Dataset for nucleotide sequence C of genotype A

[Download (right click)] [Edit] [Sequences] [Repertoires]

1677 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

AB697487_C_P-A      atggacattgacccktataaagaatttggagctwctgtggagttactctcktttttgcct
AB697498_C_P-A      atggacattgacccktataaagaatttggagctwctgtggagttactctcktttttgcct
KP857066_C_P-A      atggacattgacccttataaagaatttggcgcttctgttgagttactctcgtttttgcct
EU414132_C_P-A      atggacattgacccttataaagaatttggagstactgkggagktactctcgtttttkcct
GQ477473_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857072_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857079_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857091_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857078_C_P-A      atggacattgacccgtataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857067_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857074_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
KP857073_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857064_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477462_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF439821_C_P-A      agggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439926_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439925_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439911_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439921_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439915_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439912_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439913_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439914_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439916_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439917_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439918_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439919_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439920_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439922_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439924_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439927_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439923_C_P-A      atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgcct
JF439931_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439935_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439941_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439933_C_P-A      atggacattgacccgtataaagagtttggagctactgcagagttactctcgtttttgcct
JF439932_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439930_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439928_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439938_C_P-A      atggacattgacccgtataaagaatttggagccactgtagagttactctcgtttttgcct
JF439937_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439939_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439942_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439936_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439940_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439929_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
JF439934_C_P-A      atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgcct
KP857076_C_P-A      atggacattgacccgtataaagaatttggagcttctgtggagttactctcctttttgcct
KP857088_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477493_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AJ627228_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857081_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477475_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
KM606695_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477501_C_P-A      atggacattgacccttataaagaatttggagctacagtggagttactctcgtttttgcct
GQ477477_C_P-A      atggacattgacccttataaagaatttggagcttctgcgagcttactctcgtttttgcct
KT749822_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857077_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477504_C_P-A      atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgcct
GQ477499_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AJ344115_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857059_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
GQ477487_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477500_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414052_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
EU414133_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
GQ477491_C_P-A      atggacatcgacccttataaagaatttggagcttctgtggacttactctcttttttgcct
AY603432_C_P-A      atggacattgacccttataaagaatttggcgctactgtggagttactctcgtttttgcct
EU414049_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcktttttgcct
KP857085_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606657_C_P-A      atggacattgacccttataaagaatttggagctaccgcggagttactctcgtttttgcct
GQ477472_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU414050_C_P-A      atggacattgacccttataaagaatttggagctactgtggagctactctcgtttttgcct
GQ477488_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
GU827640_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF324071_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606661_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477484_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
GQ477470_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477465_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477490_C_P-A      atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcct
GQ477482_C_P-A      atggacattgaccattataaagaatttggagctactgtggagttactctcgtttttgcct
KP718102_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718092_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606653_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
GQ477494_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477498_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185776_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185777_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606658_C_P-A      atggacattgaccattataaagaatttggagcttctgtggagttactctcgtttttgcct
KF779384_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779221_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477468_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324126_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606688_C_P-A      atggacattgacccttataaagaatttggagctactgccgagttactctcgtttttgcct
KF779361_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ586809_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563551_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
AJ309369_C_P-A      atggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgcct
AJ309371_C_P-A      atggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgcct
AJ309370_C_P-A      atggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgcct
KP995108_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779272_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718095_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779213_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779215_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324118_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttacct
AB116076_C_P-A      atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
AF324122_C_P-A      atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
EU185774_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749836_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749833_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718100_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606742_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606692_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779371_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779365_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779211_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836858_C_P-A      atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgcct
JF439830_C_P-A      atggacgttgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477496_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859934_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
DQ788725_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697488_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779280_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779281_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779334_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439832_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
L13994_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718089_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779284_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606672_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606694_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606749_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426096_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426095_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttatgcct
KX827298_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827293_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749831_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606676_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854709_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779386_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779385_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779283_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779282_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779249_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779240_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707662_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ687533_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439859_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ414522_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859944_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233286_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AM282986_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY707087_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324148_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324120_C_P-A      atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgcct
AB116078_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB064314_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836834_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594384_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594386_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718101_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718096_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactatcatttttgcct
KF779293_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779346_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX096953_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttaccctcgtttttgcct
GQ477503_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX096952_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779347_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MW401519_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718094_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718088_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718090_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718097_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718098_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718099_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718091_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854708_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779268_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779360_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779279_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779370_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606674_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606684_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606685_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606691_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426097_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN507849_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC311242_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC074724_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC311241_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC311243_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749844_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749843_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749839_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749838_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749829_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749824_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP274925_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843182_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779372_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779351_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779336_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779333_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779329_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779323_