HBVdb

Dataset for nucleotide sequence S of genotype A

[Download (right click)] [Alignment] [Repertoires]

3537 sequence(s)

>gnl|hbvcds|AB014370_S_P-A Feature FT:CDS AB014370_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB030513_S_P-A Feature FT:CDS AB030513_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBNP7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB064314_S_P-A Feature FT:CDS AB064314_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgggtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB076678_S_P-A Feature FT:CDS AB076678_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076679_S_P-A Feature FT:CDS AB076679_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggttccacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076680_S_P-A Feature FT:CDS AB076680_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacaactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076681_S_P-A Feature FT:CDS AB076681_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076682_S_P-A Feature FT:CDS AB076682_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala22). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076683_S_P-A Feature FT:CDS AB076683_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala23). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcagggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076685_S_P-A Feature FT:CDS AB076685_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala30). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccwgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagagggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattgcaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggcttty
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076686_S_P-A Feature FT:CDS AB076686_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076687_S_P-A Feature FT:CDS AB076687_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagaatctagacttgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcagcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076688_S_P-A Feature FT:CDS AB076688_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076689_S_P-A Feature FT:CDS AB076689_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB076690_S_P-A Feature FT:CDS AB076690_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116076_S_P-A Feature FT:CDS AB116076_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA1911). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgc
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116077_S_P-A Feature FT:CDS AB116077_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA2126). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcatgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgtttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116078_S_P-A Feature FT:CDS AB116078_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116079_S_P-A Feature FT:CDS AB116079_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116080_S_P-A Feature FT:CDS AB116080_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116081_S_P-A Feature FT:CDS AB116081_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB116082_S_P-A Feature FT:CDS AB116082_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggcgaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116083_S_P-A Feature FT:CDS AB116083_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgagtcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116084_S_P-A Feature FT:CDS AB116084_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN81). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116085_S_P-A Feature FT:CDS AB116085_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN83). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggntcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaaccttctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccttgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagttattcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116086_S_P-A Feature FT:CDS AB116086_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggcgaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116087_S_P-A Feature FT:CDS AB116087_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116088_S_P-A Feature FT:CDS AB116088_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgggtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggttctgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB116089_S_P-A Feature FT:CDS AB116089_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcgaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccacgtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116090_S_P-A Feature FT:CDS AB116090_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP40). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116091_S_P-A Feature FT:CDS AB116091_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcntggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaacctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116092_S_P-A Feature FT:CDS AB116092_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaagggaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttggggtttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttgtctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttacac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116093_S_P-A Feature FT:CDS AB116093_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcntggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB116094_S_P-A Feature FT:CDS AB116094_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaacctgcagaacctgcacgactcctgctcaaggcaactctacgt
ttccctcatgttgctgtacaaaacctacgggtggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgcttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB126580_S_P-A Feature FT:CDS AB126580_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaatccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB194950_S_P-A Feature FT:CDS AB194950_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR983). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB194951_S_P-A Feature FT:CDS AB194951_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttggctttgggcatacatttaa
>gnl|hbvcds|AB194952_S_P-A Feature FT:CDS AB194952_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR711). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB194953_S_P-A Feature FT:CDS AB194953_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR991). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacagaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatt
>gnl|hbvcds|AB205118_S_P-A Feature FT:CDS AB205118_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TJ1-1-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaccaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB222707_S_P-A Feature FT:CDS AB222707_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate UZTBV102). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|AB222742_S_P-A Feature FT:CDS AB222742_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IF722). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB241114_S_P-A Feature FT:CDS AB241114_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB241115_S_P-A Feature FT:CDS AB241115_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246317_S_P-A Feature FT:CDS AB246317_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate TA112). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacaactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgactccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246335_S_P-A Feature FT:CDS AB246335_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246336_S_P-A Feature FT:CDS AB246336_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgtctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB246337_S_P-A Feature FT:CDS AB246337_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB246338_S_P-A Feature FT:CDS AB246338_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB263406_S_P-A Feature FT:CDS AB263406_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MonB04-023E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaactacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB289692_S_P-A Feature FT:CDS AB289692_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacaactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB289693_S_P-A Feature FT:CDS AB289693_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagattactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaatccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB289694_S_P-A Feature FT:CDS AB289694_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtanggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggncaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB289704_S_P-A Feature FT:CDS AB289704_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB289706_S_P-A Feature FT:CDS AB289706_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtatggggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB289711_S_P-A Feature FT:CDS AB289711_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 20). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB289727_S_P-A Feature FT:CDS AB289727_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 36). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtatggggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB289737_S_P-A Feature FT:CDS AB289737_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 46). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtatggggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB300366_S_P-A Feature FT:CDS AB300366_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB300367_S_P-A Feature FT:CDS AB300367_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB362931_S_P-A Feature FT:CDS AB362931_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453979_S_P-A Feature FT:CDS AB453979_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453980_S_P-A Feature FT:CDS AB453980_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453981_S_P-A Feature FT:CDS AB453981_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453982_S_P-A Feature FT:CDS AB453982_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453983_S_P-A Feature FT:CDS AB453983_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggcgaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453984_S_P-A Feature FT:CDS AB453984_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB453986_S_P-A Feature FT:CDS AB453986_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB453987_S_P-A Feature FT:CDS AB453987_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB453988_S_P-A Feature FT:CDS AB453988_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtactgggggcaaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB453989_S_P-A Feature FT:CDS AB453989_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagagggggccaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB480036_S_P-A Feature FT:CDS AB480036_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB480038_S_P-A Feature FT:CDS AB480038_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB480039_S_P-A Feature FT:CDS AB480039_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB480040_S_P-A Feature FT:CDS AB480040_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB480041_S_P-A Feature FT:CDS AB480041_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcatgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB549213_S_P-A Feature FT:CDS AB549213_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|AB697487_S_P-A Feature FT:CDS AB697487_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaatttcaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697488_S_P-A Feature FT:CDS AB697488_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697489_S_P-A Feature FT:CDS AB697489_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697491_S_P-A Feature FT:CDS AB697491_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697492_S_P-A Feature FT:CDS AB697492_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697493_S_P-A Feature FT:CDS AB697493_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697495_S_P-A Feature FT:CDS AB697495_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697496_S_P-A Feature FT:CDS AB697496_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697497_S_P-A Feature FT:CDS AB697497_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697498_S_P-A Feature FT:CDS AB697498_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697499_S_P-A Feature FT:CDS AB697499_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697501_S_P-A Feature FT:CDS AB697501_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697503_S_P-A Feature FT:CDS AB697503_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697504_S_P-A Feature FT:CDS AB697504_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No23). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697505_S_P-A Feature FT:CDS AB697505_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697506_S_P-A Feature FT:CDS AB697506_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697507_S_P-A Feature FT:CDS AB697507_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697508_S_P-A Feature FT:CDS AB697508_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697509_S_P-A Feature FT:CDS AB697509_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697511_S_P-A Feature FT:CDS AB697511_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No36). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttrtcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
taccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB697512_S_P-A Feature FT:CDS AB697512_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB775198_S_P-A Feature FT:CDS AB775198_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0707). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB775199_S_P-A Feature FT:CDS AB775199_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB775200_S_P-A Feature FT:CDS AB775200_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB775201_S_P-A Feature FT:CDS AB775201_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB786643_S_P-A Feature FT:CDS AB786643_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20401). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786645_S_P-A Feature FT:CDS AB786645_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20403). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786646_S_P-A Feature FT:CDS AB786646_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20404). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786647_S_P-A Feature FT:CDS AB786647_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20405). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786648_S_P-A Feature FT:CDS AB786648_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20406). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786649_S_P-A Feature FT:CDS AB786649_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20407). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786651_S_P-A Feature FT:CDS AB786651_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20409). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacttttaa
>gnl|hbvcds|AB786652_S_P-A Feature FT:CDS AB786652_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20410). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786654_S_P-A Feature FT:CDS AB786654_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20412). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786655_S_P-A Feature FT:CDS AB786655_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20413). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786656_S_P-A Feature FT:CDS AB786656_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20417). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagacttgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786657_S_P-A Feature FT:CDS AB786657_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20419). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786658_S_P-A Feature FT:CDS AB786658_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20420). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786659_S_P-A Feature FT:CDS AB786659_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20421). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786660_S_P-A Feature FT:CDS AB786660_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20422). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggcgaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacattaaa
>gnl|hbvcds|AB786661_S_P-A Feature FT:CDS AB786661_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20425). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccagccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786662_S_P-A Feature FT:CDS AB786662_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20427). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB786663_S_P-A Feature FT:CDS AB786663_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KE20429). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaattcgc
agttcccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB809471_S_P-A Feature FT:CDS AB809471_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaagccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809476_S_P-A Feature FT:CDS AB809476_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H128). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809477_S_P-A Feature FT:CDS AB809477_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate R41). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgttcaacaccttgaggccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809478_S_P-A Feature FT:CDS AB809478_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H129). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809479_S_P-A Feature FT:CDS AB809479_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H185). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctgattccaggatcgacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809480_S_P-A Feature FT:CDS AB809480_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate K1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809481_S_P-A Feature FT:CDS AB809481_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate K2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatgtgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacttgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809482_S_P-A Feature FT:CDS AB809482_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KW4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809483_S_P-A Feature FT:CDS AB809483_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KW6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809484_S_P-A Feature FT:CDS AB809484_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KW8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggcaaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809485_S_P-A Feature FT:CDS AB809485_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KW12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttccagagggaacacccgcgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809486_S_P-A Feature FT:CDS AB809486_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate KW14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809487_S_P-A Feature FT:CDS AB809487_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M2). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgtaacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809489_S_P-A Feature FT:CDS AB809489_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809490_S_P-A Feature FT:CDS AB809490_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacaactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809491_S_P-A Feature FT:CDS AB809491_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809492_S_P-A Feature FT:CDS AB809492_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcagccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809493_S_P-A Feature FT:CDS AB809493_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate R25). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809532_S_P-A Feature FT:CDS AB809532_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Okayama1-S-2007). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809533_S_P-A Feature FT:CDS AB809533_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Okayama2-S-2007). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattctctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809534_S_P-A Feature FT:CDS AB809534_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Okayama3-S-2007). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggcttttagctatatggatgatgtggtactgggggcaaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809537_S_P-A Feature FT:CDS AB809537_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Osaka1-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809538_S_P-A Feature FT:CDS AB809538_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Osaka2-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809541_S_P-A Feature FT:CDS AB809541_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Tottori-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809542_S_P-A Feature FT:CDS AB809542_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Fukuoka-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB809543_S_P-A Feature FT:CDS AB809543_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Osaka5-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatt
>gnl|hbvcds|AB937791_S_P-A Feature FT:CDS AB937791_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB937792_S_P-A Feature FT:CDS AB937792_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB937793_S_P-A Feature FT:CDS AB937793_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB937794_S_P-A Feature FT:CDS AB937794_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB937795_S_P-A Feature FT:CDS AB937795_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctamttccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatrt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB937796_S_P-A Feature FT:CDS AB937796_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB937797_S_P-A Feature FT:CDS AB937797_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1204). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcagggttcctaggaccccggctcgtgttacaggcggggttttycttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcyaatttgtcytggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgccgctatgcctcatcttcttattggttcttctggattatcaaggtatattgcccgtttg
tcctctaattccaggatcaacakcaaacartacgggasgrtgcaaaayctgcacgaytcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatattgtattgggggccaaatctgtacagcatcgtgagtccctttatac
tgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB937798_S_P-A Feature FT:CDS AB937798_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcgaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF043560_S_P-A Feature FT:CDS AF043560_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF043580_S_P-A Feature FT:CDS AF043580_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF061525_S_P-A Feature FT:CDS AF061525_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate tl647). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|AF061526_S_P-A Feature FT:CDS AF061526_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate wp2380). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttggtgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF065111_S_P-A Feature FT:CDS AF065111_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate sn387). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattctaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF065113_S_P-A Feature FT:CDS AF065113_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate sn1288). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF065114_S_P-A Feature FT:CDS AF065114_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate sn2882). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgcgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF065115_S_P-A Feature FT:CDS AF065115_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate sn4222). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF065116_S_P-A Feature FT:CDS AF065116_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate sn4651). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcngcgtttt
atcatatccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcraggcaactctatgt
ctccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF083634_S_P-A Feature FT:CDS AF083634_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 1-1991). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctaagt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF083635_S_P-A Feature FT:CDS AF083635_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 1-1996). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctaagt
ttccctcatgttgctgtacaaaacctacggctggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF083636_S_P-A Feature FT:CDS AF083636_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 2-1987). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaatttccttttgtctctgggtatacatttaa
>gnl|hbvcds|AF083637_S_P-A Feature FT:CDS AF083637_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 2-1992). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtatattgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaatttccttttgtctctgggtatacatttaa
>gnl|hbvcds|AF083638_S_P-A Feature FT:CDS AF083638_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 3-1987). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaaccaccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF083639_S_P-A Feature FT:CDS AF083639_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient 3-1995). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactaatgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttttac
cgctgttaccaattttcctttgtctctgggtatacatttaa
>gnl|hbvcds|AF090838_S_P-A Feature FT:CDS AF090838_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090839_S_P-A Feature FT:CDS AF090839_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090840_S_P-A Feature FT:CDS AF090840_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090841_S_P-A Feature FT:CDS AF090841_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF090842_S_P-A Feature FT:CDS AF090842_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttatac
cggtgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF129506_S_P-A Feature FT:CDS AF129506_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctaagt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggtgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF132442_S_P-A Feature FT:CDS AF132442_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF132443_S_P-A Feature FT:CDS AF132443_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134134_S_P-A Feature FT:CDS AF134134_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgcttgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatagaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134138_S_P-A Feature FT:CDS AF134138_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctaac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134143_S_P-A Feature FT:CDS AF134143_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctattcaccctgctgctatgcctcatattcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccttcatgttgctgtacaaaacctacggctggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134144_S_P-A Feature FT:CDS AF134144_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctacgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134145_S_P-A Feature FT:CDS AF134145_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcgaaacaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggtctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF134147_S_P-A Feature FT:CDS AF134147_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtttacatttaa
>gnl|hbvcds|AF134148_S_P-A Feature FT:CDS AF134148_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaagggaactctatgt
ttccctcatgttgctgtacaaaacctacggatgggaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF143298_S_P-A Feature FT:CDS AF143298_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
tgccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF143302_S_P-A Feature FT:CDS AF143302_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF208866_S_P-A Feature FT:CDS AF208866_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CP595). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctatacttccaggatcaacaacaaccagtacgggaccatgcaaaacttgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF208873_S_P-A Feature FT:CDS AF208873_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate pal3660). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctacatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttcgccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatggattacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccttcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggcctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttacctattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF208875_S_P-A Feature FT:CDS AF208875_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate pal4783). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcatatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaaaatcaacaacaaccagtacgggatcatgcagaacctgcacgcttcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccagtgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF209392_S_P-A Feature FT:CDS AF209392_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate as9419). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgccggtgttacaggcggggtttttcttgttgacaagaatccacac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
gatccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattctaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcactttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagttcctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF209395_S_P-A Feature FT:CDS AF209395_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate fh013). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaacatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF209397_S_P-A Feature FT:CDS AF209397_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate jv1802). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaagttcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF209399_S_P-A Feature FT:CDS AF209399_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate mh5274). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF209400_S_P-A Feature FT:CDS AF209400_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate on019). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF209403_S_P-A Feature FT:CDS AF209403_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate sd4767). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF209404_S_P-A Feature FT:CDS AF209404_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate tm7463). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaatccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF209405_S_P-A Feature FT:CDS AF209405_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ui004). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggaaactctatgt
ttccctcatgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF297621_S_P-A Feature FT:CDS AF297621_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagttccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cactgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF297622_S_P-A Feature FT:CDS AF297622_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 79). Complete genome. [Hepadnaviridae] (length=681 residues).
atagagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttagtagggatttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF297623_S_P-A Feature FT:CDS AF297623_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 83). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF297624_S_P-A Feature FT:CDS AF297624_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 80). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF297625_S_P-A Feature FT:CDS AF297625_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 84). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtacccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF363663_S_P-A Feature FT:CDS AF363663_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX4c). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF369532_S_P-A Feature FT:CDS AF369532_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX9c). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttctgttgtctctgggtatacatt
>gnl|hbvcds|AF369544_S_P-A Feature FT:CDS AF369544_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX515). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF536524_S_P-A Feature FT:CDS AF536524_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtattcatttaa
>gnl|hbvcds|AF537371_S_P-A Feature FT:CDS AF537371_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacggaaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF537372_S_P-A Feature FT:CDS AF537372_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgagaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaatgccaggatcaacgacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ012207_S_P-A Feature FT:CDS AJ012207_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ309369_S_P-A Feature FT:CDS AJ309369_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctaggctcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccggtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ309370_S_P-A Feature FT:CDS AJ309370_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
accatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ309371_S_P-A Feature FT:CDS AJ309371_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ344115_S_P-A Feature FT:CDS AJ344115_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctcaaactacaagatcaacaacaaccagtacgggatcatgcaaaacctgcacgattcctgctcgcggcaaatctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaagc
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ627226_S_P-A Feature FT:CDS AJ627226_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20952). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ627227_S_P-A Feature FT:CDS AJ627227_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcat
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaycaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggwccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagytatatggatgatgtggtmttggggaccagatctgtacagcatcgtgaggccctttwtac
cgctgttaccaattttcttttgtctctgggtatacatataa
>gnl|hbvcds|AJ627228_S_P-A Feature FT:CDS AJ627228_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 34408). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM180624_S_P-A Feature FT:CDS AM180624_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcarggtatgttgcycgtttg
tcctctaattccaggatccamaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AM184125_S_P-A Feature FT:CDS AM184125_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AM184126_S_P-A Feature FT:CDS AM184126_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AM282986_S_P-A Feature FT:CDS AM282986_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295795_S_P-A Feature FT:CDS AM295795_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295796_S_P-A Feature FT:CDS AM295796_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295797_S_P-A Feature FT:CDS AM295797_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295798_S_P-A Feature FT:CDS AM295798_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM295799_S_P-A Feature FT:CDS AM295799_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM410963_S_P-A Feature FT:CDS AM410963_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM494718_S_P-A Feature FT:CDS AM494718_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAR204). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggrgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY034878_S_P-A Feature FT:CDS AY034878_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVKL). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatattgatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY128092_S_P-A Feature FT:CDS AY128092_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY152726_S_P-A Feature FT:CDS AY152726_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctagaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaatgccaggatcaacaacaacaagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgt
tgccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgaggccctttatac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY161138_S_P-A Feature FT:CDS AY161138_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=684 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctggtgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgctcgt
ttgtcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactcta
tgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgca
aaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggct
ttcccccactgtttggctttcagctatgtggatgatctggtactgggggccaagtctgtacaacatcttgagtcccttta
taccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161139_S_P-A Feature FT:CDS AY161139_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatctggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161142_S_P-A Feature FT:CDS AY161142_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161143_S_P-A Feature FT:CDS AY161143_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggaggacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY161144_S_P-A Feature FT:CDS AY161144_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggaggacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY168427_S_P-A Feature FT:CDS AY168427_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ST21). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY230117_S_P-A Feature FT:CDS AY230117_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcctgtttg
tcctctaattccaggatcaacaactaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaaatctgtgcaacatcgtgaggccctttatac
cgctgttatcaattttctgttgtctctgggtatacatttaa
>gnl|hbvcds|AY230118_S_P-A Feature FT:CDS AY230118_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY232836_S_P-A Feature FT:CDS AY232836_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacgaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|AY232837_S_P-A Feature FT:CDS AY232837_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcactggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggaatatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatttggtattgggggccaaatctgttcagcatcgcgaggccctgtatac
cgctgttaccaattttcttatgtccctgggtatacatttaa
>gnl|hbvcds|AY232838_S_P-A Feature FT:CDS AY232838_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacgaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|AY232839_S_P-A Feature FT:CDS AY232839_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgtgtccctttacac
cgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|AY232840_S_P-A Feature FT:CDS AY232840_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttacac
cgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|AY233274_S_P-A Feature FT:CDS AY233274_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaatttcctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233275_S_P-A Feature FT:CDS AY233275_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatctacaacaacgagtacgggaccttgcaagacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233276_S_P-A Feature FT:CDS AY233276_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1839). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233278_S_P-A Feature FT:CDS AY233278_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233279_S_P-A Feature FT:CDS AY233279_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctagggcccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233280_S_P-A Feature FT:CDS AY233280_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgcgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY233281_S_P-A Feature FT:CDS AY233281_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatctacaacaacgagtacgggaccttgcaagacctgcacgactcctgctcaaaacaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233282_S_P-A Feature FT:CDS AY233282_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 306). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
gtcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatattgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233283_S_P-A Feature FT:CDS AY233283_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4038). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233284_S_P-A Feature FT:CDS AY233284_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5283). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatctacaacaacgagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233285_S_P-A Feature FT:CDS AY233285_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccccgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233286_S_P-A Feature FT:CDS AY233286_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 818). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacaacaaccagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaacacctacggatggaaattgcacctgtattcccatcccatcgtcctggactttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccgctgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY233287_S_P-A Feature FT:CDS AY233287_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8225). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcccgtcctccaatttgtcctggttatcgcgggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggtctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgcttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233288_S_P-A Feature FT:CDS AY233288_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 823). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233289_S_P-A Feature FT:CDS AY233289_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctactgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY233290_S_P-A Feature FT:CDS AY233290_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagacttgtggtggacttctctcaattttccagggggcccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccaccatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY303900_S_P-A Feature FT:CDS AY303900_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Q470). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakcwcccgtgtgtcttggccaaaattygc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggaytatcaaggtatgttgcccgtttg
tcctctaattccaggatccwcaaccaccagtacgggaccctgcagaacctgcacgactcytgctcaaggmamctctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacytgtattcccatcccatcatcmtgggctttcgsaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgymgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccmattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY311374_S_P-A Feature FT:CDS AY311374_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BD10111). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY373428_S_P-A Feature FT:CDS AY373428_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttacttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY373429_S_P-A Feature FT:CDS AY373429_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcaggtatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY373432_S_P-A Feature FT:CDS AY373432_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY576429_S_P-A Feature FT:CDS AY576429_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FM). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttcttgggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653775_S_P-A Feature FT:CDS AY653775_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 308-02). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggtccacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaaccatatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653776_S_P-A Feature FT:CDS AY653776_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4451-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgttgtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggcactttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653777_S_P-A Feature FT:CDS AY653777_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5424-89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccaagcaaaacctgcacgactcctgctcaaggcaactctatga
gtccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653778_S_P-A Feature FT:CDS AY653778_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 307-00). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaatccctttatac
cgctgtcaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|AY653779_S_P-A Feature FT:CDS AY653779_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1902-98). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653780_S_P-A Feature FT:CDS AY653780_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4410-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY653781_S_P-A Feature FT:CDS AY653781_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4599-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaatgccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgt
taccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653784_S_P-A Feature FT:CDS AY653784_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3788-91). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653785_S_P-A Feature FT:CDS AY653785_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 885-96). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653786_S_P-A Feature FT:CDS AY653786_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3809-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaagcaactctatgt
ttcactcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtccggggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653787_S_P-A Feature FT:CDS AY653787_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4505-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653788_S_P-A Feature FT:CDS AY653788_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4520-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653789_S_P-A Feature FT:CDS AY653789_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4507-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtctg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653791_S_P-A Feature FT:CDS AY653791_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4422-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaagcagggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653793_S_P-A Feature FT:CDS AY653793_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2018-00). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653794_S_P-A Feature FT:CDS AY653794_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 116-02). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653796_S_P-A Feature FT:CDS AY653796_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4580-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653798_S_P-A Feature FT:CDS AY653798_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4436-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacagcaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653799_S_P-A Feature FT:CDS AY653799_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4502-97). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653800_S_P-A Feature FT:CDS AY653800_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3803-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653801_S_P-A Feature FT:CDS AY653801_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 3807-91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY653803_S_P-A Feature FT:CDS AY653803_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2017-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY707087_S_P-A Feature FT:CDS AY707087_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-N10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738139_S_P-A Feature FT:CDS AY738139_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacattaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttggccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738140_S_P-A Feature FT:CDS AY738140_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaagtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738141_S_P-A Feature FT:CDS AY738141_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaaatatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738142_S_P-A Feature FT:CDS AY738142_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaagtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggccttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738143_S_P-A Feature FT:CDS AY738143_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacattaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttggccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagttggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738804_S_P-A Feature FT:CDS AY738804_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtcgttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738806_S_P-A Feature FT:CDS AY738806_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738807_S_P-A Feature FT:CDS AY738807_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagctcgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738808_S_P-A Feature FT:CDS AY738808_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacggaaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738809_S_P-A Feature FT:CDS AY738809_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcactactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738810_S_P-A Feature FT:CDS AY738810_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738811_S_P-A Feature FT:CDS AY738811_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggaaccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738812_S_P-A Feature FT:CDS AY738812_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738813_S_P-A Feature FT:CDS AY738813_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738814_S_P-A Feature FT:CDS AY738814_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtccgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738815_S_P-A Feature FT:CDS AY738815_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggagcatgcaaaacctgcacgactactgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacggcatcgtgagtccctttatac
ctctgttgccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738816_S_P-A Feature FT:CDS AY738816_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcacgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtcagtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738817_S_P-A Feature FT:CDS AY738817_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaagtttcttttgtctctgggtaatcatttaa
>gnl|hbvcds|AY738818_S_P-A Feature FT:CDS AY738818_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738819_S_P-A Feature FT:CDS AY738819_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY738820_S_P-A Feature FT:CDS AY738820_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatgcatttaa
>gnl|hbvcds|AY738821_S_P-A Feature FT:CDS AY738821_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738822_S_P-A Feature FT:CDS AY738822_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY862867_S_P-A Feature FT:CDS AY862867_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY862868_S_P-A Feature FT:CDS AY862868_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY902775_S_P-A Feature FT:CDS AY902775_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MTB162). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY903452_S_P-A Feature FT:CDS AY903452_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934763_S_P-A Feature FT:CDS AY934763_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacggggccttgcagaagctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934764_S_P-A Feature FT:CDS AY934764_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtatggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY934765_S_P-A Feature FT:CDS AY934765_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24306). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934766_S_P-A Feature FT:CDS AY934766_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggctcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934767_S_P-A Feature FT:CDS AY934767_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934768_S_P-A Feature FT:CDS AY934768_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtactggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgg
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934769_S_P-A Feature FT:CDS AY934769_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23719). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934770_S_P-A Feature FT:CDS AY934770_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 953642). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934771_S_P-A Feature FT:CDS AY934771_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattrtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934772_S_P-A Feature FT:CDS AY934772_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctgattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934773_S_P-A Feature FT:CDS AY934773_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=681 residues).
atggacaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
rtcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY934774_S_P-A Feature FT:CDS AY934774_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ020002_S_P-A Feature FT:CDS DQ020002_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 380). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ020003_S_P-A Feature FT:CDS DQ020003_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ131121_S_P-A Feature FT:CDS DQ131121_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M-A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctagtacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ131125_S_P-A Feature FT:CDS DQ131125_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ236103_S_P-A Feature FT:CDS DQ236103_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX C03). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ236104_S_P-A Feature FT:CDS DQ236104_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX C04). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggctgggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgctgcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ236105_S_P-A Feature FT:CDS DQ236105_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX C05). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttctgttgtctctgggtatacatttaa
>gnl|hbvcds|DQ236107_S_P-A Feature FT:CDS DQ236107_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX C07). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaactccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ236108_S_P-A Feature FT:CDS DQ236108_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX C08). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaactccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ236110_S_P-A Feature FT:CDS DQ236110_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MEX C10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ298161_S_P-A Feature FT:CDS DQ298161_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatccccac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ298162_S_P-A Feature FT:CDS DQ298162_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcagggctcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcctgtttg
tcctctaattccaggatcaacaactaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccatcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaaatctgtgcaacatcgtgaggccctttatac
cgctgttatcaattttctgttgtctctgggtatacatttaa
>gnl|hbvcds|DQ298163_S_P-A Feature FT:CDS DQ298163_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttacac
cgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|DQ298164_S_P-A Feature FT:CDS DQ298164_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacgaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|DQ298165_S_P-A Feature FT:CDS DQ298165_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacccgcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatttggtattgggggccaagtctgtacagcatcgtgtgtccctttacac
cgctgttacaaattttctgttgtctctgggtattcatttaa
>gnl|hbvcds|DQ299401_S_P-A Feature FT:CDS DQ299401_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FS_2045). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatctaa
>gnl|hbvcds|DQ299404_S_P-A Feature FT:CDS DQ299404_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FS_2298). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagyacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttra
>gnl|hbvcds|DQ315784_S_P-A Feature FT:CDS DQ315784_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI03101). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315785_S_P-A Feature FT:CDS DQ315785_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI0386). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccttgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315786_S_P-A Feature FT:CDS DQ315786_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI057). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412443_S_P-A Feature FT:CDS DQ412443_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S02000403). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgacacctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgaggccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412444_S_P-A Feature FT:CDS DQ412444_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02003093). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagagggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtagaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412445_S_P-A Feature FT:CDS DQ412445_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02003095). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaaaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412446_S_P-A Feature FT:CDS DQ412446_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02003100). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggtccaaccgtgtgtcttggccaaaattcgc
agtmcccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtggctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaacaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgcacaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcaatggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtmttgggggccaagtctgtgcagcatcttgagtccctttacac
cgctgttactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412447_S_P-A Feature FT:CDS DQ412447_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02004203). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattrtcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttggggtttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatctggagtccctttatac
cgctgttacyaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412448_S_P-A Feature FT:CDS DQ412448_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02005644). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaccacccgtgtgtcytggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttacac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412449_S_P-A Feature FT:CDS DQ412449_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02006852). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctctaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggcttccgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggwctttc
ccccactgtttggctttcagytatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412450_S_P-A Feature FT:CDS DQ412450_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02009122). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412451_S_P-A Feature FT:CDS DQ412451_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S02011119). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcgtgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtggggctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtcactttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412452_S_P-A Feature FT:CDS DQ412452_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02012949). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412453_S_P-A Feature FT:CDS DQ412453_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S02012952). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatga
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggcttccgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412454_S_P-A Feature FT:CDS DQ412454_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S02015691). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412455_S_P-A Feature FT:CDS DQ412455_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S02016682). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttcyagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctrgatgtgtctgcggcgtttt
atcatattcctcttcaycctgctgctatgcctcatcttcttattggttcttcaggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaaacaactctatgy
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412456_S_P-A Feature FT:CDS DQ412456_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02022151). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ412457_S_P-A Feature FT:CDS DQ412457_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02023958). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttatwggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcaggggaccctgcaaaacctgcacgactcctgctccaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412458_S_P-A Feature FT:CDS DQ412458_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02023967). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412459_S_P-A Feature FT:CDS DQ412459_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03001127). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412460_S_P-A Feature FT:CDS DQ412460_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03007895). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtactgggggcgaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412461_S_P-A Feature FT:CDS DQ412461_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03008349). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgacccctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatttggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412462_S_P-A Feature FT:CDS DQ412462_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03016604). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412464_S_P-A Feature FT:CDS DQ412464_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03017686). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaatcaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatrt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|DQ412465_S_P-A Feature FT:CDS DQ412465_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03018053). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412466_S_P-A Feature FT:CDS DQ412466_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03019532). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412467_S_P-A Feature FT:CDS DQ412467_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03021334). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaagcaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgcttgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacgaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggttctgggggccaagtctgttcaacatcttgaagccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412468_S_P-A Feature FT:CDS DQ412468_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S03023665). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccrcagagtctagactcgtggtggacttctctcarttttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtycccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagytatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412469_S_P-A Feature FT:CDS DQ412469_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03024022). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagaatctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatccctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcwcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagttyactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412470_S_P-A Feature FT:CDS DQ412470_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04000911). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412471_S_P-A Feature FT:CDS DQ412471_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04001322). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccratttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgacacctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggayggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412472_S_P-A Feature FT:CDS DQ412472_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04001718). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412473_S_P-A Feature FT:CDS DQ412473_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04006022). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaaacaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagwctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412474_S_P-A Feature FT:CDS DQ412474_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04008719). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagacttgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttacccgtttg
tcctatgattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412475_S_P-A Feature FT:CDS DQ412475_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04013164). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaactaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggacgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412476_S_P-A Feature FT:CDS DQ412476_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04013889). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaagggaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtactgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412477_S_P-A Feature FT:CDS DQ412477_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04019789). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactygtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412478_S_P-A Feature FT:CDS DQ412478_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04020448). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctaggggatccacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412479_S_P-A Feature FT:CDS DQ412479_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04020969). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412480_S_P-A Feature FT:CDS DQ412480_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04023100). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412481_S_P-A Feature FT:CDS DQ412481_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04024774). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412482_S_P-A Feature FT:CDS DQ412482_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S04025434). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412483_S_P-A Feature FT:CDS DQ412483_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05000567). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgyttggctttcagytatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412484_S_P-A Feature FT:CDS DQ412484_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05001608). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412485_S_P-A Feature FT:CDS DQ412485_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05009484). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412486_S_P-A Feature FT:CDS DQ412486_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05009485). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggaytatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagytatatggatgatgtggtaytgggggccaagtctgtacarcatcttgagtccctttwtac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412487_S_P-A Feature FT:CDS DQ412487_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05010412). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtatttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412488_S_P-A Feature FT:CDS DQ412488_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05014132). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactygtggtggacttctctcaattttctagggggatcacccgtgtgtcttggcctaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412489_S_P-A Feature FT:CDS DQ412489_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05015377). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaawttgtcctggttatcgctggatgtrtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412490_S_P-A Feature FT:CDS DQ412490_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05015562). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggttgacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412491_S_P-A Feature FT:CDS DQ412491_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05016894). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412492_S_P-A Feature FT:CDS DQ412492_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05021370). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412493_S_P-A Feature FT:CDS DQ412493_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s06001115). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412494_S_P-A Feature FT:CDS DQ412494_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03006072). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412495_S_P-A Feature FT:CDS DQ412495_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate e04005714). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttcyaggggratcacccgtgtgtcatggccaaaattcgc
wgtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaycaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412496_S_P-A Feature FT:CDS DQ412496_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate e05001211). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggctcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttacac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412497_S_P-A Feature FT:CDS DQ412497_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02003101). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggaytatcaaggtatgttgcccgtttg
tcctctrattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
wtccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaartctgtacarcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412498_S_P-A Feature FT:CDS DQ412498_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02005645). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412499_S_P-A Feature FT:CDS DQ412499_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02006857). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412500_S_P-A Feature FT:CDS DQ412500_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02015690). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412501_S_P-A Feature FT:CDS DQ412501_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S02019167). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412502_S_P-A Feature FT:CDS DQ412502_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s02023960). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412503_S_P-A Feature FT:CDS DQ412503_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S03001913). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412504_S_P-A Feature FT:CDS DQ412504_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03005844). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcayatcaggaytcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacaggaccatgcaaaacctgcacgactcctgctcaaggcaactctacaa
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggccttc
ccycattgtttggctttcagctatatggatgatgtagtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgtgactaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412505_S_P-A Feature FT:CDS DQ412505_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03007896). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412506_S_P-A Feature FT:CDS DQ412506_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03017841). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412507_S_P-A Feature FT:CDS DQ412507_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03024644). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412508_S_P-A Feature FT:CDS DQ412508_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03024905). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattygc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412509_S_P-A Feature FT:CDS DQ412509_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s03025319). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412510_S_P-A Feature FT:CDS DQ412510_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04000576). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412511_S_P-A Feature FT:CDS DQ412511_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04001424). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412512_S_P-A Feature FT:CDS DQ412512_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04003303). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412513_S_P-A Feature FT:CDS DQ412513_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04003408). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412514_S_P-A Feature FT:CDS DQ412514_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04005839). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaagggatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412515_S_P-A Feature FT:CDS DQ412515_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04006948). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412516_S_P-A Feature FT:CDS DQ412516_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04008408). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattygc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412517_S_P-A Feature FT:CDS DQ412517_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04009363). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattctcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412518_S_P-A Feature FT:CDS DQ412518_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04010494). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412519_S_P-A Feature FT:CDS DQ412519_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04013441). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcatggccaaaattcgc
tgtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412520_S_P-A Feature FT:CDS DQ412520_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04013574). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttrcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgastcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412521_S_P-A Feature FT:CDS DQ412521_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04013890). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412522_S_P-A Feature FT:CDS DQ412522_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04015284). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtatgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatatcgtmttgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412523_S_P-A Feature FT:CDS DQ412523_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04015417). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaatttgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412524_S_P-A Feature FT:CDS DQ412524_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04015800). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412525_S_P-A Feature FT:CDS DQ412525_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04017583). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412526_S_P-A Feature FT:CDS DQ412526_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04018169). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412527_S_P-A Feature FT:CDS DQ412527_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04019154). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtaggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412528_S_P-A Feature FT:CDS DQ412528_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04020125). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412529_S_P-A Feature FT:CDS DQ412529_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04021181). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctscaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctmattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaarrcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412530_S_P-A Feature FT:CDS DQ412530_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04021494). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412531_S_P-A Feature FT:CDS DQ412531_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s04023099). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatttctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412532_S_P-A Feature FT:CDS DQ412532_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05000388). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgtkaccaattttctttkgtctctgggtatacatttaa
