Dataset for nucleotide sequence S of genotype A

[Download (right click)] [Edit] [Sequences] [Repertoires]

3610 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

KX372097_S_P-A      atggagaacatcacatcaggattccyaggacmcctgcycgtgttacaggcggggttttcc
KX372086_S_P-A      agggrgaacatcacatcaggattcctaggacccctgctcgggttaccggcggggttttcc
KU847556_S_P-A      atggagaacatcacatcagrattcctargacccctgctcgtgttacaggcggggtttttc
JN604218_S_P-A      atggagaacatcacatcaggattccyaggacccctgckcgtgttacaggcggggtttttc
KF922431_S_P-A      atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttc
EU185786_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
EU185789_S_P-A      atggagaacatyayatcaggactcctaggacccctgctygtgttacaggcggggtttttc
EU185787_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
EU185788_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
DQ995827_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144207_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
AB937797_S_P-A      atggagaacatcacatcagggttcctaggaccccggctcgtgttacaggcggggttttyc
JN604176_S_P-A      atggagaacatcacatcaggattcctaggacccccgctcgtgttacaggcggggtttttc
JN604249_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486770_S_P-A      atggagaacatcacatcaggactcctagsacccctgctcgtgttacaggcggggtttttc
GQ486817_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
DQ412504_S_P-A      atggagaacatcayatcaggaytcctaggacccctactcgtgttacaggcggggtttttc
KX372074_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372069_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
DQ995822_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttta
GQ486677_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
DQ412446_S_P-A      atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486139_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486309_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325766_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372101_S_P-A      atggagaacatcacatcaggattcctaggacccctgcacgtgttacaggaggggtttttc
KF862525_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771960_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604314_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372054_S_P-A      acggagaacatcacatcagggttcctaggacccctgcwcgtgttacaggcggggtttttc
AJ344115_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttc
AY230117_S_P-A      atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttc
DQ298162_S_P-A      atggagaacatcacatcagggctcctaggacccctgctcgtgttacaggcggggtttttc
DQ298165_S_P-A      atggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttc
DQ298163_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ298164_S_P-A      atggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttc
AY232836_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY232838_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY232839_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY232840_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY230118_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ298161_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372048_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgcgttacaggcggggtttttc
GQ486192_S_P-A      atggagaacatcacatcrggattcctaggacccctgctcgtgttacaggcggggtttttc
AY232837_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372096_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372090_S_P-A      atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
KP997696_S_P-A      atggagaacatcacatctggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412537_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
MK840531_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372071_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771957_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KP165753_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgtyacaggcggggtttttc
JN604285_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggtcactggcggggttttyc
KU847663_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412551_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MW234356_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849305_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372049_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372081_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486853_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477474_S_P-A      acggagaacatcacatcaggattcctaggacccctgcacgtgttacaggcggggttttcc
JN604195_S_P-A      atggagaacatcacatcaggattcctaagacccctgcccgtgttacaggcggggtttttc
KX372056_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849318_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF771943_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486369_S_P-A      atggagaacatcacatcarrattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486182_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
GQ486205_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF208875_S_P-A      atggagaacatcatatcaggattcctaagacccctgctcgggttacaggcggggtttttc
KF862524_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY660207_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630625_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX925296_S_P-A      atggagaacatcacatcaggattcctaggacacctgctcgtgttacaggcggggtttttc
KX372089_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttc
KT749822_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127850_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG383612_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggthtttc
KF771956_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604302_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477473_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
GQ325777_S_P-A      ayggagaacatcacatcaggattcctaggacccctgcycgtgttacaggcggggtttttc
AF208866_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgcgttacaggcggggtttttc
AJ627227_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165655_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
KP165796_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412495_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttc
DQ412519_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttc
KX372073_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372066_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606857_S_P-A      atggagaacatcacatcaggattcctaagacccctgcccgtgttacaggcggggtttttc
KM606781_S_P-A      atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggttttcc
GQ486391_S_P-A      atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttc
GQ477476_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ904411_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372084_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486120_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439877_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439878_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439872_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439870_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439881_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439880_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439873_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439875_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439869_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439876_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439871_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439874_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439879_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439882_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439883_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372085_S_P-A      atggagagcatcacatcaggattcctaggacccctgctcgtrttacaggcggggtttttc
KP165656_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
KX372100_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486225_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
GQ477502_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
GQ486560_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggyggggttttyc
JN226069_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849598_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486782_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttc
GQ486441_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgkgttacaggcggggtttttc
GQ486165_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295518_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412497_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233286_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttc
MG839209_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttc
KX372088_S_P-A      atggagaacatyacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372065_S_P-A      atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttc
KP165645_S_P-A      atggagaacatcacatcaggattcctargacccctgctcgtgttacaggcggggtttttc
GQ486232_S_P-A      atggagaacatcacmtcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477493_S_P-A      atggaaaacatcacatcaggattcctagaacccccgctcgtgttacaggcggggtttttc
AF537372_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738142_S_P-A      atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AY738140_S_P-A      atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AY738141_S_P-A      atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
JN604305_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF208873_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC836781_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486368_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849306_S_P-A      atggagaacatcacatcaggattcctaggacccctsctcgtgttacaggcggggttttty
GQ486694_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
GQ477477_S_P-A      agggagaacatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttc
JX849298_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862517_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372093_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372102_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KM606827_S_P-A      atggagaacatcacatcaggactcctgggacccctgctcgtgttacaggcggggtttttc
GQ486209_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165813_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165795_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165770_S_P-A      atggagaacatcacatcmggattcctaggacccctgctcgtrttacaggcggggtttttc
KP165651_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606901_S_P-A      atggagaacatcacatcaggattcctaagacccctgcccgtgttacaggcggggtttttc
JF439842_S_P-A      atggagaacatcacatcaggattcctagggcccctgctcgtgttacaggcggggtttttc
GQ486840_S_P-A      atggagaacatmacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486253_S_P-A      atggagaacatcacatcrggaytcctaggacccctgctcgtgttacaggcggggtttttc
GQ325775_S_P-A      atggagaacatcacatcaggattcctaggacccctgcycgtgttacaggcggggtttttc
GQ477500_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
KY660208_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
KP144202_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
KM606950_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477463_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HE576988_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
HE576989_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439919_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF065114_S_P-A      atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttc
KF475984_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
GQ477490_S_P-A      atggagaacatcacatccggagtcctaggacccctgctcgtgttacaggcggggtttttc
GQ486416_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
MN818844_S_P-A      atggagaacatcacatcaggactcctaagacccctgctcgtgttacaggcggggtttttc
KF476012_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475994_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475982_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AY738816_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KX520693_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KX520683_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AY738817_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KM606779_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476007_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476006_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476002_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475995_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475992_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AF537371_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476013_S_P-A      gtggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
FN295503_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KX520682_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KX520681_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
JX310723_S_P-A      atggagaacatcacatcagcactcctaggacccctgctcgtgttacaggcggggtttttc
KX372043_S_P-A      atggagaacatcacatcagcactcctaggacccctgctcgtgttacaggcggggtttttc
KP165732_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476014_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476008_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476005_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476003_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476001_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475999_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475998_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475997_S_P-A      atggagaacgtcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475996_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475993_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475991_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475989_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475988_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475986_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttcttc
JN604240_S_P-A      atggagaacatcacatccggactcctaggacccctgctcgtgttacaggcggggtttttc
JN604194_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475985_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475987_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF475990_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476000_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476004_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476009_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476010_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF476011_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KM606891_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KX520707_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KM606797_S_P-A      atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486389_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809923_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809925_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AB809485_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486415_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttc
KP144203_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144204_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439936_S_P-A      atggagaacatcacatcaggattcctaggacctctgctcgtgttacaggcggggtttttc
JF439930_S_P-A      atggagaacatcacatcgggattcctaggacccccgctcgtgttacaggcggggtttttc
JF439932_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439929_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439928_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439934_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439940_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439942_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439933_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439939_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439938_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439937_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439941_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439923_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439921_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439912_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439914_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439915_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439927_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439925_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439920_S_P-A      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439917_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439916_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439926_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439911_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439913_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439918_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439922_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439924_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165790_S_P-A      atggaaaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
GQ486813_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AJ309369_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AJ309370_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AJ309371_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN818843_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772345_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372104_S_P-A      atggagaacatcacatcaggattcctagraccccygctcgtgttacaggcggggtttttc
KX372095_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372083_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165733_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606934_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
KF779298_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849297_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604290_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604255_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604227_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439931_S_P-A      atggagaacatcacatcaggagtcctaggacccctgctcgtgttacaggcggggtttttc
GQ486857_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
GQ486563_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486306_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486104_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477504_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU414104_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412538_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738815_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738139_S_P-A      atggagaacatcacattaggattcctaggacccctgctcgtgttacaggcggtgtttttc
AY738143_S_P-A      atggagaacatcacattaggattcctaggacccctgctcgtgttacaggcggtgtttttc
AY653778_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
AY653775_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF536524_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
KX827297_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
JF439819_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439827_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439823_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809479_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KP165735_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606860_S_P-A      atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606854_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606787_S_P-A      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604298_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
JF439935_S_P-A      atggagaacatcacatcaggagtcctaggacccctgctcgtgttacaggcggggtttttc
DQ412536_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606925_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849315_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
GQ477495_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AF134143_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477470_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758683_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372092_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX827293_S_P-A      atggagaacaccccatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KP165778_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144208_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144206_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
KM606803_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477494_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF297622_S_P-A      atagagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165779_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486831_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477469_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412529_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606710_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606844_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809481_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849312_S_P-A      atggagaacvtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862515_S_P-A      atggagaacvtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG383607_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY382410_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KX372103_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KT630643_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165758_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165700_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165687_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165685_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606872_S_P-A      atggagaacatcacatcaggactcctaagacccctgctcgtgttacaggcggggtttttc
KM606856_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849311_S_P-A      atggagaacatcayatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707537_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604236_S_P-A      atggagaacatcacatcrggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439821_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563551_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
GQ486807_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486741_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486556_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486211_S_P-A      atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggttttcc
GQ486077_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477480_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325792_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690528_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412520_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653780_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653779_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY034878_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF209399_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF209397_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF065116_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB222707_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606957_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606964_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165817_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
KP165819_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
KM606793_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606794_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX125368_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604179_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477501_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325776_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF083634_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF134138_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF065113_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM282986_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY707087_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
M54898_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF065115_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165741_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606954_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477475_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KP997443_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK840529_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372050_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165818_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439832_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439826_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439824_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439820_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439830_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439822_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439825_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439829_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439831_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439828_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653781_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604181_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165697_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165705_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165719_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486669_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486725_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486754_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165638_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165836_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144210_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165837_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849300_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477468_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ709471_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
KM606894_S_P-A      agggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144201_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144205_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165694_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165729_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486531_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165646_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN226093_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849595_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862516_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
Z72478_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttta
KX372053_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165808_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
KP165766_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165755_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165684_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144209_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606913_S_P-A      atggagaacatcacatcaggattcctaggacccctgcncgtgttacaggcggggtttttc
KM606809_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606784_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843184_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771963_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771946_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF771920_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707628_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707536_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604269_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604172_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439981_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
GQ486856_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggcttttc
GQ486776_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486567_S_P-A      atggagaacatcacatcaggaytcctargacccctgctcgtgttacaggcggggtttttc
GQ486529_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486456_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486427_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486101_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477497_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477478_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477465_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
GQ477462_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859950_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594386_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690529_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF208113_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412496_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653786_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653784_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AJ627226_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF209403_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF134148_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF134147_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF134144_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF134134_S_P-A      atggagaacatcacatcaggattcctaggacccctgcttgtgttacaggcggggtttttc
AF083639_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF083637_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF061526_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116076_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236104_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggctgggtttttc
MN507849_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630640_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606947_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN107758_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF065111_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862513_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486710_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF209404_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849294_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779333_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87730_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU900750_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165763_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165756_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165641_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ586809_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771969_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC836779_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859945_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690534_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690533_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690531_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ131121_S_P-A      atggagaacatcacatcaggattcctagtacccctgctcgtgttacaggcggggtttttc
AF369544_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690530_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC836778_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779262_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630626_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738821_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779232_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862512_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606952_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707572_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749825_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749826_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749842_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779315_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653794_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594384_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779365_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165744_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165661_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165768_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165712_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165749_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606831_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF369532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236105_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165752_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707559_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707553_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707558_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606890_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB289727_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB289737_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486751_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604288_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707556_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606828_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606830_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606885_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606936_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606939_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606948_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606956_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606962_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606963_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606965_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606966_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606970_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606972_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165652_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165662_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165728_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165811_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606949_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606945_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779272_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ459086_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412522_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB205118_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486721_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF083638_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF132442_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707545_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707531_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707561_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707540_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707533_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707542_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707535_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707539_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707538_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697506_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707543_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707569_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707554_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707571_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486062_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997676_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606938_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477499_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ184323_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165835_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165633_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606873_S_P-A      atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779257_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779317_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779286_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779290_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779291_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779294_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779287_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779320_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779321_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604197_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809492_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606881_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372041_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165757_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606774_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412513_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412515_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779279_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
Z35717_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF143302_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ788728_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779210_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779211_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862514_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809538_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809533_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
X70185_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY886219_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372099_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749833_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997677_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP995108_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165824_S_P-A      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165750_S_P-A      atggagaacatcacatcmggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165742_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165672_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165667_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165620_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606921_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606903_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606889_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606888_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggagtttttc
KM606820_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606783_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606775_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843172_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779370_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779311_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779295_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779284_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779268_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779263_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779252_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771965_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771958_S_P-A      atggagaacatcacatcagaattcctaggacccctgctcgtgttacaggcggggtttttc
KF771940_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849319_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ911742_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707550_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707547_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ687533_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
JN604266_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604159_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486646_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486642_S_P-A      atggagaacatcacatcaggattccyaggacccctgctcgtgttacaggcggggtttttc
GQ486611_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486598_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486583_S_P-A      atggagaacrtcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
GQ486544_S_P-A      atggagaacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486510_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