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779325_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779308_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779299_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779309_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779298_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779297_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779295_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779294_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779287_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779270_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779266_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779257_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779253_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779256_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779271_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779238_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779232_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779227_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426098_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836831_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX310722_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606652_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749850_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX310721_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707634_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707623_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707620_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707612_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707609_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707610_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707611_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707613_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707614_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707616_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707617_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707618_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707619_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707621_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707622_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707624_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707625_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707626_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707627_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707628_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707629_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707630_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707631_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707632_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707637_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439864_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439861_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439855_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439853_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439848_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439845_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439839_C_P-A      atggacattgacccttataaagaatttggagctactgtggagctactctcgtttttgcct
JF439829_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439828_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439826_C_P-A      atggacattgacccttataaagaatttggagctgctgtggagttactctcgtttttgcct
JF439825_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439822_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439820_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439824_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439827_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HE576988_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
Z35717_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563558_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563550_C_P-A      atggacattgacccttataaagaatttggagctactggggagttactctcgtttttgcct
FJ349222_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859956_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439836_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843218_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859942_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP274927_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749825_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749826_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749842_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749846_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749847_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749849_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859919_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttcctctcgtttttgcct
EU859912_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859899_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859900_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859901_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859902_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859903_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859904_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859905_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859906_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859907_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859908_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859909_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859910_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859911_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859913_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859915_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859916_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859917_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859920_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859921_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859922_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859923_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859924_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859925_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859926_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859927_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859928_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP274928_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749837_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859898_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594394_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594395_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185746_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY862868_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439835_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439837_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM295796_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM295795_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM295797_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM410963_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594383_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779255_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779259_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426094_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426099_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324147_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324133_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF090839_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF090840_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594389_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594390_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594391_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594392_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859945_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859950_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779231_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779319_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779379_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854710_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM519454_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606648_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697511_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324135_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779252_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697491_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480040_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY886219_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116081_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116079_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116080_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB300367_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453979_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453980_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453984_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480038_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480041_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697489_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697496_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697497_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697499_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697501_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697503_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697504_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697505_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697508_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697509_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697512_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937798_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161138_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY161139_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779305_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC517161_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH932713_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
X07911_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116077_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ687529_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859935_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859936_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439862_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439852_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779313_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB246337_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB246338_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB300366_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453981_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480039_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB549213_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697492_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697506_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697507_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF043580_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF297624_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324125_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324128_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324136_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY128092_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233280_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY862867_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU086721_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185750_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594385_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594393_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859914_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859918_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859929_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859930_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859931_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859932_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859933_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859937_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859940_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859941_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859943_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859946_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859947_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859948_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859949_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859951_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