>gnl|hbvcds|DQ412533_S_P-A Feature FT:CDS DQ412533_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05001110). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412534_S_P-A Feature FT:CDS DQ412534_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05003005). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412535_S_P-A Feature FT:CDS DQ412535_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05003007). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtccwggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412536_S_P-A Feature FT:CDS DQ412536_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05004147). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggrycacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggrgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcaatggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaartctgtacagcatcgtgagtccctttatac
cgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412537_S_P-A Feature FT:CDS DQ412537_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05006576). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgtttgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttctcattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaatgccaggatcaacaacgaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctacgt
taccctcatgttgctgtacaaaacctacggayggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtggggctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412538_S_P-A Feature FT:CDS DQ412538_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05006873). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcytggccaaaattcgc
agtgcccaayctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagyacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaagccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412539_S_P-A Feature FT:CDS DQ412539_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05014484). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412540_S_P-A Feature FT:CDS DQ412540_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05014763). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412541_S_P-A Feature FT:CDS DQ412541_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05015138). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaracttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412542_S_P-A Feature FT:CDS DQ412542_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05015563). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggacacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412543_S_P-A Feature FT:CDS DQ412543_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05015565). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412544_S_P-A Feature FT:CDS DQ412544_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05016895). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412545_S_P-A Feature FT:CDS DQ412545_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S05016897). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412546_S_P-A Feature FT:CDS DQ412546_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05017882). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412547_S_P-A Feature FT:CDS DQ412547_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05017883). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412548_S_P-A Feature FT:CDS DQ412548_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05017885). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412549_S_P-A Feature FT:CDS DQ412549_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05018055). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412550_S_P-A Feature FT:CDS DQ412550_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05018794). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412551_S_P-A Feature FT:CDS DQ412551_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05021811). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaccacccgtgtgtcktggccaaaattygc
agtcccyaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctrattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaagggaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacarcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412552_S_P-A Feature FT:CDS DQ412552_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05022192). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412553_S_P-A Feature FT:CDS DQ412553_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05022193). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412554_S_P-A Feature FT:CDS DQ412554_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05024566). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412555_S_P-A Feature FT:CDS DQ412555_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s05024568). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412556_S_P-A Feature FT:CDS DQ412556_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s06001510). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ412557_S_P-A Feature FT:CDS DQ412557_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate s06001513). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ459086_S_P-A Feature FT:CDS DQ459086_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient ID7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacttacggacagaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ788725_S_P-A Feature FT:CDS DQ788725_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgccccatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ788728_S_P-A Feature FT:CDS DQ788728_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 05/96). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ995813_S_P-A Feature FT:CDS DQ995813_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Pts5_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaatycgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatctycttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttttac
cgctgttaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|DQ995822_S_P-A Feature FT:CDS DQ995822_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Pts14_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttattgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttatagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
atccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcmtggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ995827_S_P-A Feature FT:CDS DQ995827_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Pts19_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacgaccagtacgggaccatgcaaaacctgcacgacccctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttac
cgctgttaccaattttcttgtgtctttgggtgtacatttaa
>gnl|hbvcds|DQ995829_S_P-A Feature FT:CDS DQ995829_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Pts21_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacgaccagtacgggaccatgcaaaacctgcacgactactgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatttggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ995834_S_P-A Feature FT:CDS DQ995834_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Pts26_Bas). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaatacttgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggtttgtagggctttc
ccccactgtttggctttcagttatattgatgatttggtattgggggccaaatctgtacagcatcgtgaggccctttatac
cgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EF103278_S_P-A Feature FT:CDS EF103278_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ran60). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgcagctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtctctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtcactttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF208113_S_P-A Feature FT:CDS EF208113_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcaccgtgagtccctttatac
tgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EF547828_S_P-A Feature FT:CDS EF547828_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD151-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcccgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547829_S_P-A Feature FT:CDS EF547829_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD219-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgagaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547830_S_P-A Feature FT:CDS EF547830_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD95-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgagaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547831_S_P-A Feature FT:CDS EF547831_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD05-7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttcgagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547832_S_P-A Feature FT:CDS EF547832_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD260-6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattctaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547833_S_P-A Feature FT:CDS EF547833_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD153-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547834_S_P-A Feature FT:CDS EF547834_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD165-7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547835_S_P-A Feature FT:CDS EF547835_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD266-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcccgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547836_S_P-A Feature FT:CDS EF547836_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD56-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547837_S_P-A Feature FT:CDS EF547837_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD250-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547838_S_P-A Feature FT:CDS EF547838_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD264-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547839_S_P-A Feature FT:CDS EF547839_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD07-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547840_S_P-A Feature FT:CDS EF547840_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD120-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547841_S_P-A Feature FT:CDS EF547841_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD142-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547842_S_P-A Feature FT:CDS EF547842_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD167-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547843_S_P-A Feature FT:CDS EF547843_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD188-8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547844_S_P-A Feature FT:CDS EF547844_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD191-0). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547845_S_P-A Feature FT:CDS EF547845_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD64-6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547846_S_P-A Feature FT:CDS EF547846_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD72-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547847_S_P-A Feature FT:CDS EF547847_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD126-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547848_S_P-A Feature FT:CDS EF547848_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD97-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547849_S_P-A Feature FT:CDS EF547849_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD273-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttttttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaagtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547850_S_P-A Feature FT:CDS EF547850_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD141-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgcttgtaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547851_S_P-A Feature FT:CDS EF547851_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD154-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtcttttttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagactgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547852_S_P-A Feature FT:CDS EF547852_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD155-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctagaaccccagctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcgaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547853_S_P-A Feature FT:CDS EF547853_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD58-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacttgcaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547854_S_P-A Feature FT:CDS EF547854_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD160-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaacgactcacatcaggattcctaggacccctgctcgtgttacaggcggggtctctcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547855_S_P-A Feature FT:CDS EF547855_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD63-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaaaacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttgtggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgc
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgtcaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF547856_S_P-A Feature FT:CDS EF547856_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FD168-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggaagacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtattgggagttgacaagaatcctcac
aataccgcagagtcttttctcggggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaccctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690515_S_P-A Feature FT:CDS EF690515_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 190-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690516_S_P-A Feature FT:CDS EF690516_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 051-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690517_S_P-A Feature FT:CDS EF690517_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 170-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690518_S_P-A Feature FT:CDS EF690518_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 284-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattctcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690519_S_P-A Feature FT:CDS EF690519_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 177-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattctctagggggttcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcaactatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattctcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690520_S_P-A Feature FT:CDS EF690520_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 048-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcacgattcctaggaccgctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcctcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690521_S_P-A Feature FT:CDS EF690521_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 043-N). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagcccatcacatcggtatttctaggtcccctcttcgtgacacaggcgggttttttcttgtcgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690522_S_P-A Feature FT:CDS EF690522_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 277-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattatcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690523_S_P-A Feature FT:CDS EF690523_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 312-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattatcttgtgtctttgggtatacatttaa
>gnl|hbvcds|EF690524_S_P-A Feature FT:CDS EF690524_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 358-S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690525_S_P-A Feature FT:CDS EF690525_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 161-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcagtattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatccctctgcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690526_S_P-A Feature FT:CDS EF690526_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 171-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690527_S_P-A Feature FT:CDS EF690527_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 255-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690528_S_P-A Feature FT:CDS EF690528_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 186-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690529_S_P-A Feature FT:CDS EF690529_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 280-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690530_S_P-A Feature FT:CDS EF690530_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 343-S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690531_S_P-A Feature FT:CDS EF690531_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 351-S). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattatcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690532_S_P-A Feature FT:CDS EF690532_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 250-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattctcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690533_S_P-A Feature FT:CDS EF690533_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 249-SE). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattatcttgtgtctttgggtatacatttaa
>gnl|hbvcds|EF690534_S_P-A Feature FT:CDS EF690534_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 146-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattctcttgtgtctttgggtatacatttaa
>gnl|hbvcds|EF690535_S_P-A Feature FT:CDS EF690535_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 159-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcagacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF690536_S_P-A Feature FT:CDS EF690536_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 378-CW). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattctcttttgtctgtgggtatccatttaa
>gnl|hbvcds|EU054331_S_C-A Feature FT:CDS EU054331_S_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgcacaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcggtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086721_S_P-A Feature FT:CDS EU086721_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU159676_S_P-A Feature FT:CDS EU159676_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Irish-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU185786_S_P-A Feature FT:CDS EU185786_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU11). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcctctggattatcaaggtattttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtasaawacctacggatgraarttgcacctgtaywscsrtcccatcgtcctgggcttkcgcaaaa
tacctatgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattskgggccaagtctgtacagcatcgtgagtmcctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU185787_S_P-A Feature FT:CDS EU185787_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccmmagaatctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtattttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaarttgcacctgtaywscsatcccatcgtcctgggcttkcgcaaaa
tacctatgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtasagcatcgtgagtmcctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU185788_S_P-A Feature FT:CDS EU185788_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU19). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagartctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtattttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaarttgcacctgtaywscsatcccatcgtcctgggcttkcgcaaaa
tacctatgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtmcstttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU185789_S_P-A Feature FT:CDS EU185789_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatyayatcaggactcctaggacccctgctygtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattgggtcttctggattatcaaggtattttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaarttgcacctgtaywscsrtcccatcgtcctgggcttkcgcaaaa
tacctatgggagtggggctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtmcctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU304331_S_P-A Feature FT:CDS EU304331_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA84). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatgc
ckctgttacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
>gnl|hbvcds|EU366129_S_P-A Feature FT:CDS EU366129_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA92). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctkgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaaatctgctcaacaccttgaagccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU410082_S_P-A Feature FT:CDS EU410082_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ph81). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU414102_S_P-A Feature FT:CDS EU414102_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU414103_S_P-A Feature FT:CDS EU414103_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU414104_S_P-A Feature FT:CDS EU414104_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcyaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacmtgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgkgagkccctttatac
cgctgttacyaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU414132_S_P-A Feature FT:CDS EU414132_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU414133_S_P-A Feature FT:CDS EU414133_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594383_S_P-A Feature FT:CDS EU594383_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttctgtctctgggtatacatttaa
>gnl|hbvcds|EU594384_S_P-A Feature FT:CDS EU594384_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594385_S_P-A Feature FT:CDS EU594385_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594386_S_P-A Feature FT:CDS EU594386_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtttttctggattatcaaggtatgttgcccgtttg