GQ486425_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486424_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486421_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486119_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486063_S_P-A      atggagaacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477498_S_P-A      atggagaacatcacatcaggattcctaggaccccagctcgtgttacaggcggggtttttc
GQ477491_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477488_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477484_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477472_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ184324_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ709472_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
EU859939_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
EU859938_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859900_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU747320_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412527_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttc
DQ412508_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412502_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ131125_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF143298_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
AF061525_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697511_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB549213_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB480040_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB453983_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB289694_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB289693_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116077_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG839208_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604183_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB453984_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486197_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997726_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779280_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779274_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttc
KF779271_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779281_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779253_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY862867_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY862868_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486631_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604173_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779256_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606802_S_P-A      aaagagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF129506_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113382_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113384_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113385_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113398_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113401_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113402_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113403_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113404_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113405_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113406_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113407_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113408_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113409_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
V00866_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707549_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606871_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606896_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG383617_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594385_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779249_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779270_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779273_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779275_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779282_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779305_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779306_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779307_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779308_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779309_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779371_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779372_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779381_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779383_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606773_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779283_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779276_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486474_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779239_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779269_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779344_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779345_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779348_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779349_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779356_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779374_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439753_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439762_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749832_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412535_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412505_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412533_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606876_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF132443_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF209395_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB362931_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809537_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862509_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809897_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
KP165660_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606969_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606791_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779324_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
KF779322_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604242_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486549_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477482_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718102_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477466_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ222207_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859947_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859944_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594387_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ788725_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653787_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653785_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AJ627228_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB014370_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606792_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB480036_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707615_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707627_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707633_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707636_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779221_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779316_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843188_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606879_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809884_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809891_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758681_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606940_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707564_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653791_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaagcagggtttttc
JQ707634_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaagcggggtttttc
KU847746_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606899_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779231_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX310730_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372060_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372063_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707552_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707548_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412548_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653793_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB064314_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412528_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563553_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563557_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707544_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885580_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606870_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606875_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606942_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165639_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165683_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165722_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426096_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236107_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236108_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738818_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606811_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738819_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809471_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477487_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604268_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486514_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486360_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809482_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU414103_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU414133_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127847_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849308_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997697_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779336_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB126580_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295533_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606874_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165780_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165806_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707562_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM467774_S_P-A      atggagaacatcacatcaggattccgaggacccctgctcgtgttacaggcggggtttttc
GQ486603_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486747_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697488_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697489_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697501_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697512_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809541_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412556_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU086721_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU159676_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849296_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779240_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862510_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862511_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606713_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606893_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606920_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165630_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372039_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC311241_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC311242_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH932713_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165640_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165727_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165815_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165670_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486426_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486616_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486408_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165720_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412516_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412517_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY697846_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862505_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486683_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809487_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgtaacaggcggggtttttc
DQ412557_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885883_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843182_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843186_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843218_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY697845_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB289692_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809490_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87732_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426097_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY660215_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX827298_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KX372091_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372079_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372077_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
KX372068_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372064_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372044_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847715_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997666_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718100_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165823_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctc
KP165822_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165821_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165814_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165809_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgkgttacaggcggggtttttc
KP165800_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165791_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165786_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165774_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165698_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165690_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165680_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165711_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165666_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165623_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP144200_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983577_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606910_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606849_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606847_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606826_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749831_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606804_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
KM606789_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606770_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606704_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843216_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779379_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779329_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779323_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779319_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779266_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779259_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779386_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779254_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771922_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476015_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF475983_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
JX849299_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX310722_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372047_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX125367_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX096952_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707635_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707616_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707614_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707573_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707563_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707557_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707551_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707560_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707570_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707541_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707321_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604293_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372035_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604270_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604214_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604185_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486712_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486599_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486597_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486587_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486564_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486479_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165632_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165708_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165759_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165762_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486478_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486445_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486417_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849321_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486410_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477486_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ709470_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165664_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859953_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859921_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859907_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594391_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594383_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U91824_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412545_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412547_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412523_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412514_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653798_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653796_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477479_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY128092_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
J02205_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606843_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
X02763_S_C-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF209400_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF090839_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF090840_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC875260_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF083636_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB937798_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697492_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697487_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB480041_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcatgttacaggcggggtttttc
AB453982_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB300367_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB289706_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606906_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606907_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606908_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809895_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779213_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779215_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116078_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116079_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116080_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116081_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB222742_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB246337_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB246338_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB289704_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB289711_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB300366_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB453979_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB453980_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB453981_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB480038_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB480039_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697491_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697495_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697496_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697497_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697498_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697499_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697503_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697504_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697505_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697507_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697508_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697509_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB775198_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB775199_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB775200_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB775201_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809476_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809478_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809480_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809483_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809489_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809491_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809493_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809542_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809543_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB937792_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB937793_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB937794_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF043580_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF297624_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF363663_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AJ012207_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM295795_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM295796_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM295797_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653799_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653800_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653801_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653803_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738822_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236103_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ236110_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412466_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412482_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412494_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412498_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412499_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412500_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412503_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412506_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412507_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412509_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412510_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412512_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412518_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412521_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412524_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412525_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412526_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412530_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412539_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412544_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412546_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412549_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412553_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412554_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412555_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU414102_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU414132_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594388_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594389_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594390_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594392_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594393_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594394_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU594395_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859898_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859899_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859901_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859902_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859903_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859904_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859905_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859906_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859908_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859909_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859910_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859911_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859912_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859913_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859914_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859915_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859916_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859917_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859918_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859919_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859920_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859922_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859923_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859924_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859925_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859926_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859927_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859928_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859929_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859930_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859931_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859932_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859933_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859935_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859936_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859937_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859940_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859941_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859942_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859943_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859946_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859948_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859949_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ349222_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ349224_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295530_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295531_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ414522_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477461_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477467_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477503_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486312_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486409_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486438_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486439_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486461_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486469_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486482_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486490_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486550_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486568_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486580_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486601_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486615_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486663_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486727_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563546_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563554_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563555_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563558_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563562_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439752_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439754_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439755_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439756_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439757_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439758_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439759_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439760_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439761_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439763_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439764_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439765_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439766_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604158_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604164_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604178_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604180_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604184_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604191_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604200_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604204_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604216_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604228_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604247_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604257_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604262_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604273_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604276_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604279_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604283_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604291_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604292_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604294_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604297_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604300_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604303_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604304_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604315_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ687529_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707534_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707546_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707555_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707565_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707566_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707567_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707568_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707609_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707610_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707611_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707612_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707613_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707617_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707618_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707619_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707620_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707621_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707622_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707623_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707624_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707625_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707626_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707629_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707630_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707631_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707632_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707637_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX096953_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX310721_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX310724_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX310725_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX310731_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX310732_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849295_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849313_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885570_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885581_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885582_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885591_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885689_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885788_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885841_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885870_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF414678_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771918_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771952_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771955_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779227_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779238_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779243_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779244_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779245_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779246_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779247_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779248_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779251_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779255_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779258_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779277_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779297_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779299_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779304_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779310_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779313_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779314_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779325_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779326_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779328_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779330_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779334_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779335_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779338_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779339_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779342_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779346_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779347_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779350_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779352_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779355_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779360_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779362_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779363_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779364_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779366_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779368_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779369_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779373_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779378_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779385_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862506_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862507_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862508_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843166_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843173_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843192_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843214_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843215_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843217_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854708_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854709_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854710_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606742_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606746_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606749_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606782_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606798_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606805_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606806_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606807_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606813_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606845_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606846_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606858_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606863_