859953_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859954_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859955_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ349224_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477461_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477467_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563546_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563553_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563554_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563555_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563562_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439819_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439823_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439831_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439833_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439834_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439838_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439840_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439841_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439842_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439843_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439844_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439846_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439847_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439849_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439850_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439851_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439854_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439856_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439857_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439858_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439860_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439865_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439866_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439867_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439868_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836832_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836849_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KC836854_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779243_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779244_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779245_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779246_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779247_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779248_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779251_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779258_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779262_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779263_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779273_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779274_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779275_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779286_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779290_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779291_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779304_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779306_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779307_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779310_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779314_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779324_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779326_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779337_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779338_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779339_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779344_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779345_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779348_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779350_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779352_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779355_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779362_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779363_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779364_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779366_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779367_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779368_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779369_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779373_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779378_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779383_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843186_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606683_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606687_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606700_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606746_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP718093_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749830_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749835_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749840_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605516_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605517_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605532_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY003230_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426093_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
Z72478_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606662_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
AY230113_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
DQ298162_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236169_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236167_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
DQ298165_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236168_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
DQ298163_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236165_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY230111_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
DQ298161_C_P-A      atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcct
AY236166_C_P-A      atggacgttgacacttataaagaatttggcgctactgtggagttgctctcttttttgcct
DQ298164_C_P-A      atggacgttgacacttataaagaatttggcgctactgtggagttgctctcttttttgcct
KP857068_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AJ627227_C_P-A      atggacattgacctttataaagaatttggagctagtgtggagttactctcgtttttgcct
JF439767_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcggttttgcct
KM606671_C_P-A      atggacattgacccttataaagaatttggcgcttctgtggagttactctcgtttttacct
KP857089_C_P-A      atggacatcgacccttataaagaatttggagctactacggaattactctcgtttttgcct
KP857087_C_P-A      atggacattgacctgtataaagaatttggagctactgtggagttactctcttttttgcct
KP857075_C_P-A      atggacattgacccgtataaagagtttggagctagtgtggagttactctcgtttttgcct
GQ477474_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttaatctcgtttttgcct
KP857070_C_P-A      atggacatcgacccttataaagaatttggagcgtctgtggagttactctcgtttttgcct
KP857071_C_P-A      atggacatcgacccttataaagaatttggagcgtctgtggagttactctcatttttgcct
AB937797_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857060_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccg
GQ477502_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY034878_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477480_C_P-A      atggacatcgacccttataaagaatttggagcttctacggagttactctcgtttttgcct
GQ477469_C_P-A      atggacattgacccttataaagaatttggagctactgctgagttactctcatttttgcct
GQ477476_C_P-A      atggacattgacccttataaagaatttggcgctactgctgagttactctcgtttttgcct
AF419536_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
KP857086_C_P-A      atggacattgacccttataaagaatttggcgcttctgcgcagttgctctcgtttttgcct
AJ627226_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JF439967_C_P-A      atggacattgacccttataaagaatttggagctactggggagttactctcatttttgcct
JF439958_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439963_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439973_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439971_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcctttttgcct
JF439969_C_P-A      atggacattggcccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439992_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439986_C_P-A      atggacattgacccttatatagaatttggagctactgtggagttactctcatttttgcct
JF439985_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttaccctcatttttgcct
JF439983_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439982_C_P-A      atggacattgacccttataaagaatttggcgctactgtggagttactctcatttttgcct
JF439981_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439978_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439972_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactcccatttttgcct
JF439970_C_P-A      atggacattgacccttataaagaatttggagctactgtggagctactctcatttttgcct
JF439962_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439953_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439954_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439944_C_P-A      atggacatggacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439975_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439976_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439990_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439984_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439979_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439968_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439966_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439964_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439960_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439957_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439956_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439955_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439952_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439949_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439980_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439752_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439753_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439754_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439755_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439756_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439757_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439758_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439759_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439760_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439761_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439762_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439763_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439764_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439765_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439766_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439943_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439945_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439946_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439947_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439948_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439950_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439951_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439959_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439961_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439965_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439977_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439987_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439988_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439989_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439991_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439993_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439974_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KP857082_C_P-A      atggacattgacccttataaagaatttggcgccactgtggagttactctcttttttgcct
AF090838_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707328_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857069_C_P-A      atggacattgacccttataaagaatttggagcttctgtggaattactctcgtttttgcct
KM606693_C_P-A      atggacatcgacccttataaagaatttggcgctactgtggagttactctcttttttgcct
EU414048_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KP857092_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477497_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857083_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
AF537372_C_P-A      atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgcct
KC875260_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707368_C_P-A      atggacattgacccttctaaagaatttggagctactgtggagttactctcgtttctgcct
