaagctattgtgtgttggggtgagttgatgaatttagccacctgggtgggaggtaatttggaaga
tcaagcatccagggaattagtagtcggctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccascaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JQ027316_PreC_P-B Feature FT:CDS JQ027316_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcctctgcggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcaca
tttcctgtcttacttttggaagagaagttgttcttgaatatttggtctctttcggagtgtggattcgcactcctactgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ027325_PreC_P-B Feature FT:CDS JQ027325_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgyggagttactctcttttttgccttctgacttttttc
cttccattcgagatctcctcgacaccgccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaaga
tcaagcatccagggacttagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggaargaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JQ027329_PreC_P-B Feature FT:CDS JQ027329_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
aggcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacggtaatatgggcctraaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaycaaatgcccctatcttatcaacacttccggaaactrctgttgttagacgaagaagcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcttgatgttag
>gnl|hbvcds|JQ027330_PreC_P-B Feature FT:CDS JQ027330_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttagggcatggacattgaccastataaagaatttggagcttctgtggagttactctcatttttgccgtctgacttctttc
cttctrttcgagatctcctcgayaccgcctctgctctgtatcgggaggctttagagtctccggaacatgtttcacctcac
catacrgcmctcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccggcatccagggaattagtagtcrgctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtattacttttggragagaaaytgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctcaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JQ027331_PreC_P-B Feature FT:CDS JQ027331_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcwtgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttagggcatggacattgaccastataaagaatttggagcttctgtggagttactctcatttttgccgtctgacttctttc
cttctrttcgagatctcctcgayaccgcctctgctctgtatcgggaggctttagagtctccggaacatgtttcacctcac
catacrgcmctcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccggcatccagggaattagtagtcrgctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtattacttttggragagaaaytgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctcaaaatgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JQ027334_PreC_P-B Feature FT:CDS JQ027334_PreC_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagaccttctcgacaccgcctcagctctgtaccgggaagccttagagtctccggaacattgtacacctcac
catacagcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatctggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcagcca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaa
>gnl|hbvcds|JQ040125_PreC_P-B Feature FT:CDS JQ040125_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040128_PreC_P-B Feature FT:CDS JQ040128_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 69). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataragaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgcgctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgttag
>gnl|hbvcds|JQ040138_PreC_P-B Feature FT:CDS JQ040138_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 240). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacctgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgctwctgctctgtatcgggaggccttagagtctccggaacattgttcacctcat
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tctagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggragagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040147_PreC_P-B Feature FT:CDS JQ040147_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 280). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040157_PreC_P-B Feature FT:CDS JQ040157_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G187). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgayttctttc
cttctattcgagatctcctcgacaccgmcwctgctctgtatcgggaggccttagagwctccggaacattgttcacctcac
catacrgcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040169_PreC_P-B Feature FT:CDS JQ040169_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G237). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctgctcgacaccgcctctgcgttgcatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040170_PreC_P-B Feature FT:CDS JQ040170_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G238). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040171_PreC_P-B Feature FT:CDS JQ040171_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G239). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaaatttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctckcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ040173_PreC_P-B Feature FT:CDS JQ040173_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G244). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaaatttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ341459_PreC_P-B Feature FT:CDS JQ341459_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno01). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctccttgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341460_PreC_P-B Feature FT:CDS JQ341460_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno02). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341461_PreC_P-B Feature FT:CDS JQ341461_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno03). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctatcctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341462_PreC_P-B Feature FT:CDS JQ341462_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno04). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttgragcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatacgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341463_PreC_P-B Feature FT:CDS JQ341463_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno05). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttccgacttctttc
cttctrttcragatctcctcgacaccgcctctgcgctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggktgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgkggattcgcactcctcctgca
tatagaccacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagakgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341464_PreC_P-B Feature FT:CDS JQ341464_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno06). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagcaacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaakctcgggaatctcaatgt
>gnl|hbvcds|JQ341465_PreC_P-B Feature FT:CDS JQ341465_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno07). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341466_PreC_P-B Feature FT:CDS JQ341466_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno08). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccgagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctatgtatcgggaggccttagagtctccggaacattgttcakctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgtgaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactrctgttgttagacaaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgt
>gnl|hbvcds|JQ341467_PreC_P-B Feature FT:CDS JQ341467_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno10). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccatataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcaattcgagatctcctcgacaccgcatctgctctgyatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattstgtgttggggtgagktaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcwgaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341468_PreC_P-B Feature FT:CDS JQ341468_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno11). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccygtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cktctrttcgagatctmctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattstgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccatcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaamtcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaacggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccagcaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341469_PreC_P-B Feature FT:CDS JQ341469_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno12). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacccgtataaagaatttggagcttctattgagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgca
tatagaccaccaanngcccctatcttatcaacacttccggagactactgttgttagaggaagaagcagggcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341470_PreC_P-B Feature FT:CDS JQ341470_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno15). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctrttctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341471_PreC_P-B Feature FT:CDS JQ341471_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno16). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagayctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggtctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgtacttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccgccaanngcccctatcttatcaacrcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341472_PreC_P-B Feature FT:CDS JQ341472_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno17). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaycaanngcccctatcttatcaacacttccggaaactrctgttgttagacgamgnkgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgt
>gnl|hbvcds|JQ341473_PreC_P-B Feature FT:CDS JQ341473_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno18). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacmcgtataaagaattyggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattstgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagttagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341474_PreC_P-B Feature FT:CDS JQ341474_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno19). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacacgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctgctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggctctcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggycccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgt
>gnl|hbvcds|JQ341475_PreC_P-B Feature FT:CDS JQ341475_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno20). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcgattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcaggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattartagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctaaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341476_PreC_P-B Feature FT:CDS JQ341476_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno21). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcaatcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacg
tttcctgtcttacttttgggagacaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tacagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341477_PreC_P-B Feature FT:CDS JQ341477_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno22). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgaattaatgaatttagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341479_PreC_P-B Feature FT:CDS JQ341479_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno24). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgccttacttttgggagagacactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcagtctcgggaacctcaatgt
>gnl|hbvcds|JQ341480_PreC_P-B Feature FT:CDS JQ341480_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno25). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactkttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttccattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccsgaacattgttcacctcac
catacggcactcaggcaagctattctatgttggggtgagttaatgaatctagccacctgggtgggaggtaatttggaaga
tccagcatccagggaagcagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgt
>gnl|hbvcds|JQ341481_PreC_P-B Feature FT:CDS JQ341481_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno26). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaattcggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgttaacgttaatatgggcctaaaaatcagacaactattgtggtttcata
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341482_PreC_P-B Feature FT:CDS JQ341482_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno27). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttaragtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcctccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341483_PreC_P-B Feature FT:CDS JQ341483_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno29). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgamgnggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341484_PreC_P-B Feature FT:CDS JQ341484_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno30). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttagaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttctcgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341485_PreC_P-B Feature FT:CDS JQ341485_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno31). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccgtctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgtgcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagacctccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341486_PreC_P-B Feature FT:CDS JQ341486_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno32). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgactccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341487_PreC_P-B Feature FT:CDS JQ341487_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno33). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcatctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcrgctatgtcaaygttaatatgggcctaaaamtcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttsttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggactcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341488_PreC_P-B Feature FT:CDS JQ341488_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno34). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctcyaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctrttcgagatctcctcgacaccgcctctgctctgtatagggaggccttagagtctccggaacattgttcacctcac
catacggcamtcaggcaagctattctgtgttgggktgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgtyaatatgggcctaaaaatcagacaacttttgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctyca
tatagaccacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341489_PreC_P-B Feature FT:CDS JQ341489_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno35). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgkggattcgcactcctcctgca
tatagaccacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341490_PreC_P-B Feature FT:CDS JQ341490_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno36). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgt
>gnl|hbvcds|JQ341491_PreC_P-B Feature FT:CDS JQ341491_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno38). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccgtataaagaatttggagcttctgyggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggragagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaygcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341492_PreC_P-B Feature FT:CDS JQ341492_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno39). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttaatctcttttttgcctgctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctcctgaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctrgccacctgggtgggaagtaatttggacga
tccagsatccagggaattagtagtcagctatgtcaacgttaatatgggcataaaaatcagacaaatactgtggtttcaca
tttcctgycttacttttgggagagacgttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcc
tatagaccacaaanngcccctatcytatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagawctcaatctcgggaacatcaatgt
>gnl|hbvcds|JQ341493_PreC_P-B Feature FT:CDS JQ341493_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno41). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacgcstataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagaccttctcgacaccgcctctgctctgtaccgggaggccttagagtctccggaacatgtttcacctcac
catacggcamtcaggcaagctattctgtgttggggtgagttgatgaatctagccwcctgggtgggargtaatttggaaga
cccagcatccagggaattagtagtcggttatgtcaaygttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaanngcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggtcccytagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcggggatctcaatgt
>gnl|hbvcds|JQ341494_PreC_P-B Feature FT:CDS JQ341494_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno43). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacmcgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgataccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcac
catacggcactcaggcaagctattstgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcgtttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgw
>gnl|hbvcds|JQ341495_PreC_P-B Feature FT:CDS JQ341495_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno44). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgyggagttactctcttttttgccttctgacttctttc
ctactattcgagatctcctcgacaccgcctctgctctrtatcgggaggccttagagtctccggaacattgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaacytagccacctgggtgggargtaatttggacga
tccagcatccagggaakyagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactgttgtggtttcaca
tttcctgtcttayktttgggagacaaacygttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttrttagacaacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcgggaacatcaatgt
>gnl|hbvcds|JQ341496_PreC_P-B Feature FT:CDS JQ341496_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno45). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341497_PreC_P-B Feature FT:CDS JQ341497_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno46). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttttttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggacga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcaca
tttcctgtcttacttttgggagasaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacmaanngcccctatcttatcaacacttccggaaactactgttgttagasraagaggcaggwcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcartctcgggaatctcaatgt
>gnl|hbvcds|JQ341498_PreC_P-B Feature FT:CDS JQ341498_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno47). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