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606865_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606866_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606877_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606878_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606880_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606882_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606911_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606926_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165621_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165627_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165628_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165631_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165642_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165649_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165650_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165673_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165677_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165678_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165679_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165681_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165682_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165688_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165691_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165695_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165696_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165709_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165710_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165714_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165718_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165730_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165731_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165736_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165737_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165739_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165745_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165747_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165748_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165754_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165765_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165767_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165775_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165784_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165801_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP244022_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP274925_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP274927_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP274928_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718087_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718088_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718090_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718091_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718092_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718093_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718094_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718095_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718096_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718097_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718098_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718099_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718101_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997618_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997619_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749824_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749829_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749830_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749835_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749836_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749837_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749838_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749840_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749843_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749844_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749850_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU605532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU900752_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372032_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372033_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372034_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372036_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372037_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372038_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372040_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372042_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372045_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372046_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372051_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372055_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372059_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372061_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372062_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372067_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372070_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372072_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372075_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372076_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372078_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372080_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372082_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372087_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372094_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520676_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY003230_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY697842_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809892_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809911_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809929_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
L13994_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC074724_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC311243_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC430617_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC458430_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC458431_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC517161_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC592168_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC592169_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC592170_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG383613_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127849_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127855_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127857_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758696_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426093_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426094_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426095_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
OK106253_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87725_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U91820_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486454_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847668_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847714_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY697833_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847591_S_P-A      atggagaacatcacataaggattcctaagacccctgctcgtgttacaggcggggtttttc
KU847547_S_P-A      acggagaacatcacatcaggattcctaggaccccagctcgtgttacaggcggggtttttc
KU847678_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacmggcggggttttyc
KU847679_S_P-A      atggagaacatcacatcaggattccyaggacccctgctcgggttacaggcggggttttyc
KU847505_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggsggggtttttc
KU847737_S_P-A      atggagaacatcacatcaggattcctaggacccctcctcgggttacaggcggggttttcc
KU847676_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816115_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
MK484595_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
KU847680_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgcgttacaggcggggtttttc
KU847545_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372028_S_P-A      atggagaacatcacatcaggattcctaggacccctgckcgtgttacaggcggggttttyc
KU847601_S_P-A      atggagaacatcacatcaggattcctarracccctgckcgtgttacaggcggggtttttc
KU847483_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847577_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggaggggtttttc
KU847544_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttc
KU847660_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
KU847661_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
KU847530_S_P-A      atggagaacatcacatcaggatycctaggacccctgctcgtgttacaggcggggtttttc
GQ486775_S_P-A      atggagaacatcacatcaggatycctaggacccctgctcgygttacaggcggggtttttc
KU847649_S_P-A      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtwtttc
KU847719_S_P-A      atggagaacatcacatcaggattcctagracccctgcccgtgttacaggcggggttttkc
KU847506_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY271385_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JN983891_S_P-A      atggagaacatcacatcagaattcctaggacccctgcccgtgttacaggcggggttttcc
JN983879_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KU847534_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
KU847681_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
JN983861_S_P-A      atggagaacatcacatcaggattcctagaaccccagctcgtgttacaggcggggtttttc
JN983853_S_P-A      atggagaacatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttc
GQ486838_S_P-A      atggagaacatcacatcaggatycctaggacccctgctcgtgttacaggcggggtttttc
KX276769_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847659_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847634_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630630_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983849_S_P-A      atggagaacatcacatcaggattcctaaaacccctgctcgggttacaggcggggtttttc
EF547855_S_P-A      atggagaacatcacatcaagattcctaaaacccctgctcgggttacaggcggggtttttc
DQ412468_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847473_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604150_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgkgttacaggcggggtttttc
KU847677_S_P-A      atggagaacatcacatccggattcctaggacccctgctcgcgttacaggcggggtttttc
KM590921_S_P-A      atggagaacatcacatcagcattcctaggacccctgctcgtgttacaggcggggtttttc
MK948385_S_P-A      atggagaacatcacatcagcattcctaggacccctgctcgtgttacaggcggggtttttc
KU847632_S_P-A      atggagaacatcacatcagaattccaagaacccctgcccgtgttacaggcggggtttttc
DQ412467_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165825_S_P-A      atggagaacatcacatcaggattcctaggaccccagctcgtgtcacaggcggggtttttc
KP165826_S_P-A      atggagaacatcacatcaggattcctaggaccccagctcgtgtcacaggcggggtttttc
MN758711_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862521_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT210034_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK975862_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847696_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847658_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692558_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttc
KU847570_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295511_S_P-A      atggagaacatcacatcaggatccctaggacccctgctagtgttacaggcggggtttttc
JN983886_S_P-A      agggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH272596_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165820_S_P-A      atggagaacatcacatcaggattcctaggaccccagctcgtgtcacaggcggggttttcc
KP165704_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412474_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
U87735_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847732_S_P-A      atggagaacatcacatcaggattcctaagacccctgcgcgtgttacaggcggggttttcc
KU847685_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggsggggtttttc
JN983868_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165831_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847738_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604128_S_P-A      atggagaacatmacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512462_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK177883_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809899_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU900751_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KU847587_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983845_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgggttacaggcggggtttttc
JN604251_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
M21030_S_P-A        atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
X04820_S_P-A        atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486772_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
FJ665816_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847692_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847664_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847630_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847604_S_P-A      atggagaacatcacatcaggattcctaggaccccngctcgtgttacaggcggggtttttc
KU847575_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847533_S_P-A      atggagaacatcacatcaggattcctacgacccctgctcgtgttacaggcggggtttttc
KU847511_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT151612_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT151617_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165647_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgkgttacaggcggggtttttc
JN983839_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692570_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
DQ412471_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
AB453988_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758680_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847641_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606765_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934772_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127860_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809910_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847617_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983867_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HQ185229_S_P-A      atggagagcacatcatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486130_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847644_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758709_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847699_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847567_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514386_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690535_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412483_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809881_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847767_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847749_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983903_S_P-A      atggagaacatcacatcaaaattcctaggacccctgctcgtgttacaggcggggtttttc
JN983873_S_P-A      ayggagaacatcacatcaggattcctaagacccctgcccgtgttacaggcggggtttttc
GQ486535_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809894_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX357646_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847666_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847646_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847631_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
KU847609_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847557_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847554_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606928_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514385_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
JQ514286_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983898_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
JN983859_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604241_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101113_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM011485_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738804_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB246336_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
JX849301_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862520_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983881_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630642_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116084_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514284_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809901_S_P-A      atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttc
KY809889_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
KU847702_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847481_S_P-A      atggagaacatcacatcaggattccyaggacccctgctcgtgttacaggyggggtttttc
GQ486194_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786655_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786656_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847486_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692572_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809933_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758718_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758700_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809912_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809904_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809903_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU900754_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847713_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847705_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847691_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847673_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847654_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847615_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847595_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847588_S_P-A      atggagaacatcacatcmggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847584_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847583_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847527_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847508_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847494_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggyggggtttttc
KM606904_S_P-A      atggagaacatcacatcaggattcctaggaccccagctcgtgttacaggcggggttttcc
KJ854701_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514289_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983893_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983847_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486287_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692562_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412461_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412453_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412450_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412445_S_P-A      atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttc
DQ412443_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
AY738807_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116091_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809922_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486419_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547854_S_P-A      atggaacgactcacatcaggattcctaggacccctgctcgtgttacaggcggggtctctc
KU847722_S_P-A      atggagaacatcacatcaggattcccaggacccctgctcgtgttacaggcggggtttttc
KU847629_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854699_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcctgttacaggcggggtttttc
KM606707_S_P-A      atgaagatcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116093_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983848_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX357649_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847752_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692576_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412473_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983846_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264610_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983902_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983856_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854707_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY903452_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847693_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809534_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412460_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758697_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983850_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK333250_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87731_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758703_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
MN758701_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF925368_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772353_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT992440_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809890_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX357645_S_P-A      atggagaacatcacatcagggttcctaggacccctgctcgtgttacaggcggggtttttc
KX357643_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KX302113_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847640_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847610_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847582_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847573_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847559_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847551_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847543_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847523_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
KU847520_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847504_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847490_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997730_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606912_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854688_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514287_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983908_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983907_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983905_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983895_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983894_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
JN983889_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983877_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983871_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983858_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JN983854_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983831_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HQ840709_S_P-A      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttc
GU799009_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
GU798978_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690526_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690518_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547849_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttt
DQ412490_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412475_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412454_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934771_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934768_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983896_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486718_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264611_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264612_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LC051141_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692577_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983904_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983862_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983832_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983892_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412472_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983890_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU799040_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847578_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983885_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983852_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547850_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372029_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412493_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854693_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165783_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606900_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847548_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983833_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200199_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692578_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692579_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692580_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692581_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692582_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692583_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692584_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692585_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692563_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692559_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690527_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
FJ692557_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692571_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692574_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101115_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101116_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101117_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847755_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847760_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690517_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983878_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758682_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY697834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847539_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809484_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK484599_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U91810_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758717_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464811_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809936_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809916_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809917_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353882_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353876_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX357650_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847763_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847709_S_P-A      atggagaacatcacatcaggatccctaggacccctgcccgtgttacaggcggggtttttc
KU847701_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847645_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847531_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847514_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
KU847500_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847501_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847499_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847482_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847478_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847475_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630637_S_P-A      atgganaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630636_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT201161_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT201168_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX357642_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718086_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165658_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606788_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
KM606706_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM590908_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM590909_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK948376_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK948377_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM519452_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM519453_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958468_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR139743_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736920_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF925400_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958459_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854698_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922424_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922425_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514405_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983897_S_P-A      atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttc
JN983888_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983860_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983851_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983872_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630638_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983837_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983838_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264603_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604145_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101119_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101120_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922428_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854700_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486693_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486143_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX357644_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690515_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547848_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547847_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctc
EF547836_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847684_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412465_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934770_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934767_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738814_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786662_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786657_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786658_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB030513_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB937791_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB937796_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738813_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934769_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934774_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ020003_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412462_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412470_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412485_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412492_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547839_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547840_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547841_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547842_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547843_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547844_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547845_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547846_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU410082_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486203_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101118_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101124_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM772994_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM772995_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM772996_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM772997_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF298903_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983836_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983840_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983844_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983865_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983882_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983883_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983884_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983899_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514383_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF170754_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922426_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922427_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854695_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606748_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165629_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718085_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630621_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847542_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847546_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847553_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847594_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847626_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847727_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847757_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264601_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264604_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264605_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264606_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264607_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264614_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264657_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264658_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264659_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX302133_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372030_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520699_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809918_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772351_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127854_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK360178_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB453987_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809486_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233278_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412458_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983841_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ023663_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847497_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847526_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847585_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847605_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690516_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604308_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486305_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604165_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttm
LT992441_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN147822_S_P-A      atggagaacatcacatcaggactcctaggacccctgcacgtgttacaggcggggtttttc
MN197542_S_P-A      atggagaacatcacatcaggactcctaggacccctgcacgtgttacaggcggggtttttc
JN604220_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
JF439890_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439886_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439887_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439888_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439889_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439891_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439892_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439893_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439894_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439895_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ995834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ995813_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN562230_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439868_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439849_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439864_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439866_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439861_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439852_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439846_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439843_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439855_S_P-A      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439836_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439840_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439850_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439857_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439854_S_P-A      atggagaacatcacatcagggttcctaggacccctgctcgtgttacaggcggggtttttc
JF439856_S_P-A      atggagaacatcacatcagggttcctaggacccctgctcgtgttacaggcggggtttttc
JF439867_S_P-A      atggcgaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439865_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439853_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439847_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439841_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439838_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439858_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439860_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439835_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439837_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439833_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439839_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439844_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439845_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439848_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439851_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439859_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707599_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707589_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707608_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707576_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707585_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707586_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707592_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707590_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707604_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707580_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707587_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707581_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707606_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707603_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707583_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707575_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707578_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707600_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707596_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707577_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttaccggcggggtttttc
JQ707605_S_P-A      atggagaacatcacatcaggaggcctaggacccctgctcgtgttacaggcggggtttttc
JQ707594_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707601_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707597_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707584_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707574_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707602_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707579_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707588_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707591_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707598_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707593_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707582_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JQ707607_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JQ707595_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847753_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707348_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707351_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707357_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707358_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707346_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707345_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707349_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707355_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707356_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707363_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707365_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707367_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
JQ707354_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707362_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707364_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707347_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707361_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707370_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707369_S_P-A      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707368_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707353_S_P-A      atggagaatatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707350_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707352_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707359_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707360_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707366_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439979_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439975_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439961_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439958_S_P-A      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439952_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439993_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439992_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439991_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439978_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439976_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439972_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439971_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439970_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439966_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439965_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439953_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439951_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439949_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439989_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707653_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaagcggggtttttc
JQ707651_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707647_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707644_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439987_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439986_S_P-A      atggagaatatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439977_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439973_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439968_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439959_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439956_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439954_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439947_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439944_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439945_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439960_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439964_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439943_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859955_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859934_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325764_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325765_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563550_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439946_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439948_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439950_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439955_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439957_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439962_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439963_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439967_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439969_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439974_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439980_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439983_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707638_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707639_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707640_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707641_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707642_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707643_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707645_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707646_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707648_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707649_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707650_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707652_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707654_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707655_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707656_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997454_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165715_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165771_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165803_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG383598_S_P-A      atggagaacatcacatcaggactcctaggaccccagctcgtgttacaggcggggtttttc
KX372057_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325767_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325768_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604309_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtctttc
JN604280_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtctttc
KP165726_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486249_S_P-A      atggagaacatcacatcaggaytcctaggacmcctgctcgtgttacaggcggggtttttc
MF772347_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606924_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KM606933_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF771936_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604229_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372098_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF209392_S_P-A      atggagaacatcacatcaggattcctaggacccctgccggtgttacaggcggggtttttc
X51970_S_P-A        atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttc
AY152726_S_P-A      atggagaacatcacatcaggattcctagaacccctgctcgtgttacaggcggggtttttc
KX372052_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707401_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF209405_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997624_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604190_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165751_S_P-A      atggagaacatcacatcaggaywcctaggacccctgctcgtgttacaggcggggtttttc
KP165782_S_P-A      atggaraacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
KP165635_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ995829_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165703_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439990_S_P-A      atggagaacatcacatcaggactcccaggacccctgctcgtgttacaggcggggtttctc
AY653776_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HE981728_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547828_S_P-A      atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486829_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HE981729_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165657_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165669_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF297623_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87726_S_P-A        atggagaacatcacattaggatccttaggacccctgctcgtgttacaggcggggtttttc
KP165654_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
JQ707340_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604209_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653777_S_P-A      atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttc
U87734_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772348_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
MF772346_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165734_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgygttacaggcggggttttyc
KP165721_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779264_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439862_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606821_S_P-A      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165625_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604317_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707318_S_P-A      gtggacaatgtcacatcagtgttcaaaggacccctgctcgtgttacaggcggggtttttc
GQ486691_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF134145_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165807_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606971_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
JQ707325_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165676_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772349_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772344_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KP997739_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165624_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KM606941_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779332_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779293_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779261_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849324_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707372_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604307_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604188_S_P-A      atggagaacatcacatcaggattcctargacccctgctcgtgttacaggcggggtttttc
GQ486571_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295528_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
DQ412501_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
AF090838_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372058_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707398_S_P-A      atggtgaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412542_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779260_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604274_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412541_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606819_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707335_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165797_S_P-A      atggagaacatcacatcaggattcctarracccctgctcgtgttacaggcggggtttttc
KP165637_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165675_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN562229_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF772350_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165668_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165626_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606943_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606808_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606816_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606817_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779265_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849309_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849640_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707339_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486836_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486557_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486198_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477464_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738820_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707397_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997707_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426099_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426098_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997737_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233280_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707395_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779367_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412511_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KP165707_S_P-A      atggagaacatcacatcaggattcctargacccctgctcgtgttacaggcggggtttttc
KP165701_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165724_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749839_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749846_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749847_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT749849_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439984_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439982_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439985_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439988_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY168427_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165723_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF150686_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847669_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP718089_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165773_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165781_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165699_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
KM606769_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707663_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB697493_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486714_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM295798_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM295799_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM410963_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412540_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859951_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859954_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859956_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486697_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707658_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707659_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707661_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707662_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707664_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707665_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707667_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707669_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707670_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707672_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707675_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707676_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707681_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM519454_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165674_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165717_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165740_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165764_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165794_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165810_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847718_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF150687_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN562228_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707674_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX125364_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707344_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707324_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707326_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707313_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707306_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707300_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707314_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707317_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707328_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707330_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707331_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707304_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707310_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707323_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707333_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707319_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707299_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707302_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707308_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707311_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707320_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707341_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707342_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707343_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707337_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707334_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707316_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707305_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707301_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707303_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707309_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707312_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165659_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606815_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606810_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606814_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653789_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY653788_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707338_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606916_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486668_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606778_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606785_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606786_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606841_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606887_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606905_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606909_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606914_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606915_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606917_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606918_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606919_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165772_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165789_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165804_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707408_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439767_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439768_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439769_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439770_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439771_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439772_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439773_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439774_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439775_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439777_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439778_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF440016_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF440020_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165663_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165716_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165761_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF440018_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165776_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165793_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165802_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165805_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707400_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707402_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707403_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707404_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707405_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707406_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707407_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707409_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707410_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707411_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707412_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707413_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707414_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707415_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707416_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707417_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707418_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707419_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707420_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604306_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771919_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809902_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87729_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX827296_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997814_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165702_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165665_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606833_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606795_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606850_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606768_S_P-A      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779358_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtatttc
KF779354_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707391_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707387_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707384_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707378_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707377_S_P-A      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707329_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707327_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707322_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707315_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604319_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604277_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604167_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412534_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttc
DQ412531_S_P-A      atggagaacatcacatcaggatttctaggacccctgctcgtgttacaggcggggtttttc
AY311374_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604282_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779234_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB263406_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF090841_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY902775_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412543_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412550_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412552_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ477496_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604160_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604162_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604299_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707307_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707332_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707336_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707371_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707373_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707375_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707376_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707379_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707380_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707381_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707382_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707383_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707385_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707386_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707388_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707389_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707390_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707392_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707393_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707394_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707396_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707399_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849320_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885609_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779312_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779331_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779337_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779351_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779359_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779361_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF779375_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606800_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606822_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606825_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606869_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606886_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165643_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165644_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165648_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165693_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165760_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165788_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX827294_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX827295_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
X75666_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ707374_S_P-A      gtggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547249_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY303900_S_P-A      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847489_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgygttacaggcggkgtttttc
KY271379_S_P-A      atggagaacacctcatcaggacccctagtacccctgctcgtgttaccggcggggtttttc
KU847726_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
FN547324_S_P-A      atggagaacaccacatcagaactcctaggacccctgctcgtgttacaggcggggtttttc
KF771953_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
FN545830_S_P-A      atggagaacatcacatcaggaytcctaggacmcctgctcgtgttacaggcgggatttttc
MN758710_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY271384_S_P-A      atggagaacatcacatcaggactcctaggacccctgcgcgtgttacaggcggggtttttc
AB194953_S_P-A      atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttc
FN547364_S_P-A      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547306_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
FN545840_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412464_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547315_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545834_S_P-A      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttc
FN545833_S_P-A      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttc
FN547321_S_P-A      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttc
FN547314_S_P-A      atggagaacatcacmtcaggattcctaggacccctrctcgtgttacaggcggggtttttc
FN547320_S_P-A      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttc
FN547322_S_P-A      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttc
FM200195_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FM200204_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FN547352_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200188_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200216_S_P-A      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttc
FN547345_S_P-A      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545838_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547338_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200202_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547353_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FN547354_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FN547351_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FM200183_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FM200193_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FN547349_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
FN547348_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
FM200210_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200207_S_P-A      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200182_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200187_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547342_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545832_S_P-A      atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttc
FM200186_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547346_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545828_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547355_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547363_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547334_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
FN545835_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580627_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580639_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580642_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH580643_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545829_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545839_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH165307_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547344_S_P-A      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692587_S_P-A      atggagaacatcacatcaggattcccaggacccctgctcgagttacaggcggggtytttc
MN585096_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849307_S_P-A      atggagaacatcacatcaggattcctaggacycctgcycgtgttacaggcggggtttttc
MK512469_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH347491_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
KX648543_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX648544_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF862522_S_P-A      atggagaacatcacatcaggattcctaggactcctgcccgtgttacaggcggggtttttc
JN604157_S_P-A      acggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggrggggtttttc
MK127858_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB076679_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476019_S_P-A      agggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH347485_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692573_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233287_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168427_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200189_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512455_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847565_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847589_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464825_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816145_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816137_S_P-A      atggagaacatcacatcaaaattcctaggacccctgctcgtgttacaggcggggtttttc
AB786663_S_P-A      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816111_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816131_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922433_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476020_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY576429_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233275_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233281_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520705_S_P-A      atggagaacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426092_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512475_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816133_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
FM200180_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF083635_S_P-A      atggagaacatcacatcaggatacctaggacccctgctcgtgttacaggcggggtttttc
HM535205_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476016_S_P-A      atggagaacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK484602_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH347489_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB076680_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512471_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922434_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX372031_S_P-A      akggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690519_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692592_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426090_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512466_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
MK512461_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK177884_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464820_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF979152_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711604_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816143_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AY233279_S_P-A      atggagaacatcacatcaggattcctagggcccctgctcgtgttacaggcggggtttttc
AF297625_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922429_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922430_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512467_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464810_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464829_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464813_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464814_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464818_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464819_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464821_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464822_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464826_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464827_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464830_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464824_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX648545_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922409_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922408_S_P-A      atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttc
KF922406_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ010776_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ010777_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ010778_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922407_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacgggcggggtttttc
MT426091_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512458_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200181_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200215_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM199974_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200203_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520686_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK484596_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512468_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512464_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512463_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK177886_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464812_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF979151_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353877_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX648547_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736919_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168426_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168422_S_P-A      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttc
FM199981_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM199978_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934766_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738811_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738808_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233289_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233285_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233284_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233282_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233276_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233274_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476017_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM199977_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816140_S_P-A      aaggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520695_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK484598_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816139_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX154579_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX154580_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX154581_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX154582_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168423_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512457_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT347091_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF979146_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM199975_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200201_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512456_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512477_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816114_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816149_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ020002_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU736918_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738810_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604169_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512474_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512465_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563545_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM199976_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412452_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512476_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM199979_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563548_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512459_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512460_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512470_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512472_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK512473_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816127_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168424_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816123_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816126_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816128_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM535200_S_P-A      atggagaacatcacatcgagattcctaggacccctgctcgtgttacaggcggggtttttc
MF979144_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520688_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KP168425_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127851_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX648548_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT347092_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT347087_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476021_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU563547_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520677_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816109_S_P-A      caggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786659_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233283_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295534_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816130_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT347088_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU605535_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520675_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520679_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520689_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520690_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520691_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520692_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520694_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520696_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520697_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520704_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY213953_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464815_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464828_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127848_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711606_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
MW567968_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200185_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934763_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MW567969_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486828_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM590923_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
MK948387_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
AB076687_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
AB246317_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476018_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KU605533_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KU605534_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
AB076685_S_P-A      atggagaacatcacatcaggattcctaggaccccwgctcgtgttacaggcggggtttttc
AB786661_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
AB076689_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB076690_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87736_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcttgttacaggcggggtttttc
KX648549_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816146_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB076682_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182334_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
JN182333_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182332_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182331_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182324_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934773_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113365_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113366_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113367_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113369_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113370_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113372_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113373_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113374_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113376_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113377_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113378_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113379_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113380_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113387_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113388_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113390_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113391_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113392_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113396_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC113397_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG839201_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG839204_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233288_S_P-A      atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttc
AM494718_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB076686_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB076683_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcagggtttttc
AB076678_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB076688_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520684_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB076681_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX648546_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182330_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182328_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182323_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182321_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182320_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182319_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182318_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182322_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182325_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182326_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182327_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN182329_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK484600_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168435_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816119_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816110_S_P-A      caggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816148_S_P-A      caggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816151_S_P-A      caggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983574_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983567_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983566_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983575_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983572_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983570_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983573_S_P-A      atggaaaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983562_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983564_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983578_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983563_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983569_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY271377_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983565_S_P-A      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY271378_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547336_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547340_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547343_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY493873_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM184125_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU054331_S_C-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM184126_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486437_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547153_S_P-A      atggagaacatcacatcaggattcctaggaccccggctcgtgttacaggcggggtttttc
FJ692555_S_P-A      atggagaacatcacatcaggattcccaggacccctgcacgtgttacaggcggggttttcc
KM983571_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983576_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439751_S_P-A      atggagaacatcacatcaggattcctaaggcccctgctcgtgttacaggcggggttttcc
JF439727_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
JF439725_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439728_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439734_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439720_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439744_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439742_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439739_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439722_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439731_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
JF439748_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439745_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439746_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439743_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439730_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439726_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439729_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439750_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JF439740_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439741_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439732_S_P-A      acggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JF439733_S_P-A      acggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JF439906_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439910_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439900_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439908_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JF439898_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439899_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439901_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439896_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JF439909_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JF439724_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439738_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
JF439723_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439721_S_P-A      atggagaagatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439735_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439736_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439737_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439747_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439903_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439905_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439897_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439902_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439904_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JF439907_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MW567972_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862523_S_P-A      atggagaacatcacatcaggatycctaggacccctgctcgtgttacaggcggggtttttc
MW567976_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711605_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU711607_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299404_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934764_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ161813_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ299401_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MW567973_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MW567975_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606737_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AM180624_S_P-A      atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttc
FN547157_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692613_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692598_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB194951_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547360_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB194950_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692606_S_P-A      atggagaacatcacatcaggattccyargacccccgctcgtgttacaggcggggtctttc
DQ412469_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547166_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547273_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692554_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547238_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY493811_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtattacaggcggggtttttc
JN604217_S_P-A      atggagaacatcacatcrggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547341_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547244_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692609_S_P-A      atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttc
FJ692610_S_P-A      atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttc
DQ412477_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545831_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547305_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547308_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547309_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547312_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547291_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
X75669_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547326_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547330_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545836_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547327_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547328_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547329_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547331_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692593_S_P-A      atggagaacatcacatcaggattcctaggacccctgcwcgtgttacaggcggggtttttc
LC462120_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY493814_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547335_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547235_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692611_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692605_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692603_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692599_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692595_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692607_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692608_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200198_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692612_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692600_S_P-A      atggagaacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692597_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692596_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692601_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692602_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692604_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT622525_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545825_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547228_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363613_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127853_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738806_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB194952_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN544634_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547216_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM363612_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN547325_S_P-A      atggagaacaycacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412481_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412487_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtatttc
KU847637_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847564_S_P-A      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtwtttc
KU847484_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847688_S_P-A      acggagaacatcacatcaggattcctaagacccctgcacgtgttacaggcggggttttyc
KU847541_S_P-A      atggagaacatcacatcaggattcctaagaccccagctcgtgttacaggcggggtttttc
KU847724_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttcc
KY493896_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgggttacaggmggggtttttc
KU847662_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY271382_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
KU847671_S_P-A      atggagaacatcacatcaggattcctaggaccccggctcgtgttacaggcggggtttttc
FN545837_S_P-A      atggagaacaycacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847665_S_P-A      -----gaacatcacatcaggattcctaggacccctgmtcgtgttacaggcggggttttyc
MN758689_S_P-A      atggagaacatcacatcaggacacctaggaccccagctcgtgttacaggcggggtttttc
KY493902_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN545826_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttc
KU847647_S_P-A      atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttc
MK177888_S_P-A      atggagaacatcacatcaggatttttaggacccttgttcgtgttacaggcggggtttttc
JN983901_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758714_S_P-A      atggagagcatcacatcrggattcctaggacccctgctcgcgttacaggcggggtttttc
MN758705_S_P-A      atggagaacatcacatcaggattcctaagacccctgcacgtgttacaggcggggtttttc
KY809908_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY493900_S_P-A      atggagaacatctcatcaggattcctaggaccccrgctcgtgttacaggcggggttttcc
KU847687_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
MN758687_S_P-A      acggagaacatcacatcaggattcctaggaccccagctcgtgttacaggcggggtttttc
KU847672_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847768_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809887_S_P-A      acggagaacatcacatcaggattcctaggacccctgctcgtgttacaggaggggtttttc
KU847730_S_P-A      aaggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847736_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547856_S_P-A      atggaagacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtattgg
DQ412449_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604186_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK177881_S_P-A      atggagaacatcacatcaggattcctaggacccctaatcgcgttacaggcggggtttttc
KP165671_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtatttc
KU847487_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809921_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606777_S_P-A      acggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983834_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547853_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
MN758690_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809920_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809883_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KU847695_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847638_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854689_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
JN983855_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604155_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758702_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630624_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412488_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847655_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847656_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847657_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816101_S_P-A      caggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847766_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847710_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847708_S_P-A      atggagaacaccacatcaggattcctaggacccctgctcgggttacaggcggggttttcc
KU847683_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847639_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547852_S_P-A      atggagaacatcacatcaggattcctagaaccccagctcgtgttacaggcggggtttttc
KP997702_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547851_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtctttt
KU847706_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983843_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604163_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630616_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630612_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847635_S_P-A      -----gaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847636_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847739_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggsggggtttttc
KU847740_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847711_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758692_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809932_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809905_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809893_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX302129_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168434_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983880_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983842_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486271_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ349296_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547832_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KU847717_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690525_S_P-A      atggagaacatcacatcagtattcctaggacccctgctcgtgttacaggcggggtttttc
KT630611_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630627_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606780_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809927_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847682_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KU847764_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
MN758724_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758716_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK517517_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK333249_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809931_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KY809926_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX302106_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847762_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847731_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847707_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630632_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630617_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630608_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630607_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
KM606766_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983887_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547831_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547829_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547830_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809930_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486686_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690523_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847667_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809880_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862519_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854691_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101114_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101122_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ665815_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847650_S_P-A      -----gaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847712_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758695_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758684_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758721_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809937_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809935_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809928_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809919_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809886_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809885_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX302095_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847765_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847769_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847759_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847751_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847607_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847716_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847572_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630641_S_P-A      atgganaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630631_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165653_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854706_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854703_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854696_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847670_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847721_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847756_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854686_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690522_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547838_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547837_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547835_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF547834_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctc
EF547833_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690524_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983864_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849314_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849323_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF862518_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854692_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630615_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630635_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630639_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809913_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK517516_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK517519_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116086_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF043560_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101123_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983874_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983876_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854694_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854702_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854704_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854705_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606927_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165692_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165799_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630628_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847563_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847734_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847750_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809888_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809909_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758719_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
LT992448_S_P-A      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
KX302134_S_P-A      atggagaacatcacatcaggactcctagaacccctgctcgtgttacaggcggggtttttc
MN758685_S_P-A      atggagaacatcacatcaggattcctaaracccctgctcgtgttacgggaggggtttttc
KU847697_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KY809882_S_P-A      atggagaacatcacatcaggattcctaggaccccagctcgtgttacaggcggggtttttc
MH464807_S_P-A      atggagaacatcacatcaaaattcctaggacccctgctcgtgttacaggaggggtttttc
KU847745_S_P-A      atggagaacatcacatcaarattcctaagacccctgctcgagttacaggaggggtttttc
EF690521_S_P-A      atggagcccatcacatcggtatttctaggtcccctcttcgtgacacaggcgggttttttc
FJ904434_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN758699_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttyc
KU847761_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771968_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU304331_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ023662_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttc
JQ023660_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttc
JQ023661_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttc
KR139742_S_P-A      agggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464809_S_P-A      agggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464823_S_P-A      agggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU859952_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ331047_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412456_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ331046_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486076_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983568_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM983579_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116094_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK177880_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168431_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514401_S_P-A      atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttc
KT201167_S_P-A      atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttc
KR816135_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997447_S_P-A      atggagaacatcacatcaaaattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958470_S_P-A      atggggaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF925362_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
KC875254_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514397_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486148_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690520_S_P-A      atggagaacatcacatcacgattcctaggaccgctgctcgtgttacaggcggggtttttc
EF103278_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB937795_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816116_S_P-A      aaggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY161138_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY161139_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847642_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847643_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809924_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168428_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958464_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983900_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ009235_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514399_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168429_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
KR816118_S_P-A      caggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514398_S_P-A      atggagaacatcacatcaggattcctaaracccctgctcgtgttacaggcggggtttttc
KT366620_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366516_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958453_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366621_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353934_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958454_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
MK484597_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU900753_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847733_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847703_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847704_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT201165_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC875258_S_P-A      atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811853_S_P-A      atggagaacatcacatccggattccaaggacccctgctcgtgttacaggcggggtttttc
JQ514391_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514384_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN476102_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983870_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604260_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604136_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738809_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY373428_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttac
AB116083_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847725_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847743_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF925373_S_P-A      atggagaacatcacatcaggattcccaggacccctgctcgtgttacaggcggggtttttc
AB786660_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU798998_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168432_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK484601_S_P-A      --ggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF925407_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF925385_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168430_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC875259_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgtaacaggcggggtttttc
KC875257_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC875252_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC875251_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811860_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604237_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU798976_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ325786_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692566_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ315786_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY934765_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786651_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116090_S_P-A      atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttc
AB786643_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786645_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786646_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786648_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786649_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786652_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB786654_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU798964_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514504_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514506_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC875253_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC875255_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC875256_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF214658_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854687_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854690_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP168433_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK127856_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514501_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY233290_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG839203_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG839206_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG839207_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847529_S_P-A      aaggagaacatcacatcaggattcctaggaccccagcccgtgttacaggcggggttttyc
MH464817_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR139744_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacagggggggtttttc
MH464808_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK568525_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK568535_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK568530_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK568531_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT210032_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922414_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922415_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922416_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922417_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922418_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922419_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922420_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922421_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U88095_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF979153_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF979149_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF297621_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF979143_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922435_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922436_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF922437_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87728_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87727_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