tcctataattccaggatcaacaacaaccagtacgggaccatgcaaaacatgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594387_S_P-A Feature FT:CDS EU594387_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594388_S_P-A Feature FT:CDS EU594388_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594389_S_P-A Feature FT:CDS EU594389_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594390_S_P-A Feature FT:CDS EU594390_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594391_S_P-A Feature FT:CDS EU594391_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattctctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594392_S_P-A Feature FT:CDS EU594392_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594393_S_P-A Feature FT:CDS EU594393_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594394_S_P-A Feature FT:CDS EU594394_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU594395_S_P-A Feature FT:CDS EU594395_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU747320_S_P-A Feature FT:CDS EU747320_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V51). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagattctagactcgtggtggaattctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859898_S_P-A Feature FT:CDS EU859898_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859899_S_P-A Feature FT:CDS EU859899_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P44). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859900_S_P-A Feature FT:CDS EU859900_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaaggggatcacccgtgtgtcttgggcaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859901_S_P-A Feature FT:CDS EU859901_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859902_S_P-A Feature FT:CDS EU859902_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859903_S_P-A Feature FT:CDS EU859903_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859904_S_P-A Feature FT:CDS EU859904_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P39). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859905_S_P-A Feature FT:CDS EU859905_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P38). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859906_S_P-A Feature FT:CDS EU859906_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859907_S_P-A Feature FT:CDS EU859907_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859908_S_P-A Feature FT:CDS EU859908_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859909_S_P-A Feature FT:CDS EU859909_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859910_S_P-A Feature FT:CDS EU859910_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859911_S_P-A Feature FT:CDS EU859911_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859912_S_P-A Feature FT:CDS EU859912_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859913_S_P-A Feature FT:CDS EU859913_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859914_S_P-A Feature FT:CDS EU859914_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859915_S_P-A Feature FT:CDS EU859915_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859916_S_P-A Feature FT:CDS EU859916_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859917_S_P-A Feature FT:CDS EU859917_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859918_S_P-A Feature FT:CDS EU859918_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859919_S_P-A Feature FT:CDS EU859919_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859920_S_P-A Feature FT:CDS EU859920_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P21). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859921_S_P-A Feature FT:CDS EU859921_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P08). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaaccttcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859922_S_P-A Feature FT:CDS EU859922_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859923_S_P-A Feature FT:CDS EU859923_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859924_S_P-A Feature FT:CDS EU859924_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859925_S_P-A Feature FT:CDS EU859925_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859926_S_P-A Feature FT:CDS EU859926_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P06). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859927_S_P-A Feature FT:CDS EU859927_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859928_S_P-A Feature FT:CDS EU859928_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P01). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859929_S_P-A Feature FT:CDS EU859929_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859930_S_P-A Feature FT:CDS EU859930_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859931_S_P-A Feature FT:CDS EU859931_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C96). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859932_S_P-A Feature FT:CDS EU859932_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C69). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859933_S_P-A Feature FT:CDS EU859933_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859934_S_P-A Feature FT:CDS EU859934_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatgcaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859935_S_P-A Feature FT:CDS EU859935_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859936_S_P-A Feature FT:CDS EU859936_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859937_S_P-A Feature FT:CDS EU859937_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859938_S_P-A Feature FT:CDS EU859938_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859939_S_P-A Feature FT:CDS EU859939_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859940_S_P-A Feature FT:CDS EU859940_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C122). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859941_S_P-A Feature FT:CDS EU859941_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C153). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859942_S_P-A Feature FT:CDS EU859942_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859943_S_P-A Feature FT:CDS EU859943_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859944_S_P-A Feature FT:CDS EU859944_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859945_S_P-A Feature FT:CDS EU859945_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU859946_S_P-A Feature FT:CDS EU859946_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859947_S_P-A Feature FT:CDS EU859947_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859948_S_P-A Feature FT:CDS EU859948_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C151). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859949_S_P-A Feature FT:CDS EU859949_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859950_S_P-A Feature FT:CDS EU859950_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctaaactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaagattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcgaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859951_S_P-A Feature FT:CDS EU859951_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859952_S_P-A Feature FT:CDS EU859952_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|EU859953_S_P-A Feature FT:CDS EU859953_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C55). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttctcattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859954_S_P-A Feature FT:CDS EU859954_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C42). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859955_S_P-A Feature FT:CDS EU859955_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C39). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859956_S_P-A Feature FT:CDS EU859956_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C35). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ009235_S_P-A Feature FT:CDS FJ009235_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtataaatttaa
>gnl|hbvcds|FJ349222_S_P-A Feature FT:CDS FJ349222_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H20). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ349224_S_P-A Feature FT:CDS FJ349224_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H71). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ349296_S_P-A Feature FT:CDS FJ349296_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ665815_S_P-A Feature FT:CDS FJ665815_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HD-06). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatactcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|FJ665816_S_P-A Feature FT:CDS FJ665816_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HD-41). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaaattgtcatggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|FJ692554_S_P-A Feature FT:CDS FJ692554_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcaaaagctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FJ692555_S_P-A Feature FT:CDS FJ692555_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24074). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcccaggacccctgcacgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagagggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaycaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtataaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692557_S_P-A Feature FT:CDS FJ692557_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48004). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692558_S_P-A Feature FT:CDS FJ692558_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttascaattttcttttrtctttgggtatacatttaa
>gnl|hbvcds|FJ692559_S_P-A Feature FT:CDS FJ692559_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48032). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692561_S_P-A Feature FT:CDS FJ692561_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692562_S_P-A Feature FT:CDS FJ692562_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggycacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctkgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgaatccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692563_S_P-A Feature FT:CDS FJ692563_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48049). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttctkttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692564_S_P-A Feature FT:CDS FJ692564_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48074). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692565_S_P-A Feature FT:CDS FJ692565_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48077). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggwccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatwcatttaa
>gnl|hbvcds|FJ692566_S_P-A Feature FT:CDS FJ692566_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692567_S_P-A Feature FT:CDS FJ692567_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48113). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692570_S_P-A Feature FT:CDS FJ692570_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50010). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcaygactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgaggccctttatac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692571_S_P-A Feature FT:CDS FJ692571_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50011). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692572_S_P-A Feature FT:CDS FJ692572_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50013). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatry
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692573_S_P-A Feature FT:CDS FJ692573_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50014). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttccagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctcgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|FJ692574_S_P-A Feature FT:CDS FJ692574_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50015). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692575_S_P-A Feature FT:CDS FJ692575_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggawcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattrtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacaycttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692576_S_P-A Feature FT:CDS FJ692576_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaaaactgtacaacatcttgagtccctttatac
tgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692577_S_P-A Feature FT:CDS FJ692577_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50024). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagactgwacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692578_S_P-A Feature FT:CDS FJ692578_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692579_S_P-A Feature FT:CDS FJ692579_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692580_S_P-A Feature FT:CDS FJ692580_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692581_S_P-A Feature FT:CDS FJ692581_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50086). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692582_S_P-A Feature FT:CDS FJ692582_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692583_S_P-A Feature FT:CDS FJ692583_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50089). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692584_S_P-A Feature FT:CDS FJ692584_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692585_S_P-A Feature FT:CDS FJ692585_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50091). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692586_S_P-A Feature FT:CDS FJ692586_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50099). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtcagcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacgaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|FJ692587_S_P-A Feature FT:CDS FJ692587_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50115). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcccaggacccctgctcgagttacaggcggggtytttcttgtggacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgyttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692588_S_P-A Feature FT:CDS FJ692588_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50119). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692590_S_P-A Feature FT:CDS FJ692590_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692591_S_P-A Feature FT:CDS FJ692591_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50167). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacatgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692592_S_P-A Feature FT:CDS FJ692592_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50175). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaawttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccwcgtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ692593_S_P-A Feature FT:CDS FJ692593_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgcwcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttt
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgccgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692595_S_P-A Feature FT:CDS FJ692595_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48093). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692596_S_P-A Feature FT:CDS FJ692596_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48103). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692597_S_P-A Feature FT:CDS FJ692597_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48125). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692598_S_P-A Feature FT:CDS FJ692598_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatacctcagagtctagacttgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccrayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaycarggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctrttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692599_S_P-A Feature FT:CDS FJ692599_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50033). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccmtttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692600_S_P-A Feature FT:CDS FJ692600_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatyacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgyaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692601_S_P-A Feature FT:CDS FJ692601_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692602_S_P-A Feature FT:CDS FJ692602_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50041). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692603_S_P-A Feature FT:CDS FJ692603_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggttgacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcactactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692604_S_P-A Feature FT:CDS FJ692604_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692605_S_P-A Feature FT:CDS FJ692605_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttckaggggratctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692606_S_P-A Feature FT:CDS FJ692606_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattccyargacccccgctcgtgttacaggcggggtctttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccamcagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692607_S_P-A Feature FT:CDS FJ692607_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttyt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692608_S_P-A Feature FT:CDS FJ692608_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50075). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692609_S_P-A Feature FT:CDS FJ692609_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50098). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgtggacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctatggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692610_S_P-A Feature FT:CDS FJ692610_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgtggacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctatggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692611_S_P-A Feature FT:CDS FJ692611_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgataagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ692612_S_P-A Feature FT:CDS FJ692612_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggyatacatttaa
>gnl|hbvcds|FJ692613_S_P-A Feature FT:CDS FJ692613_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatat
taccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctttatgc
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FJ709470_S_P-A Feature FT:CDS FJ709470_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CHI14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ709471_S_P-A Feature FT:CDS FJ709471_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CHI15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtattgggggcaaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttatctctgggtatacatttaa
>gnl|hbvcds|FJ709472_S_P-A Feature FT:CDS FJ709472_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CHI16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttctcattggttcttctggattatcaaggtatattgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FJ904411_S_P-A Feature FT:CDS FJ904411_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A55). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaaccttcaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaggtctgtacaacatcgtgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ904434_S_P-A Feature FT:CDS FJ904434_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate B21). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggagccacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatccctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccmtttgttcartggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcgtgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199974_S_P-A Feature FT:CDS FM199974_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199975_S_P-A Feature FT:CDS FM199975_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtkgacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199976_S_P-A Feature FT:CDS FM199976_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagacttgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199977_S_P-A Feature FT:CDS FM199977_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccarggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatwcatttaa
>gnl|hbvcds|FM199978_S_P-A Feature FT:CDS FM199978_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccmattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199979_S_P-A Feature FT:CDS FM199979_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199980_S_P-A Feature FT:CDS FM199980_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcamctctatgt
ttccctcatgttgctgtacaaaacytacggctggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM199981_S_P-A Feature FT:CDS FM199981_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatrttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200180_S_P-A Feature FT:CDS FM200180_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccctaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatattgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggctggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
tgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200181_S_P-A Feature FT:CDS FM200181_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccamccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200182_S_P-A Feature FT:CDS FM200182_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200183_S_P-A Feature FT:CDS FM200183_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaagttcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccagcatccacaaccaccagtacgggaccctgcagaacctgcacgacacctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200185_S_P-A Feature FT:CDS FM200185_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatattgcccgtttg
tcctctaattccaggatccacaacaaccagtacggggccttgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacagaaattgcacctgtattcccatcccatcatcatgggctttcggaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FM200186_S_P-A Feature FT:CDS FM200186_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattcaaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200187_S_P-A Feature FT:CDS FM200187_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200188_S_P-A Feature FT:CDS FM200188_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacatgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200189_S_P-A Feature FT:CDS FM200189_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccacggtatattgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggctggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FM200193_S_P-A Feature FT:CDS FM200193_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccagcatccacaaccaccagtacgggaccctgcagaacctgcacgacacctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200195_S_P-A Feature FT:CDS FM200195_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctccaattccaggatccacaacaaccagcacgggaccctgcaaaacatgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200198_S_P-A Feature FT:CDS FM200198_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
attatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FM200199_S_P-A Feature FT:CDS FM200199_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200201_S_P-A Feature FT:CDS FM200201_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200202_S_P-A Feature FT:CDS FM200202_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcactaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccagcatccacaaccaccagtacgggaccctgcagaacctgcacgacacctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttwtac
cgctgttaccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|FM200203_S_P-A Feature FT:CDS FM200203_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctactatgcctcatcttcttattggttcttctggattaccagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200204_S_P-A Feature FT:CDS FM200204_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctccaattccaggatccacaacaaccagcacgggaccctgcaaaacatgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200207_S_P-A Feature FT:CDS FM200207_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200210_S_P-A Feature FT:CDS FM200210_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FM200214_S_P-A Feature FT:CDS FM200214_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacttacggctggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtggggctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200215_S_P-A Feature FT:CDS FM200215_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FM200216_S_P-A Feature FT:CDS FM200216_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtgtttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacatgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN295503_S_P-A Feature FT:CDS FN295503_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaggcctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295508_S_P-A Feature FT:CDS FN295508_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgw
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295511_S_P-A Feature FT:CDS FN295511_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M19). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatccctaggacccctgctagtgttacaggcggggtttttctggttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatga
ttccctcatgttgctrtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN295518_S_P-A Feature FT:CDS FN295518_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M26). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaatctacggctggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtggggctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttctgttgtctctgggtatacatttaa
>gnl|hbvcds|FN295528_S_P-A Feature FT:CDS FN295528_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate M38). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtwtactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295530_S_P-A Feature FT:CDS FN295530_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295531_S_P-A Feature FT:CDS FN295531_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RA3_A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295532_S_P-A Feature FT:CDS FN295532_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RA4_A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295533_S_P-A Feature FT:CDS FN295533_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RA5_A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaagacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN295534_S_P-A Feature FT:CDS FN295534_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RA6_A). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545825_S_P-A Feature FT:CDS FN545825_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtctg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545826_S_P-A Feature FT:CDS FN545826_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgccttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacgaccagtacaggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgytgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttac
cgctgtwaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN545828_S_P-A Feature FT:CDS FN545828_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggrtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcytggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgactccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545829_S_P-A Feature FT:CDS FN545829_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
tcccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545830_S_P-A Feature FT:CDS FN545830_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggacmcctgctcgtgttacaggcgggatttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcatggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacgaccaccagyacgggaccctgccgaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccctcatcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545831_S_P-A Feature FT:CDS FN545831_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FN545832_S_P-A Feature FT:CDS FN545832_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggawcacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtataaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545833_S_P-A Feature FT:CDS FN545833_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccrcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545834_S_P-A Feature FT:CDS FN545834_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttrttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaara
twcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaycttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545835_S_P-A Feature FT:CDS FN545835_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545836_S_P-A Feature FT:CDS FN545836_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttcwggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN545837_S_P-A Feature FT:CDS FN545837_S_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacaycacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggamcctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggtycgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545838_S_P-A Feature FT:CDS FN545838_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctccaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|FN545839_S_P-A Feature FT:CDS FN545839_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaycttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545840_S_P-A Feature FT:CDS FN545840_S_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggcccacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtgctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgaatccctttttac
tgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547153_S_P-A Feature FT:CDS FN547153_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccggctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggratcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcttctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacrgaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggrgtgggcctcagtccgtttctcttggctcagtttactagtgccmtttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgtaaccaattttcttttgtctctgggtgtacatttaa
>gnl|hbvcds|FN547157_S_P-A Feature FT:CDS FN547157_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtgtg
tcctctaattccaggatccacaaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|FN547166_S_P-A Feature FT:CDS FN547166_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtatgggaccctgcaaaacttgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547216_S_P-A Feature FT:CDS FN547216_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattrtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547228_S_P-A Feature FT:CDS FN547228_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtctg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547235_S_P-A Feature FT:CDS FN547235_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547238_S_P-A Feature FT:CDS FN547238_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tccactaattccaggatccacaaccaccagtacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|FN547244_S_P-A Feature FT:CDS FN547244_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacytgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacmtgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacaycttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547249_S_P-A Feature FT:CDS FN547249_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggctctgctggattgtcgaggtatgttacccgtttg
tcctctaattccacgatccacaaccaccagtacgggtccctgcagaacctgcacgattcctgttcaaggcaaatctatgt
ttccctcatgttgttgtacaaaacctacggaaggaaattacacctgtattcccatcccattatcctgggctttcgcaaat
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatctgttcggtggttcgcagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547273_S_P-A Feature FT:CDS FN547273_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FN547291_S_P-A Feature FT:CDS FN547291_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggrccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcaggacctgcacgactcctgctcaaggcaactctatwt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|FN547305_S_P-A Feature FT:CDS FN547305_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FN547306_S_P-A Feature FT:CDS FN547306_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctctaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacgaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaagttgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547308_S_P-A Feature FT:CDS FN547308_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FN547309_S_P-A Feature FT:CDS FN547309_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FN547312_S_P-A Feature FT:CDS FN547312_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggcatacatttaa
>gnl|hbvcds|FN547314_S_P-A Feature FT:CDS FN547314_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacmtcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatycctcttcatcctgctgctatgcctcatcttcttrttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547315_S_P-A Feature FT:CDS FN547315_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatccctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547320_S_P-A Feature FT:CDS FN547320_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatycctcttcatcctgctgctatgcctcatcttcttrttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547321_S_P-A Feature FT:CDS FN547321_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttrttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547322_S_P-A Feature FT:CDS FN547322_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctrctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatycctcttcatcctgctgctatgcctcatcttcttrttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547324_S_P-A Feature FT:CDS FN547324_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcagaactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccctaacctccaagcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccacaagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547325_S_P-A Feature FT:CDS FN547325_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaycacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547326_S_P-A Feature FT:CDS FN547326_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctaaactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccrattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547327_S_P-A Feature FT:CDS FN547327_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547328_S_P-A Feature FT:CDS FN547328_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547329_S_P-A Feature FT:CDS FN547329_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547330_S_P-A Feature FT:CDS FN547330_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547331_S_P-A Feature FT:CDS FN547331_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaactaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547334_S_P-A Feature FT:CDS FN547334_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcactcgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547335_S_P-A Feature FT:CDS FN547335_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcagggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacaycttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547336_S_P-A Feature FT:CDS FN547336_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547338_S_P-A Feature FT:CDS FN547338_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctccaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547340_S_P-A Feature FT:CDS FN547340_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547341_S_P-A Feature FT:CDS FN547341_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|FN547342_S_P-A Feature FT:CDS FN547342_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547343_S_P-A Feature FT:CDS FN547343_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttacyaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547344_S_P-A Feature FT:CDS FN547344_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggawcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgctgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtrcaacaycttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FN547345_S_P-A Feature FT:CDS FN547345_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggtccgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547346_S_P-A Feature FT:CDS FN547346_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctccaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactttatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaatccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547348_S_P-A Feature FT:CDS FN547348_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttttcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttctcttgtctttgggcatacatttaa
>gnl|hbvcds|FN547349_S_P-A Feature FT:CDS FN547349_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccagcatccacaaccaccagtacgggaccctgcagaacctgcacgacacctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547351_S_P-A Feature FT:CDS FN547351_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtatcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccagcatccacaaccaccagtacgggaccctgcagaacctgcacgacacctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtagtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547352_S_P-A Feature FT:CDS FN547352_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgagaccctgcaaaacatgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547353_S_P-A Feature FT:CDS FN547353_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctatcctccaatttgtcctggttatcgctagatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccagcatccacaaccaccagtacgggaccctgcagaacctgcacgacacctgctcaaggcaactccatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547354_S_P-A Feature FT:CDS FN547354_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaagattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcagcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccagcatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547355_S_P-A Feature FT:CDS FN547355_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttcgagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacarcatcttgagtccctttttac
cgctgttactaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547360_S_P-A Feature FT:CDS FN547360_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaawttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcarggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgytgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttacyaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547363_S_P-A Feature FT:CDS FN547363_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtcccacccgtgtgtcytggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttctgctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN547364_S_P-A Feature FT:CDS FN547364_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FR821988_S_P-A Feature FT:CDS FR821988_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|FR821989_S_P-A Feature FT:CDS FR821989_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggatcatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|FR821990_S_P-A Feature FT:CDS FR821990_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctatacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|FR821991_S_P-A Feature FT:CDS FR821991_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|FR821992_S_P-A Feature FT:CDS FR821992_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaagcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactggtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacgattaa
>gnl|hbvcds|FR821993_S_P-A Feature FT:CDS FR821993_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcttccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|FR821994_S_P-A Feature FT:CDS FR821994_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccacactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|GQ161813_S_P-A Feature FT:CDS GQ161813_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ184323_S_P-A Feature FT:CDS GQ184323_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggactttcttccattgtctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ184324_S_P-A Feature FT:CDS GQ184324_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttctttttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ222207_S_P-A Feature FT:CDS GQ222207_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1123). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgacttctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ325764_S_P-A Feature FT:CDS GQ325764_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1329-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ325765_S_P-A Feature FT:CDS GQ325765_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1329-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ325766_S_P-A Feature FT:CDS GQ325766_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16375-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgayaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttctyattggttcttctggattatcraggtatattrcccgtttg
tcctstaattccaggatcaacaacaaccagtacgggaccatgcaraacctgcacgactcctgctcaaggcaamtctatgt
ttccctcmtgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatygtcctgggctttcgcaaaa
tacctatgggastkggcctyagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ325767_S_P-A Feature FT:CDS GQ325767_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16375-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgayaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcgaggtatattgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcctgggctttcgcaaaa
tacctatgggacttggycttagtccgtttctcatggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ325768_S_P-A Feature FT:CDS GQ325768_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 16375-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgayaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcgaggtatattgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcctgggctttcgcaaaa
tacctatgggacttggycttagtccgtttctcatggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ325775_S_P-A Feature FT:CDS GQ325775_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 7774-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgcycgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggratcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctrgatgtgtctgcggcrtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcaygactcctgctcaaggcaactctatgt
twccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ325776_S_P-A Feature FT:CDS GQ325776_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 7774-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcwtggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatattgatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttktgtctctgggtatacatttaa
>gnl|hbvcds|GQ325777_S_P-A Feature FT:CDS GQ325777_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 7774-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
ayggagaacatcacatcaggattcctaggacccctgcycgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggratcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcrtttt
atcatattcctcttcatcctgcygctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
wcctctaattccaggatcaacaacaaccagtacgggaccatgcaraacctgcaygactcctgctcaaggcaactctatgt
twccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
mgctgtwaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ325786_S_P-A Feature FT:CDS GQ325786_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcarggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ325792_S_P-A Feature FT:CDS GQ325792_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GB1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggrkcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacmtgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcartttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ331046_S_P-A Feature FT:CDS GQ331046_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-188). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctcgactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaaccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ331047_S_P-A Feature FT:CDS GQ331047_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ414522_S_P-A Feature FT:CDS GQ414522_S_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477461_S_P-A Feature FT:CDS GQ477461_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477462_S_P-A Feature FT:CDS GQ477462_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgcttgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggttttgggggccaagtctgtacaacatcgtgaagccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477463_S_P-A Feature FT:CDS GQ477463_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatccctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactggtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477464_S_P-A Feature FT:CDS GQ477464_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ477465_S_P-A Feature FT:CDS GQ477465_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggcattc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477466_S_P-A Feature FT:CDS GQ477466_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477467_S_P-A Feature FT:CDS GQ477467_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477468_S_P-A Feature FT:CDS GQ477468_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaagcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|GQ477469_S_P-A Feature FT:CDS GQ477469_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggaatacccgtgtgtcatggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477470_S_P-A Feature FT:CDS GQ477470_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttcgaggggaagcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgtaaccaattttcttttgtctctgggtatacatytaa
>gnl|hbvcds|GQ477472_S_P-A Feature FT:CDS GQ477472_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatcctcac
aataccgaagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477473_S_P-A Feature FT:CDS GQ477473_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggtaccacccgagtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtgcagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477474_S_P-A Feature FT:CDS GQ477474_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
acggagaacatcacatcaggattcctaggacccctgcacgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtcagcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcatgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggccttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgattccctttatac
cgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477475_S_P-A Feature FT:CDS GQ477475_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtgcaacatcgtgaagccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477476_S_P-A Feature FT:CDS GQ477476_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggggtcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgtctcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagagctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477477_S_P-A Feature FT:CDS GQ477477_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=681 residues).