MT448620_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779234_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439774_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324121_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439874_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439880_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439869_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439870_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439871_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439872_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439876_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439877_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439878_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439879_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439881_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439882_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439883_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439873_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439875_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AJ012207_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF090841_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439768_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439769_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439770_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439771_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439772_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439773_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439775_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439777_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF439778_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JF440016_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
X51970_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779321_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827294_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827296_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX827295_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779342_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779320_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779260_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779239_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779312_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779328_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779330_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779331_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779354_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779358_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779359_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707388_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707346_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707369_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcctttttgccc
JQ707360_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707356_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707353_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JQ707361_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JQ707352_C_P-A      atggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgcct
JQ707351_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707349_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707350_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707355_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707358_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707363_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707365_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707367_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
JQ707348_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707354_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707357_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707362_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707364_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707366_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707370_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
JQ707347_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
JQ707359_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
JQ707345_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttagtctcgtttttgcct
JQ707325_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707300_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707314_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707321_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707322_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707337_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779311_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779269_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707419_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707339_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707332_C_P-A      atggacattgacccttataaagaattcggagctactgtggagttactctcgtttttgcct
JQ707324_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707315_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707312_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779277_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779265_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707303_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707323_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707299_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707319_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779374_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779349_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779356_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779261_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779276_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707415_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707414_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707407_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707408_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707404_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707401_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707396_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707395_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707392_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707387_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707386_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttacct
JQ707382_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707377_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707336_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707335_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707334_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707331_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707329_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707327_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707318_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707313_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707310_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707311_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707330_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707343_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707308_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707305_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707301_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707306_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707317_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707326_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707344_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY902775_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707371_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707372_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707373_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707374_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707375_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707376_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707378_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707379_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707380_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707381_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707383_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707385_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707389_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707390_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707391_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707393_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707394_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707397_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707398_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707399_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707400_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707402_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707403_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707405_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707406_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707409_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707410_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707411_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707412_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707413_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707416_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707417_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707418_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707420_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779264_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779335_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779375_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707302_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707304_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707307_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707309_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707316_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707320_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707333_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707338_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707340_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707341_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707342_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707384_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477478_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttacct
AB453982_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GQ477466_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857084_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857061_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477486_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KP857080_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KM606650_C_P-A      atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgcct
X02763_C_C-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707577_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707595_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707596_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707605_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707600_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749834_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697495_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707582_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707594_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707607_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707598_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707551_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707578_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactcttgtttttgcct
JQ707563_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707602_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707576_C_P-A      atgaacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707593_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactcgcgtttttgcct
JQ707590_C_P-A      atggacattgacccttataaagaatttggcgctactgcggagttactctcgtttttgcct
JQ707581_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707603_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707580_C_P-A      atggacattgacccttataaagaatttggggctactgcggagttactctcgtttttgcct
JQ707574_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707575_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707579_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707583_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707584_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707585_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707586_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707587_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707588_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707589_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707591_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707597_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707599_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707604_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707606_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707608_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