U87733_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476023_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476022_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476027_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476026_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU605536_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU605537_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU605538_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU605539_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520680_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520687_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520701_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520698_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476025_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520678_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520700_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520702_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520703_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX520706_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF476024_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EU366129_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM199980_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FM200214_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847690_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847614_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttcc
GQ486780_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692575_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN562223_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264631_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264635_S_P-A      atggagaacatcacatcaggattcctagnnnccctgctcgtgttacaggcggggtttttc
KX264629_S_P-A      atggagaacatcacatcaggattcctaggacccntgctcgtgttacaggcggggtttttc
KX264640_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264594_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264595_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264596_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264597_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264598_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264620_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264621_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264622_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264623_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264624_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264625_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264626_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264627_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264628_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264632_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264633_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264638_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264641_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264642_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264643_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264644_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264645_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264646_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264647_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264648_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264649_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264650_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264651_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264652_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264653_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264654_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264655_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX264656_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847503_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847625_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997998_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809934_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997407_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
HM101121_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847747_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809914_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN053840_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP997723_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165706_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809900_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB453989_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692561_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983863_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX302130_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847622_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KU847555_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165634_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG877723_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG877725_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847742_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847560_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606923_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486317_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809896_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809898_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606701_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847517_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847495_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606864_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY738812_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165738_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165777_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412444_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847474_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX302105_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606832_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847700_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854685_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847538_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT630609_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983857_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983909_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FR821992_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652707_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821993_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652704_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652716_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652715_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652711_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652708_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652705_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821994_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821990_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821988_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821991_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652709_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652710_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652712_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652713_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
HE652718_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
FR821989_S_P-A      atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttc
GQ486314_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847651_S_P-A      ayggagaacatcacatcaggatccctargacccctgckcgtgttacaggcggggtttttc
KU847652_S_P-A      ayggagaacatcacatcaggatccctaggacccctgcgcgtgttacaggcggggtttttc
MH272691_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847675_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412486_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412455_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165830_S_P-A      atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353905_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604193_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165832_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165833_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165828_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165829_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN585097_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT114170_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353889_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983875_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809907_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412451_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttc
KR905426_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KT366467_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF779384_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggagaggtttttc
MK177885_S_P-A      atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT201163_S_P-A      atggagaacatcacatcaggaytcctaggacccctgcwcgtgttacaggcggggtttttc
AB116088_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165827_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KP165785_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412447_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486156_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB809477_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT201159_S_P-A      atggagaacatcacatcaggattcctaggacccctgcwcgtgttacaggcggggtttttc
KR905429_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KF771962_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KF214662_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR905425_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366466_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486213_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811862_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353875_S_P-A      atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttc
JN983835_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514293_S_P-A      atggaaaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847698_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692586_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412476_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412448_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB453986_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116092_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116089_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF214659_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM243029_S_P-A      nnnnnnnnnnnnnnnnnnngattcctaggacccctgctcgtgttacaggcggggtttttc
GU799039_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116085_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809915_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT151613_S_P-A      atggagannnnnnnnnnnnnattcctaggacccctgctcgtgttacaggcggggtttttc
KR905427_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
EF690536_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692567_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486092_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
AY373429_S_P-A      atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT151618_S_P-A      nnnnnnnnnnnnncatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK295788_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH272667_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353901_S_P-A      atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353895_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353890_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847758_S_P-A      atggagaacatcacatcaraattcctaggacccctgctcgtgttacaggcggggtttttc
KT366521_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF214666_S_P-A      atggagaacatcacatcgggattcctaggacccctgctcgtgttacaggcggggtttttc
KF214657_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggaggggtttttc
KC885659_S_P-A      atggagaacattacatcaggattcctargacccctgctcgtgttacaggcggggtttttc
JQ514505_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514396_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514381_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514296_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514283_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU799020_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
GU798993_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GQ486103_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412478_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412457_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB116082_S_P-A      atggagaacatcacatcaggactcctaagacccctgctcgtgttacaggcggggtttttc
JN226084_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JX849603_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM590919_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK948383_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353897_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
KU847729_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816141_S_P-A      caggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412489_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514392_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF214661_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353879_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366471_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT201158_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412491_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AF090842_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH272675_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH272586_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KY809906_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT235599_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT151616_S_P-A      nnnnnnnacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811855_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH464816_S_P-A      atggagaacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttc
KY353904_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttc
KY353902_S_P-A      atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
KU847748_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT235614_S_P-A      atggagaacatcacatcaggattccttggacccctgctcgtgttacaggcggggtttttc
KT235603_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT235593_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttc
KT201164_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958443_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ843183_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ854697_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847754_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514389_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514297_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttc
JQ514292_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514281_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983869_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604230_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FN295508_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692565_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811861_S_P-A      atggagaacatctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY161143_S_P-A      atggaggacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY161144_S_P-A      atggaggacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692564_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692590_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692591_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514388_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN983866_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB241115_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
FJ692588_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KX357647_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
OK274310_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KU847744_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514503_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885810_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514500_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ315784_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU799047_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
M57663_S_P-A        atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF925372_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG839202_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MG839205_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514507_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF214660_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514295_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514280_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514290_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY373432_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366469_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT151614_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT151615_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MN476101_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF771967_S_P-A      atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttc
AB786647_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR816150_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412459_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412479_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH272668_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MF925361_S_P-A      atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttc
AB116087_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514531_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MT426088_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT235608_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT201166_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT151611_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR905430_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KR905431_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366468_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366470_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KM606930_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514502_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514393_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514288_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514533_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514285_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514282_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604156_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN132119_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU799052_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU799025_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU799004_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT235598_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366517_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ315785_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB246335_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AB241114_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
AY161142_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412480_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
DQ412484_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
GU799030_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604171_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604252_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JN604261_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514291_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514294_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514380_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514382_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514387_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514390_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514394_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514395_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514400_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ514532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811854_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811856_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811857_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811858_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811859_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811863_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
JQ811888_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KC885725_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF214663_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KF214665_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ194506_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958448_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958461_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KJ958467_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT235600_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366619_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
KT366628_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH272532_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH272552_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MH272679_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MZ093431_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
MK295787_S_P-A      atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttc
                                                                **  *           

KX372097_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KX372086_S_P-A      tkgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847556_S_P-A      ttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604218_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KF922431_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU185786_S_P-A      ttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctcaat
EU185789_S_P-A      ttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctcaat
EU185787_S_P-A      ttgttgacaagaatcctcacaataccmmagaatctagactcgtggtggacttctctcaat
EU185788_S_P-A      ttgttgacaagaatcctcacaataccacagartctagactcgtggtggacttctctcaat
DQ995827_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KP144207_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AB937797_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604176_S_P-A      ttgttgacaagaatcctcacaatacygaagagtctagactcgtggtggacttctctcaat
JN604249_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486770_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
GQ486817_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412504_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372074_S_P-A      ttgttgacaagaatcctcacaataccgcrgagtctagactcgtggtggacttctctcart
KX372069_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcagt
DQ995822_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486677_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
DQ412446_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486139_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486309_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ325766_S_P-A      ttgttgayaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372101_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862525_S_P-A      ttgttgacaagaatcctcacaataccscagagtctagactygtggtggacttctctcaat
KF771960_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604314_S_P-A      ttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KX372054_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AJ344115_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY230117_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ298162_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ298165_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ298163_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ298164_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY232836_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY232838_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY232839_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY232840_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY230118_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ298161_S_P-A      ttgttgacaagaatccccacaataccgcagagtctagactcgtggtggacttctctcagt
KX372048_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcagt
GQ486192_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY232837_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KX372096_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KX372090_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KP997696_S_P-A      ttgttgacaagaatcctcaccataccgcagaggatagactcgtggtggacttctctcaat
DQ412537_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
MK840531_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KX372071_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771957_S_P-A      ttgttgacaaaaatcctcacaacacctcagagtctagactcgtggtggacttctctcaat
KP165753_S_P-A      ttgttracaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604285_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KU847663_S_P-A      tygttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ412551_S_P-A      ttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MW234356_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849305_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372049_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372081_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486853_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477474_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604195_S_P-A      ttgttgacaagaatcctcacaataccacggagtctagactcgtggtggacttctctcaat
KX372056_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
JX849318_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771943_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486369_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486182_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486205_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF208875_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862524_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY660207_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KT630625_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX925296_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KX372089_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749822_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcaat
MK127850_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcaat
MG383612_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KF771956_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
JN604302_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477473_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ325777_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF208866_S_P-A      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AJ627227_S_P-A      ttgttgacaagaatcctcataataccgcagagtctagactcgtggtggacttctctcagt
KP165655_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165796_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412495_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412519_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372073_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372066_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606857_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606781_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486391_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477476_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
FJ904411_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372084_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486120_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
JF439877_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439878_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439872_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439870_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439881_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JF439880_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439873_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439875_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439869_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439876_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439871_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439874_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439879_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439882_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439883_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372085_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165656_S_P-A      tygttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372100_S_P-A      ttgttgacaagaatcctcacaataccgcagagkctagactygtggttgacttctctcagt
GQ486225_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactygtggtggacttctctcaat
GQ477502_S_P-A      ttgttgacaagaatcctcacaataccgcagaatctagactcgtggtggacttctctcagt
GQ486560_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN226069_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849598_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486782_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486441_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
GQ486165_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295518_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412497_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY233286_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MG839209_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372088_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372065_S_P-A      ttgttaacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165645_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486232_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477493_S_P-A      ttgttgacaagaatcctcacaatcccgcagagtctagactcgtggtggacttctctcaat
AF537372_S_P-A      ttgttgagaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY738142_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY738140_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY738141_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JN604305_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AF208873_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC836781_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486368_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
JX849306_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486694_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477477_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849298_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862517_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372093_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KX372102_S_P-A      ttgttgacaagaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
KM606827_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486209_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165813_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165795_S_P-A      ttgttgacaagaatcctcasaataccgcagagtctagactcgtggtggacttctctcaat
KP165770_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165651_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606901_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JF439842_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486840_S_P-A      ttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486532_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
GQ486253_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ325775_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477500_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY660208_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144202_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606950_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477463_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HE576988_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
HE576989_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JF439919_S_P-A      ttgttgacaagaatccttacaataccgcagagtctagactcgtggtgggcttctctcaat
AF065114_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475984_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477490_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486416_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN818844_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476012_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475994_S_P-A      ttgttgacaagaatcctcacgataccgcagagtctagactcgtggcggacttctctcaat
KF475982_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738816_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX520693_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX520683_S_P-A      ttgttgacaagaatcctcacaacaccgcagagtctagactcgtggtggacttctctcaat
AY738817_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606779_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476007_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476006_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476002_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacccgtggtggacttctctcaat
KF475995_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475992_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF537371_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476013_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295503_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX520682_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX520681_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX310723_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372043_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165732_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476014_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476008_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476005_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476003_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476001_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475999_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475998_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475997_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475996_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475993_S_P-A      ttgttggcaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475991_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtgggcttctctcaat
KF475989_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475988_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475986_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604240_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604194_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475985_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475987_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475990_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476000_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476004_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476009_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476010_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476011_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606891_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX520707_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606797_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486389_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809923_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KY809925_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809485_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486415_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144203_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144204_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439936_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439930_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439932_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439929_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439928_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439934_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439940_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439942_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439933_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439939_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439938_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439937_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439941_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439923_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439921_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439912_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439914_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439915_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439927_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439925_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439920_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439917_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439916_S_P-A      ttgttgacaagagtcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439926_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439911_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439913_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439918_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439922_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439924_S_P-A      ttgttgacaagaatcctcacagtaccgcagagtctagactcgtggtggacttctctcaat
KP165790_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486813_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AJ309369_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctaggctcgtggtggacttctctcaat
AJ309370_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AJ309371_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN818843_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MF772345_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372104_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KX372095_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KX372083_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165733_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606934_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779298_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849297_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604290_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604255_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604227_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439931_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486857_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggttgacttctctcagt
GQ486563_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486306_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacwcgtggtggacttctctcaat
GQ486104_S_P-A      ttgttgacaagaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
GQ477504_S_P-A      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU414104_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412538_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY738815_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738139_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY738143_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AY653778_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653775_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AF536524_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX827297_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JF439819_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439827_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439823_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809479_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KP165735_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606860_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606854_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctcgactcgtggtggacttctctcaat
KM606787_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
JN604298_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439935_S_P-A      ttgttgacaagaatcctcgcaataccgcagagtctagactcgtggtggacttctctcaat