ctwmtsttcgagatctcctcgacactgcctctgctctgtatcgggaggccttagagtctccggaacattgttcasctcac
catacrgcaatcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagawaytgttcttgamtatttrgtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacmaanngcccctatcttatcaacacttccggaaactrctgttgttagaccaagaggcaggtccwctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341499_PreC_P-B Feature FT:CDS JQ341499_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno48). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctrcggagttactctcttttttgccttctgacttctatc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacatkgtacacctcac
catacggcactcaggcaagctattctgtgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaaga
cccargatccagggaakyagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagacattgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccacaaanngcccctatcttatcaacacttccggaaactactgttattagacaacgaggcaggacccctagaag
aagaactccctcacctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341501_PreC_P-B Feature FT:CDS JQ341501_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno50). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcctactgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341502_PreC_P-B Feature FT:CDS JQ341502_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno51). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggrtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatyagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgakgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgt
>gnl|hbvcds|JQ341503_PreC_P-B Feature FT:CDS JQ341503_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno52). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctacttttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggaggttctgtggagttactctcttttttgccttctgacttctttc
ctactattcgagatctcctcgacaccgcctctgctctatatcgggaggccttagagtctccggaacattgttcacctcac
catacggcaatcaggcaagctattctgtgttggggcgagttaatgaatctagccacctgggtgggaggtaatttggacga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgactatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaatgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgt
>gnl|hbvcds|JQ341504_PreC_P-B Feature FT:CDS JQ341504_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno53). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttrgggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctgctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggktgagttgatgaatctagccacctgggtgggargtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgkggattcgcactcctcctgca
tatagaccacmaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341508_PreC_P-B Feature FT:CDS JQ341508_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno58). Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgttgagttactctctttyttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctgttctgtgttggggtgagttgatgaatctagccacctgggtgggaggwaatttggaaga
tccagcatccagggaattagtagtcggctatgtcaacgttaatatgggcctraaactcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactccttctgca
tatagaccaccaanngcccctatcytatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggamyctcaatgt
>gnl|hbvcds|JQ341510_PreC_P-B Feature FT:CDS JQ341510_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Bgeno61). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcctgca
tatagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341515_PreC_P-B Feature FT:CDS JQ341515_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cgeno12). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttcwattcgtgatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactaaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaasa
cccagcatccagggaattartagtaagctatgtcaatgttaatatgggcctaaaamtcagacaamtattgtggtttcaca
tttcctgtcttacttttggaaragawactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgct
tacagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagaygacgaggcaggacccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ341530_PreC_P-B Feature FT:CDS JQ341530_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Cgeno39). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=636 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cgtctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacagcactcaggcaagctattctgtgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgct
tacagaccaccaanngcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|JQ429079_PreC_P-B Feature FT:CDS JQ429079_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 08.10.002). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctgttcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattagtagtcagcyatgtcaatgttaatatgggcctaaaawtcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcytatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ429080_PreC_P-B Feature FT:CDS JQ429080_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.40.033). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcctkctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaaga
tccagcttcccgagaattagtagttggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcyyaatgttag
>gnl|hbvcds|JQ429081_PreC_P-B Feature FT:CDS JQ429081_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.80.055). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttgggacatggacattgacccgtataaagaatttggagcttctggagagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctctatcgggaggccttagagtctccggaacattgctcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcctcccgggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ429082_PreC_P-B Feature FT:CDS JQ429082_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 09.41.591). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttaggacatggacattgacacctataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattgtgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatcccgggaattggtagtcagttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcacacctcctgcc
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ688405_PreC_P-B Feature FT:CDS JQ688405_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVB2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
tccagcatccagggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707734_PreC_P-B Feature FT:CDS JQ707734_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_1). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707735_PreC_P-B Feature FT:CDS JQ707735_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_10). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707736_PreC_P-B Feature FT:CDS JQ707736_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_11). Partial genome (Contains: HBx). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707737_PreC_P-B Feature FT:CDS JQ707737_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_12). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707738_PreC_P-B Feature FT:CDS JQ707738_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_14). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707739_PreC_P-B Feature FT:CDS JQ707739_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_17). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707740_PreC_P-B Feature FT:CDS JQ707740_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_18). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707741_PreC_P-B Feature FT:CDS JQ707741_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_19). Partial genome (Contains: HBx). [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacagcgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagagg
aagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JQ707742_PreC_P-B Feature FT:CDS JQ707742_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_2). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707743_PreC_P-B Feature FT:CDS JQ707743_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_20-3). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707744_PreC_P-B Feature FT:CDS JQ707744_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_22). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccacgctgtgccttgggtggct
ttggggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707745_PreC_P-B Feature FT:CDS JQ707745_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_23). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttgggtggct
ttagggcatggacattgaccactataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttc
cttctattcgagatcttctcgacaccgccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcac
catacggcactcaggcaagctattctgtgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaaga
cccagcatccagggaattagtagtcggctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcaca
tttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgca
tatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaag
aagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707746_PreC_P-B Feature FT:CDS JQ707746_PreC_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S35_24-6). Complete genome. [Hepadnaviridae] (length=639 residues).
atgcaactttttcacctctgcctaatcatctcctgttcatgtcccactgttcaagcctccaagctgtgccttggg