JQ707592_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcct
KP718087_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606663_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606669_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707565_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707550_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707539_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707534_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB775198_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB697493_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB775199_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB775200_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB775201_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937792_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937793_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937794_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707531_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707532_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707533_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707535_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707536_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707537_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707538_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707540_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707541_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707542_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707543_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707544_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707545_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707546_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707547_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707548_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707549_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707552_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707553_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707554_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707556_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707557_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707558_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707559_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707560_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707561_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707562_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707564_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707566_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707567_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707568_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707569_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707570_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707571_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707572_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707573_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707601_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC430617_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC458430_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC458431_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC592168_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC592169_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC592170_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707555_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT749832_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttaatctcgtttttgcct
KX827297_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857062_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477495_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KJ843172_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477463_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185786_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY152726_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB453983_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
JF439886_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439887_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439888_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439890_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439891_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439892_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439893_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439894_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439895_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439889_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF419534_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF419535_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606659_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859938_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857058_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
AB362931_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB222707_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
AB126580_C_P-A      atggacattgaccctcataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477479_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779210_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448623_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
OK106253_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP857063_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843188_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779381_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707655_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccg
EU859939_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185787_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU185789_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF537371_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324123_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563557_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX310724_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX310725_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
V00866_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ222208_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU747320_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707635_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707615_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707633_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707636_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707638_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707639_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707640_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707641_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707642_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707643_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707644_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707645_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707646_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707647_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707648_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707649_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707650_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707651_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707652_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707653_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707654_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707656_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
X70185_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843184_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779254_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY603441_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF536524_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB205118_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB014370_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB480036_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EF208113_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779315_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779316_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779317_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779322_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606665_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606666_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY603431_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603438_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603446_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603429_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603430_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603435_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
AY603436_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcct
MT448622_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448626_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843166_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843173_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843215_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU594388_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX310723_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843192_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843214_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843216_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843217_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606656_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606677_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606678_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606680_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738140_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738141_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738139_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738143_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY738142_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707665_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ184324_C_P-A      atggacattgacccttataaagaatttggagctactctggagttactctcgtttttgcct
EU594387_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ184323_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HE576989_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707658_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707659_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707661_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707663_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707664_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707667_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707669_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707670_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707672_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707674_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707675_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707676_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JQ707681_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY382410_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545837_C_P-A      atggacattgacccttataaagaatttggagcgactgtggagttactctcttttttgcct
AB076679_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MH464811_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922429_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
KF922431_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
KF922430_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MH464808_C_P-A      atggacattgacccttataagaaatttggagctwctgtggagttactctcatttttgcct
MH464809_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922421_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KF922417_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KF922416_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KF922420_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KF922414_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KF922415_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KF922418_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KF922419_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
AY233290_C_P-A      atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgcct
KF922435_C_P-A      atggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgcct
KF922436_C_P-A      atggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgcct
MH464817_C_P-A      atggacattgacccttataaagaatttggagctactgyggagttactctcgtttttacct
AF297622_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF297621_C_P-A      atggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgcct
KF922433_C_P-A      atggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgcct
KF922434_C_P-A      atggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgcct
KU605536_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605537_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605538_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605539_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT210032_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692573_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB246317_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
GU563547_C_P-A      atggacattgacccttataaagaatttggagctactacggacttactctcttttttgcct
FM199974_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692587_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF922437_C_P-A      atggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgcct
MT731865_C_P-A      atggacattgacccttataaagaatttggagctactgyggagttactctcgtttttgcct
KP168426_C_P-A      atggacattgacccctataaagaatttggagctactgtggagttactctcgtttttgcct
KP168422_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcktttttgcct
AY233279_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233276_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY233287_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692592_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464825_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512464_C_P-A      atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgcct
MK512455_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FM199977_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP168427_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX357646_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FM199975_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgcct
MT731929_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512461_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512475_C_P-A      atggacattgacccttataaagaatttggagcgactgcggagttactctcgtttttgcct
AF297623_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233284_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT347087_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY233275_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcctttttgcct
AY233281_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KX648549_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182334_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182332_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182326_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182325_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182331_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccc
JN182329_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182328_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182327_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182323_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182318_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182320_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182321_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182322_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182324_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182330_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182333_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JN182319_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB076678_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AM494718_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY934773_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF297625_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512477_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512465_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512456_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FM199976_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
JX154579_C_P-A      atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgcct
JX154580_C_P-A      atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgcct
JX154581_C_P-A      atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgcct
JX154582_C_P-A      atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426092_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MK512463_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512462_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY934766_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512476_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512469_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FM199981_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512467_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512474_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512458_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512460_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KP168435_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512466_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ020002_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512471_C_P-A      atggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgcct
GU563545_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MK512472_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MK512468_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512459_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FM199980_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FM199978_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324127_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512457_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP168423_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736918_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU736919_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512473_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GU563548_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FM199979_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MK512470_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426090_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT426091_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY934772_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KP168424_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KP168425_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233288_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464812_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX648547_C_P-A      atggacattgacccttataaagaatttggagctactgyggagttactctcgtttttgcct
KP168434_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM535205_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233282_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464829_C_P-A      nnnnnnnnnnnnnnnnnnnnnnnnnnnggagctactgtggagttactctcgtttttgcct
MH464824_C_P-A      nnnnnnnnnnnnnnnnnnnnnnnnnnnggaggagctgtggagttactctcgtttttgcct
MH464826_C_P-A      nnnnnnnnnnnnnnnnnnnnnnnnnnnggagctactgtggagttactctcgtttttgcct
MH464827_C_P-A      nnnnnnnnnnnnnnnnnnnnnnnnnnnggagctactgtggagttactctcgtttttgcct
KU605519_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605518_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605533_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605534_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX648548_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464821_C_P-A      nnnnncattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922409_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922407_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
HM535200_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233285_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233274_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464815_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT347088_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922408_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233289_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233283_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922406_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ010776_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ010777_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ010778_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605520_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605521_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605522_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KU605535_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464828_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464822_C_P-A      nnnnnnnnnnnnccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464814_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MH464810_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464813_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464818_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MH464830_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692597_C_P-A      atggacatygacccttataaagaatttggagcttctgtggagttactctcttttttgcct
FJ692607_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcct
FJ692609_C_P-A      atggacattgacccgtataaagaatttggagctagtgtggagttactctcttttttgcct
FJ692610_C_P-A      atggacattgacmcgtataaagaatttggagctagtgtggagttactctcttttttgcct
FJ692600_C_P-A      atggayattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692599_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcttttttgcct
FJ692595_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcct
FJ692593_C_P-A      atggacattgacctktataaagaatttggagctactgtggagttactctcttttttgcct
FJ692598_C_P-A      atggacattgacccttataaagaatttggagctactgtrgagttactctcttttttgcct
FJ692596_C_P-A      atggacattgacccttataaagaatttggagctactgttgagttactctcttttttgcct
FJ692613_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692611_C_P-A      atggacattgacacttataaagaatttggagcttctgtggagttactctcttttttgcct
FJ692602_C_P-A      atggacattgacccttataaagaatttggagctactgtagagttactctcttttttgcct
FJ692605_C_P-A      atggacattgaccmttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692604_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692603_C_P-A      atggacattgaccattataaagaatttggagctwctgtggagttactctcttttttgcct
FJ692612_C_P-A      atggacattgaccmttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692601_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692606_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692608_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545832_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MF536820_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY934764_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ161813_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545839_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
LT992448_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545833_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcct
FN545834_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MH580627_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MH580639_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MH580642_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MH580643_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
LT992440_C_P-A      atggacattgacccctataaagaatttggagctactgtggagttactctcgtttttgcct
LT992441_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FN545828_C_P-A      atggacattgacccttataaagaatttggcgctactgtagagttactctcttttttgcct
FN545829_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545835_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545830_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545840_C_P-A      atggacattgacccttataaagagtttggagctactgtggagttactctcttttttgcct
FN545838_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AM180624_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB194950_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KY271391_C_P-A      atggacattgacccttataaagaatttggagctagtgttgagttactctcgtttttgcct
KY271389_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY271390_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM184126_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU054331_C_C-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AM184125_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MF536814_C_P-A      atggacattgacccttataaagaatatggagataatgtggagttactctcttttttgcct
MN544634_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MF536815_C_P-A      atggacattgacccttataaagaatttggagctactacggagttactctcgtttttgcct
MF536810_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MF536811_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545825_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB194952_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HM363612_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
HM363613_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AB194951_C_P-A      atggacattgacccttataaagaatttggagctactgtagagttactctcgtttttgcct
MT622525_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536846_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MF536823_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MF536827_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MF536836_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MF536821_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