DQ412536_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606925_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
JX849315_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477495_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF134143_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477470_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN758683_S_P-A      ttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372092_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactygtggtggacttctctcaat
KX827293_S_P-A      ttgttgacaagagtcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165778_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144208_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144206_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606803_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477494_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF297622_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165779_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486831_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477469_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ412529_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606710_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606844_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AB809481_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849312_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862515_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MG383607_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY382410_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KX372103_S_P-A      ttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT630643_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165758_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165700_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165687_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165685_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606872_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606856_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849311_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707537_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604236_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439821_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgcggtggacttctctcaat
GU563551_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486807_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486741_S_P-A      tygttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486556_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
GQ486211_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486077_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ477480_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ325792_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF690528_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ412520_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY653780_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653779_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY034878_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AF209399_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF209397_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF065116_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB222707_S_P-A      tcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606957_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606964_S_P-A      ttgttgacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
KP165817_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KP165819_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606793_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606794_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX125368_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
JN604179_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ477501_S_P-A      ttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctcaat
GQ325776_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF083634_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF134138_S_P-A      ttgttgacaagaatcctaacaataccgcagagtctagactcgtggtggacttctctcaat
AF065113_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM282986_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY707087_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
M54898_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF065115_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165741_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606954_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ477475_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP997443_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK840529_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372050_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165818_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439832_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgcggtggacttctctcaat
JF439826_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439824_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439820_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggatttctctcaat
JF439830_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439822_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439825_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439829_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439831_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439828_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653781_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604181_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165697_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165705_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165719_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486669_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486725_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486754_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165638_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165836_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144210_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165837_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849300_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477468_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ709471_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606894_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144201_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctggactcgtggtggacttctctcaat
KP144205_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165694_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165729_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486531_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165646_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN226093_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849595_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862516_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
Z72478_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372053_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165808_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165766_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165755_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165684_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144209_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606913_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606809_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606784_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KJ843184_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771963_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771946_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771920_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707628_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707536_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604269_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604172_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439981_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486856_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486776_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486567_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486529_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486456_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486427_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486101_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ477497_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ477478_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477465_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477462_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859950_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctaaactcgtggtggacttctctcaat
EU594386_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF690529_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF208113_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412496_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653786_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653784_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AJ627226_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF209403_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF134148_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF134147_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF134144_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF134134_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF083639_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF083637_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF061526_S_P-A      ttggtgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB116076_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236104_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN507849_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT630640_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606947_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN107758_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF065111_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF862513_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486710_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AF209404_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
JX849294_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF779333_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
U87730_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU900750_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165763_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165756_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165641_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ586809_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KF771969_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC836779_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859945_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF690534_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF690533_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF690532_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF690531_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ131121_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF369544_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF690530_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC836778_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779262_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT630626_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738821_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779232_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862512_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606952_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707572_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749825_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749826_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749842_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779315_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaaa
AY653794_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594384_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779365_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165744_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165661_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165768_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165712_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165749_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606831_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF369532_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236105_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165752_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707559_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707553_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707558_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606890_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB289727_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB289737_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486751_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604288_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707556_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606828_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606830_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606885_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606936_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606939_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606948_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606956_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606962_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606963_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606965_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606966_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606970_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606972_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165652_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165662_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165728_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165811_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606949_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606945_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KF779272_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ459086_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412522_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB205118_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486721_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF083638_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF132442_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707545_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
JQ707531_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707561_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707540_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707533_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707542_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707535_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707539_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707538_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697506_S_P-A      ttgttgacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
JQ707543_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707569_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707554_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707571_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486062_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP997676_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606938_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477499_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ184323_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggactttcttccat
KP165835_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165633_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606873_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779257_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779317_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779286_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779290_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779291_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779294_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779287_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779320_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779321_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604197_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809492_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606881_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372041_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165757_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606774_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412513_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412515_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779279_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
Z35717_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF143302_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ788728_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779210_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779211_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862514_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809538_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809533_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
X70185_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY886219_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372099_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749833_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP997677_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP995108_S_P-A      ttgttgacaagaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
KP165824_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165750_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165742_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KP165672_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165667_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165620_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606921_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606903_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606889_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606888_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606820_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606783_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606775_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843172_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779370_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779311_S_P-A      ttgttgacaagaatcctcacaataccgcagagtatagactcgtggtggacttctctcaat
KF779295_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779284_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaac
KF779268_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779263_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaac
KF779252_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaag
KF771965_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771958_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771940_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849319_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
JQ911742_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707550_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707547_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgttgtggacttctctcaat
JQ707532_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ687533_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604266_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604159_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486646_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486642_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486611_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486598_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486583_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486544_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486510_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486425_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486424_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486421_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486119_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486063_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477498_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477491_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477488_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477484_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477472_S_P-A      ttgttaacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
GQ184324_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ709472_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859939_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859938_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
EU859900_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU747320_S_P-A      ttgttgacaagaatcctcacaataccgcagattctagactcgtggtggaattctctcaat
DQ412527_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412508_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412502_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ131125_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF143298_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF061525_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697511_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB549213_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB480040_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB453983_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB289694_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB289693_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB116077_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MG839208_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604183_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AB453984_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486197_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KP997726_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779280_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779274_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779271_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779281_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779253_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY862867_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY862868_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486631_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604173_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779256_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606802_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF129506_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113382_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113384_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113385_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113398_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113401_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113402_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113403_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113404_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113405_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113406_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113407_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113408_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC113409_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
V00866_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707549_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606871_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606896_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MG383617_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594385_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779249_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779270_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779273_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779275_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779282_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779305_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779306_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779307_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779308_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779309_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779371_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779372_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779381_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779383_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606773_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779283_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779276_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486474_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779239_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779269_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779344_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779345_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779348_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779349_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779356_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779374_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439753_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439762_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749832_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412535_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412505_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412533_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606876_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF132443_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF209395_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB362931_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809537_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862509_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809897_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165660_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606969_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606791_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779324_S_P-A      ttgttgacaagaatcctcacaataacgcagagtctagactcgtggtggacttctctcaat
KF779322_S_P-A      ttgttgacaagaatcctcacaataacgcagagtctagactcgtggtggacttctctcaat
JN604242_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486549_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477482_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718102_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477466_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ222207_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859947_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859944_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594387_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ788725_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653787_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY653785_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AJ627228_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AB014370_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606792_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB480036_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707615_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707627_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707633_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707636_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779221_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779316_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843188_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606879_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809884_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809891_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN758681_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606940_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707564_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653791_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707634_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847746_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606899_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779231_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX310730_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372060_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372063_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707552_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707548_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486834_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412548_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653793_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB064314_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412528_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU563553_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU563557_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707544_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885580_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606870_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606875_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606942_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165639_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165683_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165722_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MT426096_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236107_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236108_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738818_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606811_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738819_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809471_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477487_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604268_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486514_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486360_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809482_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU414103_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU414133_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK127847_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849308_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP997697_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779336_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaac
AB126580_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295533_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606874_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165780_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165806_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707562_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM467774_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486603_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486747_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697488_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697489_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697501_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697512_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809541_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412556_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU086721_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU159676_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849296_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779240_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862510_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862511_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606713_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606893_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606920_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165630_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372039_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC311241_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC311242_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH932713_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165640_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165727_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165815_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165670_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486426_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486616_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486408_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165720_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412516_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412517_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY697846_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862505_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486683_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809487_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412557_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885883_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843182_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843186_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843218_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY697845_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB289692_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809490_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
U87732_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MT426097_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY660215_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX827298_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372091_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372079_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372077_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372068_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372064_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372044_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847715_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP997666_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718100_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165823_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165822_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165821_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165814_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165809_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165800_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165791_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165786_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165774_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165698_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165690_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165680_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165711_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165666_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165623_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP144200_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM983577_S_P-A      ttgttgacaagaatcctcacaataccgcaaagtctagactcgtggtggacttctctcaat
KM606910_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606849_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606847_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606826_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749831_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606804_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606789_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606770_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606704_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843216_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779379_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779329_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779323_S_P-A      ttgttgacaagaatcctcacaataacgcagagtctagactcgtggtggacttctctcaat
KF779319_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779266_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779259_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779386_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779254_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771922_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF476015_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF475983_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849299_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX310722_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372047_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX125367_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX096952_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707635_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707616_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707614_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707573_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707563_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707557_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707551_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707560_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707570_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707541_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707321_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604293_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372035_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604270_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604214_S_P-A      ttgttgacaagaatcctcacaataccgcagagtcyagactcgtggtggacttctctcaat
JN604185_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486712_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486599_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486597_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486587_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486564_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486479_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165632_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165708_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165759_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165762_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486478_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486445_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486417_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849321_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486410_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477486_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ709470_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165664_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859953_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859921_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859907_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594391_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594383_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