agggagaacatcacatcaggattcctaggacccctgcacgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgccatgcctcatcttcttattggttcttctggattatcaaggtatattgcccgtttg
tcctctaattccaggagcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477478_S_P-A Feature FT:CDS GQ477478_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P34). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgattcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477479_S_P-A Feature FT:CDS GQ477479_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477480_S_P-A Feature FT:CDS GQ477480_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P41). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477482_S_P-A Feature FT:CDS GQ477482_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctcaaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477484_S_P-A Feature FT:CDS GQ477484_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaccagtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477486_S_P-A Feature FT:CDS GQ477486_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgtaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477487_S_P-A Feature FT:CDS GQ477487_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P60). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaagccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477488_S_P-A Feature FT:CDS GQ477488_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P64). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaagttcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcatgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477490_S_P-A Feature FT:CDS GQ477490_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P74). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatccggagtcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcaccgtgagtccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477491_S_P-A Feature FT:CDS GQ477491_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P75). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477493_S_P-A Feature FT:CDS GQ477493_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P79). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaaacatcacatcaggattcctagaacccccgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatcccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacacgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtctctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477494_S_P-A Feature FT:CDS GQ477494_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P80). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacggggccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatattgtattgggggccaagtctgtacaacatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtattcatttaa
>gnl|hbvcds|GQ477495_S_P-A Feature FT:CDS GQ477495_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P89). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaaacagctctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477496_S_P-A Feature FT:CDS GQ477496_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P94). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477497_S_P-A Feature FT:CDS GQ477497_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P98). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|GQ477498_S_P-A Feature FT:CDS GQ477498_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P100). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggaccccagctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcctgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477499_S_P-A Feature FT:CDS GQ477499_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P105). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgcttggctttcagctatatggatgatgtggtattgggggccaagtctgtagagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477500_S_P-A Feature FT:CDS GQ477500_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P107). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatattgcgcgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatctaa
>gnl|hbvcds|GQ477501_S_P-A Feature FT:CDS GQ477501_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P116). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccattgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477502_S_P-A Feature FT:CDS GQ477502_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P123). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagaatctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccacatctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477503_S_P-A Feature FT:CDS GQ477503_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P130). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ477504_S_P-A Feature FT:CDS GQ477504_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P131). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tccactaattccaggatcaacaacaaccagtacaggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggcactttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486062_S_P-A Feature FT:CDS GQ486062_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS27). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486063_S_P-A Feature FT:CDS GQ486063_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS28). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggamcatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486076_S_P-A Feature FT:CDS GQ486076_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS41). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacaycttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ486077_S_P-A Feature FT:CDS GQ486077_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS42). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctaggggragcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacmaaacctacggayggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486092_S_P-A Feature FT:CDS GQ486092_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS57). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatatsgtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttacyaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486101_S_P-A Feature FT:CDS GQ486101_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS66). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcatttt
atcatattcctctgcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486103_S_P-A Feature FT:CDS GQ486103_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS68). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgyagggctttc
ccccactgyttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486104_S_P-A Feature FT:CDS GQ486104_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS69). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagaatctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcawcaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagctatatggatgatgtggtaytgggggccaaatctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486119_S_P-A Feature FT:CDS GQ486119_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS84). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
tkccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtktggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486120_S_P-A Feature FT:CDS GQ486120_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS85). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggakcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcrctggatgtgtctgcggcrtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccmtcgtcctgggctttcgcaaaa
twcctatgggrgtgggcctcagtccgtttctcttggctcagttyactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486130_S_P-A Feature FT:CDS GQ486130_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS95). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactygtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgacycctgctcaargcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcytttagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486139_S_P-A Feature FT:CDS GQ486139_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS104). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggaytatcaaggtatgttgcccgtttg
tcctctaattccaggatcmwcaacmaccagyacgggaccatgcaraacctgcaygactcctgctcaaggcaactctatgt
wtccctcatgttgctgtacmaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486143_S_P-A Feature FT:CDS GQ486143_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS108). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486148_S_P-A Feature FT:CDS GQ486148_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS113). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatctcccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggcwttc
ccccactgtttggcttttagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttyttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486156_S_P-A Feature FT:CDS GQ486156_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS121). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcmccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaarrcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtrcaacaccttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486165_S_P-A Feature FT:CDS GQ486165_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS130). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcaaccgtgtgtcttggccaaaattcgc
agtscccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcytggctcagtttactagtgccmtttgttcagtggttcgtagggcyttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaartctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486182_S_P-A Feature FT:CDS GQ486182_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS147). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggwcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagytatatggatgatgtggtattgggggccaaatctgtacarcatcktgaggccctttwtac
cgctgttaccaattttcttttgtctytgggtatacatttaa
>gnl|hbvcds|GQ486192_S_P-A Feature FT:CDS GQ486192_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS157). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcrggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcamccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctratrccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctaygt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgyttggcytttagctatatggatgatgtggtattgggggcyaartcygtacagcatcgtgargccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486194_S_P-A Feature FT:CDS GQ486194_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS159). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggragcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486197_S_P-A Feature FT:CDS GQ486197_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS162). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486198_S_P-A Feature FT:CDS GQ486198_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS163). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactyctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486203_S_P-A Feature FT:CDS GQ486203_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS168). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486205_S_P-A Feature FT:CDS GQ486205_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS170). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggattatcaaggtatgttgcccgtttg
tcctctcattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgyttggctttcagytatatggatgatgtggtattgggggccaartctgtacagcatcgtgaggccctttayac
cgctgtyaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486209_S_P-A Feature FT:CDS GQ486209_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS174). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggrtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcytgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatattgtattgggggccaartctgtaymgcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatwcatttaa
>gnl|hbvcds|GQ486211_S_P-A Feature FT:CDS GQ486211_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS176). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgcccgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaggccctttatac
cgctgtgaccaattttcttttgtctctgggtattcatttaa
>gnl|hbvcds|GQ486213_S_P-A Feature FT:CDS GQ486213_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS178). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaatkccaggatcaacaacaaccagcacaggaccctgcaaaacctgcacgactcctgctcaarrcaactctaygt
tkccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggsctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486225_S_P-A Feature FT:CDS GQ486225_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS190). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactygtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccracatgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtwtg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacatgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtwcagcatcgtgaagccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486232_S_P-A Feature FT:CDS GQ486232_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS197). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacmtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggaytatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggsctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacarcatcktgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486249_S_P-A Feature FT:CDS GQ486249_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS214). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggacmcctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttytctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagytatatggatgatgtggtattgggggccaagtctgtacarcatcktgagtccctttatac
cgctgttacyaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486253_S_P-A Feature FT:CDS GQ486253_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS218). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcrggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggrycacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgtkgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaartctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486271_S_P-A Feature FT:CDS GQ486271_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS236). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttracaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttrggtatacatttaa
>gnl|hbvcds|GQ486287_S_P-A Feature FT:CDS GQ486287_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS252). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtscccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486305_S_P-A Feature FT:CDS GQ486305_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS270). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagrggraccacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacatgtattcccatcccatcrtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtwttgggggccaaatctgtrcarcatckkgarkcmctttayac
cgctgttwscaaytttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486306_S_P-A Feature FT:CDS GQ486306_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS271). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagacwcgtggtggacttctctcaattttctagggggagcacccgggtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctamttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgyttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486309_S_P-A Feature FT:CDS GQ486309_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS274). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggrawcwmccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggaytatcaaggtatgttgcccgtttg
tcctctaattccaggatcmwcaacmaccagyacgggaccatgcmaaacctgcaygactcctgctcaaggcaactctatgt
wtccctcmtgttgctgtacmaaacctwcggatggaaattgcacctgtattcccatcccatcrtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatattgtattgggggccaagtctgtacarcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486312_S_P-A Feature FT:CDS GQ486312_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS277). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486314_S_P-A Feature FT:CDS GQ486314_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS279). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagartctagactcgtggtggacttctctcaattttcyagrggrgccacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctsctgtcctccaayttgtcctggttatcgttggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctrmttccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggayggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcyttyagctatatggatgatgtggtmctgggggccaartctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486317_S_P-A Feature FT:CDS GQ486317_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS282). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacrgaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486360_S_P-A Feature FT:CDS GQ486360_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS325). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaartctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486368_S_P-A Feature FT:CDS GQ486368_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS333). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctscaatcactcaccaacctcctgtcctccgatttgtcctggttatcgctggatgtgtctgcggcrtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactrgtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacaccttgactccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486369_S_P-A Feature FT:CDS GQ486369_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS334). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcarrattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggwtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctgattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacractcctgctcaarrcaamtctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatkgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486389_S_P-A Feature FT:CDS GQ486389_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS354). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggrtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgytcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacaacaccgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486391_S_P-A Feature FT:CDS GQ486391_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS356). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattytctaggggggtcaaccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgytgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggamcatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccmtttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486408_S_P-A Feature FT:CDS GQ486408_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS373). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtrtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctcyaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486409_S_P-A Feature FT:CDS GQ486409_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS374). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486410_S_P-A Feature FT:CDS GQ486410_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS375). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccamgtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486415_S_P-A Feature FT:CDS GQ486415_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS380). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcaygactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatmtkgatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|GQ486416_S_P-A Feature FT:CDS GQ486416_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS381). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggratcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccamgwctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486417_S_P-A Feature FT:CDS GQ486417_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS382). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagactgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486419_S_P-A Feature FT:CDS GQ486419_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS384). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtrgtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggaaccacaacgaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486421_S_P-A Feature FT:CDS GQ486421_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS386). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcaygactcctgctcaaggcaactctatgt
ttcmctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486424_S_P-A Feature FT:CDS GQ486424_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS389). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaatkccaggatcaacaacaaccagtacgggamcatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486425_S_P-A Feature FT:CDS GQ486425_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS390). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctgsattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgastcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486426_S_P-A Feature FT:CDS GQ486426_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS391). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagwctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486427_S_P-A Feature FT:CDS GQ486427_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS392). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggwcacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcaygactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486437_S_P-A Feature FT:CDS GQ486437_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS402). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactygtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgytgcccgtttg
tcctctaattccaggatccacaacaaccagyacgggamcttgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcatgggctttcggaaaa
twcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ486438_S_P-A Feature FT:CDS GQ486438_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS403). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486439_S_P-A Feature FT:CDS GQ486439_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS404). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486441_S_P-A Feature FT:CDS GQ486441_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS406). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgkgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcytgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagctatatggatgatrtrgtattgggggccaagwctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486445_S_P-A Feature FT:CDS GQ486445_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS410). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccmctgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486454_S_P-A Feature FT:CDS GQ486454_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS419). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatctaa
>gnl|hbvcds|GQ486456_S_P-A Feature FT:CDS GQ486456_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS421). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctamttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctwtgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttctkttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486461_S_P-A Feature FT:CDS GQ486461_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS426). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486469_S_P-A Feature FT:CDS GQ486469_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS434). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486474_S_P-A Feature FT:CDS GQ486474_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS439). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaaaaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486478_S_P-A Feature FT:CDS GQ486478_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS443). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtaccaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486479_S_P-A Feature FT:CDS GQ486479_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS444). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486482_S_P-A Feature FT:CDS GQ486482_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS447). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486490_S_P-A Feature FT:CDS GQ486490_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS455). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486510_S_P-A Feature FT:CDS GQ486510_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS475). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486514_S_P-A Feature FT:CDS GQ486514_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS479). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttatgtctctgggtatacatttaa
>gnl|hbvcds|GQ486529_S_P-A Feature FT:CDS GQ486529_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS494). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgrgaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagwctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486531_S_P-A Feature FT:CDS GQ486531_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS496). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaycacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctcyaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486532_S_P-A Feature FT:CDS GQ486532_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS497). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggaycacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccmtgcaaaacctgcacgastcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccamgtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486535_S_P-A Feature FT:CDS GQ486535_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS500). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggrbcacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtrcgggamcctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaartctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486544_S_P-A Feature FT:CDS GQ486544_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS509). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486549_S_P-A Feature FT:CDS GQ486549_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS514). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaycatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486550_S_P-A Feature FT:CDS GQ486550_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS515). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486556_S_P-A Feature FT:CDS GQ486556_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS521). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcaygactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatrtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486557_S_P-A Feature FT:CDS GQ486557_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS522). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtkrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatrtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486560_S_P-A Feature FT:CDS GQ486560_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS525). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggyggggttttycttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaycacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcmctcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccmggatcaacaacaaccastacgrgaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagctatatggatgatrtkgtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486563_S_P-A Feature FT:CDS GQ486563_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS528). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggamcatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtkrttcgtagggcwttc
ccccaytgtttggctttcagctatatggatgatgtggtattgggggccamgtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486564_S_P-A Feature FT:CDS GQ486564_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS529). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaacmagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486567_S_P-A Feature FT:CDS GQ486567_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS532). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggaytcctargacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcmtccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgrgaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486568_S_P-A Feature FT:CDS GQ486568_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS533). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486571_S_P-A Feature FT:CDS GQ486571_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS536). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggakcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctcwaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486580_S_P-A Feature FT:CDS GQ486580_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS545). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486583_S_P-A Feature FT:CDS GQ486583_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS548). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacrtcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486587_S_P-A Feature FT:CDS GQ486587_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS552). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486597_S_P-A Feature FT:CDS GQ486597_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS562). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccacgtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486598_S_P-A Feature FT:CDS GQ486598_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS563). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaamaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctaygt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486599_S_P-A Feature FT:CDS GQ486599_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS564). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtytgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486601_S_P-A Feature FT:CDS GQ486601_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS566). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486603_S_P-A Feature FT:CDS GQ486603_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS568). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486611_S_P-A Feature FT:CDS GQ486611_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS576). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaargtatgttgcccgtttg
tcctcyaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486615_S_P-A Feature FT:CDS GQ486615_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS580). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486616_S_P-A Feature FT:CDS GQ486616_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS581). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaycacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagwctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486631_S_P-A Feature FT:CDS GQ486631_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS596). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486642_S_P-A Feature FT:CDS GQ486642_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS607). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattccyaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486646_S_P-A Feature FT:CDS GQ486646_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS611). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcyaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486663_S_P-A Feature FT:CDS GQ486663_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS628). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486668_S_P-A Feature FT:CDS GQ486668_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS633). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccmtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486669_S_P-A Feature FT:CDS GQ486669_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS634). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcwtggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatrtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486677_S_P-A Feature FT:CDS GQ486677_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS642). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcactaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggaytrtcaaggtatgttgcccgtttg
tcctctrattccaggatcmwcracmaccagtacgggaccmtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctwcggaygraaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgyagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486683_S_P-A Feature FT:CDS GQ486683_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS648). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacarcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttra
>gnl|hbvcds|GQ486686_S_P-A Feature FT:CDS GQ486686_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS651). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacrgaaattgcacctgtattcccatcccatcatcttgggctttcggaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486691_S_P-A Feature FT:CDS GQ486691_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS656). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggccacccgtgtgtcttggccaaaattcgc
agtycccaacctccaatcactcaccaacctcctgtcctccaawttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486693_S_P-A Feature FT:CDS GQ486693_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS658). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486694_S_P-A Feature FT:CDS GQ486694_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS659). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggagcacccgggtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggcmattc
ccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486697_S_P-A Feature FT:CDS GQ486697_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS662). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486710_S_P-A Feature FT:CDS GQ486710_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS675). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggytatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486712_S_P-A Feature FT:CDS GQ486712_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS677). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486714_S_P-A Feature FT:CDS GQ486714_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS679). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486718_S_P-A Feature FT:CDS GQ486718_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS683). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgccttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486721_S_P-A Feature FT:CDS GQ486721_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS686). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaycacmcgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacmtgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486725_S_P-A Feature FT:CDS GQ486725_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS690). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggastgggcctcagtccgtttctcwtggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatrtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486727_S_P-A Feature FT:CDS GQ486727_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486741_S_P-A Feature FT:CDS GQ486741_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS706). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctygttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggrtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctamttccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccamgtctgtacagcatcgtgagkccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486747_S_P-A Feature FT:CDS GQ486747_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS712). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtattcatttaa
>gnl|hbvcds|GQ486751_S_P-A Feature FT:CDS GQ486751_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS716). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486754_S_P-A Feature FT:CDS GQ486754_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS719). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggaktgggcctcagtccgtttctcwtggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatrtggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486770_S_P-A Feature FT:CDS GQ486770_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS735). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctagsacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcarttttctagggggrkcacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggctcttctggattatcraggtatgttgcccgtttg
tcctctrattccaggatcaacaacaaccagtacaggaccrtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgkagggctttc
ccccactgtytggctttcagctatatggatgatgtggtattgggggccaagwctgtacarcatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486772_S_P-A Feature FT:CDS GQ486772_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS737). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaccacccgtgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486775_S_P-A Feature FT:CDS GQ486775_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS740). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatycctaggacccctgctcgygttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtytg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
twcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacayctggagtccctttatac
cgctgttacyaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|GQ486776_S_P-A Feature FT:CDS GQ486776_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS741). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacaacgaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486780_S_P-A Feature FT:CDS GQ486780_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS745). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaagatatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaaccygcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggcttttagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486782_S_P-A Feature FT:CDS GQ486782_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS747). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattcyaggatcaacaacaaccagtacgggaccatgcaaaayctgcaygactcctgctcaaggcaactctaygt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486807_S_P-A Feature FT:CDS GQ486807_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS772). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctakgggagkgggcctcagtccgtttctctkggctcagtttactagtgccatttgttcagkggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486813_S_P-A Feature FT:CDS GQ486813_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS778). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggttttcagctatattgatgatattgtattgggggccaagtctgtacarcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486817_S_P-A Feature FT:CDS GQ486817_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS782). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgcyatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcamrrcaactctatgt
ttccctcatgttgytgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttyagytayatggatgatgtggtattgggkgcmaarwctgtasarcatcgtgagkccctttatac
ygctgtwaccaattttcttytrtctctgggtatacatttaa
>gnl|hbvcds|GQ486828_S_P-A Feature FT:CDS GQ486828_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS793). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggcycacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaaccaccagtacgggaccatgcaggacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgtkaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486829_S_P-A Feature FT:CDS GQ486829_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS794). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggayggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486831_S_P-A Feature FT:CDS GQ486831_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS796). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggtccacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccgtgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttcmctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtgattcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486834_S_P-A Feature FT:CDS GQ486834_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS799). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggccttagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486836_S_P-A Feature FT:CDS GQ486836_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS801). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggaycacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcgtcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486838_S_P-A Feature FT:CDS GQ486838_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS803). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggatycctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctscaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatatycctcttcatcctgctgcyatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtytg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgacycctgctcaaaacaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ486840_S_P-A Feature FT:CDS GQ486840_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS805). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatmacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggwtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagyccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatattgatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486853_S_P-A Feature FT:CDS GQ486853_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS818). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcktggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctcattccaggatcaacaacaaccagtacgggwccatgcaaaacttgcacgactcctgctcaarrcaamtctacgt
ttccctcatgttgctgtacaaaacctacggwtggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagytatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgtwaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486856_S_P-A Feature FT:CDS GQ486856_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS821). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggcttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatattgatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ486857_S_P-A Feature FT:CDS GQ486857_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GS822). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggttgacttctctcagttttctaggggaatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563545_S_P-A Feature FT:CDS GU563545_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU563546_S_P-A Feature FT:CDS GU563546_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563547_S_P-A Feature FT:CDS GU563547_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-23). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU563548_S_P-A Feature FT:CDS GU563548_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-108). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU563550_S_P-A Feature FT:CDS GU563550_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-204). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563551_S_P-A Feature FT:CDS GU563551_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-124). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccattgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563553_S_P-A Feature FT:CDS GU563553_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563554_S_P-A Feature FT:CDS GU563554_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563555_S_P-A Feature FT:CDS GU563555_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-35). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563557_S_P-A Feature FT:CDS GU563557_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-78). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563558_S_P-A Feature FT:CDS GU563558_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-90). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU563562_S_P-A Feature FT:CDS GU563562_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-189). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU798964_S_P-A Feature FT:CDS GU798964_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_479). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU798976_S_P-A Feature FT:CDS GU798976_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_1186). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU798978_S_P-A Feature FT:CDS GU798978_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_1196). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GU798993_S_P-A Feature FT:CDS GU798993_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_1756). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctcgggggaacacccgtgtgtcttggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU798998_S_P-A Feature FT:CDS GU798998_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_2006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GU799004_S_P-A Feature FT:CDS GU799004_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_1426). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU799009_S_P-A Feature FT:CDS GU799009_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_1071). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU799020_S_P-A Feature FT:CDS GU799020_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 09/H_247). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcagttttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcactaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU799025_S_P-A Feature FT:CDS GU799025_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 09/H_1000). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaagcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU799030_S_P-A Feature FT:CDS GU799030_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 07/H_1319). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU799039_S_P-A Feature FT:CDS GU799039_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_265). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttgtggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaaccaccagcacgggaccctgcaaaacctgcacgactcctgctcraarcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttwtgtctttgggtatacatttaa
>gnl|hbvcds|GU799040_S_P-A Feature FT:CDS GU799040_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 08/H_616). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagactgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|GU799047_S_P-A Feature FT:CDS GU799047_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 09/H_746). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU799052_S_P-A Feature FT:CDS GU799052_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 07/H_782). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaatctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HE576988_S_P-A Feature FT:CDS HE576988_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttcaagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggaaggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HE576989_S_P-A Feature FT:CDS HE576989_S_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P2.2.11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcagggtatgttgcccgtttg
tcctctaattccaggatcaacaacaaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggaaggaaattgcacctgtattcccatcccattgtcctgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttatac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|HE652704_S_P-A Feature FT:CDS HE652704_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttgaccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattag
>gnl|hbvcds|HE652705_S_P-A Feature FT:CDS HE652705_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattctaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|HE652707_S_P-A Feature FT:CDS HE652707_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctccagtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttg
tcctctaattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgt
atccctcatgttgctgtacaaaaccttcggacggaaattgcgcctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacaattaa
>gnl|hbvcds|HE652708_S_P-A Feature FT:CDS HE652708_S_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtcta