HBVdb

Dataset for nucleotide sequence S of genotype A

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                            **  *             *     *    ***    
ATGGAGAACATCACATCAGGATTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAGAATCCTCAC
                     c     a            g                 c           a         
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                  *  *         *    *                        *     *  *        *
AATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGatCACCCGTGTGTCTTGGCCAAAATTCGC
      a                               g           acg ta         g              
                                                   gc                           
                                                    a                           

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             * * * **  *  *                  *     * *  *             *   *  * *
AGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTT
                               t        g c         c     t                     
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *    **    ** **  *     * **  *                      *                       
ATCATATTCCTCTTCATCCTGC---TGCTATGCCTCATCTTCTTATTGGTTCTTCTGGATTATCAAGGTATGTTGCCCGT
                                            g     a  g     c gc  g              
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                            **        *  *      
TTGTCCTCTAATTCCAGGATCa------ACAACAACCAGtACGGGACCaTGCAAAACCTGCACGACTCCTGCTCAAGGCA
                     c      g    c     c      a c    gg                     a   
                            t                                                   
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
               *       *             *      *    *             * *          *  *
ACTCTATGTTTCCCTCATGTTGCTGTACAAAACCTACGGAtGGAAATTGCACCTGTATTCCCATCCCATCgTCcTGGGCT
c               c     t            t    c           t                 a  t      
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   *    *  * ***     *    ** *    *         **              *     *          
TTCGCAAAATACCTATGGGAGTGGGCCTCAGTCCGTTTCTCtTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGT
          t        g           c         a                    c           r    c
          w                              c                                      
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *          *  *  *   *     *   *    *                                 
AGGGCTTTCCCCCACTGTTTGGCTTTCAGcTATATGGATGATGTGGTAtTGGGGGCCAAGTCTGTACAgCATCgTGAGtC
              t   c       t  t   g t      a t  tc          aa  a g  a  c t   ag 
                                                           r                  k 
                                                                                

       650       660       670       680       690
....:....|....:....|....:....|....:....|....:....|
                                                  
CCTTTATACCGCTGTTACCAATTTTCTTTTGTCTcTGGGTATACATTTAA
     t            t               t    c      c---
                                                  
                                                  
© 1998-2020Legal notice