U91824_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412545_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412547_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412523_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412514_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653798_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653796_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ477479_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY128092_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
J02205_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606843_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
X02763_S_C-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF209400_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF090839_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF090840_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC875260_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF083636_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB937798_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697492_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697487_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB480041_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB453982_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB300367_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB289706_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606906_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606907_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606908_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809895_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779213_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779215_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB116078_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB116079_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB116080_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB116081_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB222742_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB246337_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB246338_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB289704_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB289711_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB300366_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB453979_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB453980_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB453981_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB480038_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB480039_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697491_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697495_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697496_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697497_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697498_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697499_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697503_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697504_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697505_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697507_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697508_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB697509_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB775198_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB775199_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB775200_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB775201_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809476_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809478_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809480_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809483_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809489_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809491_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809493_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809532_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809542_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB809543_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB937792_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB937793_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB937794_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF043580_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF297624_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AF363663_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AJ012207_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM295795_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM295796_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AM295797_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653799_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653800_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653801_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY653803_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738822_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236103_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ236110_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412466_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412482_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412494_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412498_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412499_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412500_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412503_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412506_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412507_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412509_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412510_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412512_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412518_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412521_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412524_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412525_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412526_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412530_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412539_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412544_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412546_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412549_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412553_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412554_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412555_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU414102_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU414132_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594388_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594389_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594390_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594392_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594393_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594394_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU594395_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859898_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859899_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859901_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859902_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859903_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859904_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859905_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859906_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859908_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859909_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859910_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859911_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859912_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859913_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859914_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859915_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859916_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859917_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859918_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859919_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859920_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859922_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859923_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859924_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859925_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859926_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859927_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859928_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859929_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859930_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859931_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859932_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859933_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859935_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859936_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859937_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859940_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859941_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859942_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859943_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859946_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859948_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EU859949_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ349222_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ349224_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295530_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295531_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295532_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ414522_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477461_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477467_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ477503_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486312_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486409_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486438_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486439_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486461_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486469_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486482_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486490_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486550_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486568_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486580_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486601_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486615_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486663_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486727_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU563546_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU563554_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU563555_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU563558_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GU563562_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439752_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439754_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439755_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439756_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439757_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439758_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439759_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439760_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439761_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439763_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439764_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439765_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JF439766_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604158_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604164_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604178_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604180_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604184_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604191_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604200_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604204_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604216_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604228_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604247_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604257_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604262_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604273_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604276_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604279_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604283_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604291_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604292_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604294_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604297_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604300_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604303_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604304_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604315_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ687529_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707534_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707546_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707555_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707565_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707566_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707567_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707568_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707609_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707610_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707611_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707612_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707613_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707617_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707618_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707619_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707620_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707621_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707622_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707623_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707624_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707625_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707626_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707629_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707630_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707631_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707632_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ707637_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX096953_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX310721_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX310724_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX310725_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX310731_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX310732_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849295_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849313_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885570_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885581_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885582_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885591_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885689_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885788_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885834_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885841_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KC885870_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF414678_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771918_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771952_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF771955_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779227_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779238_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779243_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779244_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779245_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779246_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779247_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779248_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779251_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779255_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779258_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779277_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779297_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779299_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779304_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779310_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779313_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779314_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779325_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779326_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779328_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779330_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779334_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779335_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779338_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779339_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779342_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779346_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779347_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779350_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779352_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779355_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779360_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779362_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779363_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779364_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779366_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779368_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779369_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779373_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779378_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF779385_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862506_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862507_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862508_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843166_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843173_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843192_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843214_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843215_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ843217_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ854708_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ854709_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KJ854710_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606742_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606746_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606749_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606782_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606798_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606805_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606806_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606807_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606813_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606845_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606846_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606858_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606863_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606865_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606866_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606877_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606878_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606880_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606882_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606911_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606926_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165621_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165627_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165628_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165631_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165642_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165649_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165650_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165673_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165677_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165678_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165679_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165681_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165682_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165688_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165691_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165695_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165696_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165709_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165710_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165714_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165718_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165730_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165731_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165736_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165737_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165739_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165745_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165747_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165748_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165754_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165765_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165767_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165775_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165784_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165801_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP244022_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP274925_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP274927_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP274928_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718087_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718088_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718090_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718091_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718092_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718093_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718094_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718095_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718096_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718097_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718098_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718099_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP718101_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP997618_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP997619_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749824_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749829_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749830_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749835_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749836_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749837_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749838_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749840_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749843_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749844_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT749850_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU605532_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU900752_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372032_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372033_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372034_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372036_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372037_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372038_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372040_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372042_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372045_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372046_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372051_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372055_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372059_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372061_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372062_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372067_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372070_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372072_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372075_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372076_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372078_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372080_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372082_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372087_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX372094_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX520676_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY003230_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY697842_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809892_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809911_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809929_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
L13994_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC074724_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC311243_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC430617_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC458430_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC458431_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC517161_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC592168_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC592169_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
LC592170_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MG383613_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK127849_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK127855_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK127857_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN758696_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MT426093_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MT426094_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MT426095_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
OK106253_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
U87725_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
U91820_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486454_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847668_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847714_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY697833_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847591_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KU847547_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847678_S_P-A      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847679_S_P-A      ttgttgacaaaaatcctcayaataccgcagagtctagactcgtggtggacttctctcaat
KU847505_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KU847737_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847676_S_P-A      ttgttgacaagaatcctaacaataccgcagagtctagactcgtggtggacttctctcaat
KR816115_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK484595_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847680_S_P-A      ttgttgacaaaaatcctcacaataccgcagaatctagactcgtggtggacttctctcagt
KU847545_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactygtggtggacttctctcart
KX372028_S_P-A      tkgttgacaaraatcctcacaatacctcagagtctagactcgtggtggacttctctcaat
KU847601_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847483_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847577_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847544_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactygtkgtggacttctctcart
KU847660_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847661_S_P-A      tygttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847530_S_P-A      ttgttgacaagaatcctmacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486775_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847649_S_P-A      ttgttgacaagaatcctcacaataccgcagaatctagactcgtggtggacttctctcagt
KU847719_S_P-A      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847506_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY271385_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983891_S_P-A      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983879_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847534_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847681_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983861_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983853_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486838_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KX276769_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KU847659_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847634_S_P-A      ttgttgacaaaaatccgcacaataccgcagagtctagacttgtggtggacttctctcart
KT630630_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggttgacttctctcaat
JN983849_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF547855_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412468_S_P-A      ttgttgacaaraatcctcacaataccrcagagtctagactcgtggtggacttctctcart
KU847473_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604150_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847677_S_P-A      ttgttgacaagaatcctcacaataccgcagartctagactcgtggtggacttctctcaat
KM590921_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK948385_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847632_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412467_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165825_S_P-A      ttgttaacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165826_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN758711_S_P-A      ttgttgacaagaatcctcacaatrccgcagagtctagamtcgtggtggacttctctcaat
KF862521_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MT210034_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK975862_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847696_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847658_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtrgacttctctcaat
FJ692558_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847570_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FN295511_S_P-A      tggttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983886_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MH272596_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165820_S_P-A      ttgttaacaagaatcctcgcaataccgcagagtctagactcgtggtggacttctctcaat
KP165704_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412474_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcaat
U87735_S_P-A        ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847732_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847685_S_P-A      ttgttgacargaatcctcmcaataccgcagagtctagactcgtggtggacttctctcaat
JN983868_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165831_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165834_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847738_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604128_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK512462_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK177883_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809899_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KU900751_S_P-A      ttgttgacaagtatcctcacaatacctcagagtctagactcgtggtggacttctctcaat
KU847587_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983845_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604251_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
M21030_S_P-A        ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
X04820_S_P-A        ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
GQ486772_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ665816_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847692_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847664_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847630_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcart
KU847604_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847575_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847533_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847511_S_P-A      ttgttgacaagaatcctcacaataccgcagaktctagactcgtggtggacttctctcaat
KT151612_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT151617_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KP165647_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggttgacttctctcagt
JN983839_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692570_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
DQ412471_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB453988_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
MN758680_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847641_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KM606765_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
AY934772_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MK127860_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809910_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847617_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983867_S_P-A      ttgttgacaagaatccgcataataccgcagagtctagactcgtggtggacttctctcagt
HQ185229_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486130_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactygtggtggacttctctcaat
KU847644_S_P-A      ttgttaacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN758709_S_P-A      ttgttgacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctcaat
KU847699_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KU847567_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcaat
JQ514386_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
EF690535_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
DQ412483_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809881_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847767_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcaat
KU847749_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983903_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983873_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486535_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809894_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggttgacttctctcaat
KX357646_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847666_S_P-A      ttgttgacaagaatcctcacaataccgcagaatctagactcgtggtggacttctctcaat
KU847646_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847631_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847609_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847557_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847554_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactygtggtggacttctctcaat
KM606928_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ514385_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ514286_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983898_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983859_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN604241_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM101113_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
HM011485_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AY738804_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
AB246336_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JX849301_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KF862520_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983881_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KT630642_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggttgacttctctcagt
AB116084_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ514284_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809901_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809889_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847702_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847481_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
GQ486194_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB786655_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
AB786656_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcaat
KU847486_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
FJ692572_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809933_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN758718_S_P-A      ttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
MN758700_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809912_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KY809904_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KY809903_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU900754_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847713_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847705_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847691_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctcaat
KU847673_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847654_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
KU847615_S_P-A      ttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaat
KU847595_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847588_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847584_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847583_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847527_S_P-A      ttgttgacaagaatcctcacaataccgcagartctagactcgtggtggacttctctcaat
KU847508_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KU847494_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
KM606904_S_P-A      ttgttgacaagaatcctcataataccgcagagtctagactcgtggtggacttctctcaat
KJ854701_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JQ514289_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983893_S_P-A      ttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaat
JN983847_S_P-A      tcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagt
GQ486287_S_P-A      tt