MF536819_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MF536867_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MF536869_C_P-A      atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcct
MF536824_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536828_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536833_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536837_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536843_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536845_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536848_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536849_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536816_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
MF536853_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MF536857_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MF536808_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MF536831_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MF536825_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536839_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536841_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536842_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536807_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536830_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536852_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536865_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536868_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536817_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536861_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536862_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536818_C_P-A      atggacattgacccttataaagaatttggagcgactgtggagttactctcgtttttgcct
MF536854_C_P-A      atggacattgacccttataaagaatttggagcgactgtggagttactctcgtttttgcct
MF536855_C_P-A      atggacattgacccttataaagaatttggagcgactgtggagttactctcgtttttgcct
MF536858_C_P-A      atggacattgacccttataaagaatttggagcgactgtggagttactctcgtttttgcct
MF536809_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536832_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536859_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536860_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536813_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536822_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536826_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536835_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536840_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536844_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536850_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536847_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536812_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536806_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536829_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536838_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536851_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536856_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536863_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536864_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF536866_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN585097_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FN545826_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttaatctcgtttttgcct
FJ692555_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
MW567969_C_P-A      tgggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
EU304331_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcktttttgcct
MG877723_C_P-A      atggacatygacccttataaagaatttggagctacygtggagttactctcgtttttgcct
MG877724_C_P-A      atggacatygacccttataaagaatttggagctacygtggagttactctcgtttttgcct
MG877725_C_P-A      atggacatygacccttataaagaatttggagctacygtggagttactctcgtttttgcct
MW567968_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccg
FJ349296_C_P-A      atggacattgacccttataaagaatttggagctactggggagttactctcttttttgcct
EU366129_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
FJ904411_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MN585096_C_P-A      atggacattgacccctataaagaatttggagctactgtggagttactctcatttttgcct
MT210034_C_P-A      atggacatngacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ904434_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF772345_C_P-A      atggacattgacccttataaagaatttggagctactgtggacttactctcgtttttgcct
AB116084_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcatttttgccg
MT114170_C_P-A      atggacattgaccattataaagaatttggagctactgcggagttactctcatttttgcct
KY353919_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
GQ331046_C_P-A      atggacattgacccctataaagaatttggagctactgtggagttactctcatttttgcct
FJ692561_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcct
MF925362_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KJ854701_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
KY353918_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM606649_C_P-A      atggacattgacccttataaagaatttggagcctctgtggagttactctcatttttgcct
AB116092_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcatttttgcct
FJ692586_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350081_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF772348_C_P-A      atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgcct
MF772346_C_P-A      atggacattgacccttataaagaatttggagctactacggagttactctcgtttttgcct
MF772347_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
GQ477464_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF772344_C_P-A      atggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgcct
KM606660_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF772350_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttacct
KP168428_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
AY161142_C_P-A      atggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgcct
AY161143_C_P-A      atggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgcct
AY161144_C_P-A      atggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgcct
KX276769_C_P-A      atggacattgacccttataaagaatttggagcttccgcggagttactctcgtttttgcct
HM042263_C_P-A      atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgcct
KX357650_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB453989_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF350087_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350088_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KX357649_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116086_C_P-A      atggacattgacccttataaagaatttggagctactgcggacttactctcgtttttgcct
FJ692564_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692565_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX357640_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
EF103278_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318690_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
KP857065_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KT151612_C_P-A      atggacattgacccttataaagaatttggagctactagcgagttactctcttttttgcct
KT151617_C_P-A      atggacattgacccttataaagaatttggagctactagcgagttactctcttttttgcct
MF925368_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcct
AF324072_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctggtttttgcct
KR905427_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttgctctcatttttgcct
FJ692558_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgcct
AB116088_C_P-A      atggacattgacctttataaagaatttggagctactgtggagttactctcatttttgcct
MF925400_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
EU859952_C_P-A      atggacattgacccctataaagaatttggagctactgtggagttactctcatttttgcct
GQ331047_C_P-A      atggacattgacccctataaagaatttggagctactgtggagttactctcatttttgcct
OK318683_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF214666_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MW567976_C_P-A      atggacattgacccttataaagaatttggagcktctgtggagttactctcatttttgcct
KP168431_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692567_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116082_C_P-A      atggacatcgacccttataaagaatttggagctactgtagagttactctcatttttgcct
MW567972_C_P-A      atggacattgacccttataaagaatttggagctactgtagagttactctcatttttgcct
FJ692576_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854685_C_P-A      atggccattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
OK318682_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KY353916_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KY353917_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY353915_C_P-A      atggacattgacctttataaagaatttggagcttctgtggagttactctcatttttgcct
KP857090_C_P-A      atggacattgacccttataaagaatttggcgcttctgtggagttactctcttttttgcct
OK318691_C_P-A      atggacattgacctttataaagaatttggagctactgtggagttactctcatttttgcct
KM606647_C_P-A      atggacattgaccattataaagaatttggagctactgtggagttactctcatttttgcct
AB453986_C_P-A      atggacattgacccgtataaagaatttggagctactgtggagttactctcatttttgcct
AB116091_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439744_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439724_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439729_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439751_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439748_C_P-A      atggatattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439740_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccc
JF439734_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439738_C_P-A      atggacattgacccttatagagaatttggagctactgtggagttactctcatttttgcct
JF439750_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439743_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439720_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439721_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttaccctcatttttgcct
JF439731_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439730_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439741_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439728_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439726_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439747_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439723_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439727_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439735_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439736_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439746_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439725_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439908_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439900_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439897_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439898_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439899_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439901_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439902_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439903_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439904_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439905_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439906_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439907_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439910_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439896_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439909_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439737_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439722_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439732_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439733_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JF439742_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350089_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MW567975_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MW567973_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350094_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350090_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606737_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcatttttgcct
AF350096_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350093_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350092_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350082_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350095_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350091_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350097_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350080_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350098_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350083_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350084_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350085_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF350086_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318696_C_P-A      atggacattgacctttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692577_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC462120_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545831_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FJ692554_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
FN545836_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
KY353913_C_P-A      atggacattgacccttataaagaatttggagctactgtagagttactctcatttttgcct
KX357644_C_P-A      atggacattgacccttataaagaatttggagctactacggagttactctcgtttttgcct
KF214660_C_P-A      atggacatcgacccttataaagaatttggcgctactgtggagttactctcatttttgcct
FJ692562_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY934763_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KP168429_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgyct
JQ023663_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JQ023662_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JQ023660_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
JQ023661_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KP168433_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KP168432_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MN476101_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KP168430_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MN476102_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692570_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692559_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KY353926_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ194506_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318685_C_P-A      atggacattgacccttataaagaatttggagctactgcggagttactctcatttttgcct
KF214661_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB246336_C_P-A      atggacattgacccttataaagaatttggagctactggcgagttactctcgtttttgcct
AB116087_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318692_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KY353909_C_P-A      atggacattgacccttataaagaatttggagctactggggagttactctcatttttgcct
KF214662_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgcct
HM011485_C_P-A      atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF324107_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
DQ315785_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB116089_C_P-A      atggacattgacccttataaagaatttggagctactgtgcagttactctcatttttgcct
FJ692572_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116090_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY903452_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MF925373_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854686_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF779332_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116093_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY934771_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318688_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KU736920_C_P-A      atggacattgacccttataaaraatttggagctactgtggagttactctcgtttttgcct
KJ854700_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854690_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MF772353_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KX686607_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606748_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM606673_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854698_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854694_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
DQ020003_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854687_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854707_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MF772351_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KP718085_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KP718086_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC836846_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854693_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854699_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT151615_C_P-A      atggacattgaccattataaagaatttggagctactgtggagttactctcatttttgcct
KF798265_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KR905425_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT366466_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KX357645_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT151611_C_P-A      atggacattgacccttataaagaatttggagctacggtggagttactctcatttttgcct
KJ854706_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798292_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798267_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KR905426_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT366467_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875257_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
FJ692575_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY934765_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB116085_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692588_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB116083_C_P-A      atggacattgacccgtataaagaatttggagctactgttgagttactctcatttttgcct
AY934767_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY934770_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY934768_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY934769_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692566_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcct
AY373429_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MF925372_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875259_C_P-A      atggacattgacccttatcaagaatttggagctactgtggagttactctcatttttgcct
OK318695_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgcct
MF925361_C_P-A      atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcct
KM243029_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854704_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854688_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798310_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798266_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF214659_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KM519452_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KM519453_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798271_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KR905429_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF214658_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MF925385_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB116094_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB937795_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MF925407_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MZ093431_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB453987_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
OK318687_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318686_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318694_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318693_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB453988_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854703_C_P-A      atggactttgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
DQ315786_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KX357647_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX357642_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KX357643_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
OK274310_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
M74501_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LK995385_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT151614_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KJ854702_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854691_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ843183_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854697_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922426_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922427_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922428_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922424_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF922425_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KF798291_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798286_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT366469_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF214657_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875255_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875253_C_P-A      atggacgttgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875251_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
EU410082_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY373428_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AF090842_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
M57663_C_P-A        atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
HM042278_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692590_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692591_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937791_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB937796_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY233278_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
LC051141_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AY934774_C_P-A      atggacattgacccttataaagaatttggagctacagtggagttactctcatttttgcct
OK318684_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
MT426088_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT151618_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT151616_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT151613_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KR905431_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798314_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798302_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798290_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798285_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798311_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT366468_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798279_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798289_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KR905430_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT366470_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798278_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF214663_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875258_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875256_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875252_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
DQ315784_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB241114_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AB246335_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KY353912_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
AY373432_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KC875254_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF214665_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798308_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KF798309_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
KT366471_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
OK318689_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcct
FJ692571_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692563_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AF043560_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854705_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
AB241115_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692557_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692574_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692578_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692579_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692580_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692581_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692582_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692583_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692584_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
FJ692585_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448635_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448636_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854689_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854692_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
KJ854696_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MN053840_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448633_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448637_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
MT448624_C_P-A      atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcct
                                               **              *        ** *  * 

AB697487_C_P-A      tctgacttctttccttccrtymgagatctyctmgacaccgcctcwgctctgtatcgrgar
AB697498_C_P-A      tctgacttctttccktcygtymgagatctyctmgacaccgcctcwgctctgtatcgrgar
KP857066_C_P-A      tctgacttctttccttccgtcaaagatctctatgacaccgccttagctctgcatcgagaa
EU414132_C_P-A      tytgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477473_C_P-A      cttgacttctttccttccgccagagatctcctagacaccgcctcagctctgtatcgagaa
KP857072_C_P-A      tctgacttctttccttccgccagagatctcctagacaccgcctcagctctgtttcgagaa
KP857079_C_P-A      tctgacttctttccttccgtccgagatcttctagacaccgcctcagctttgtatcgagaa
KP857091_C_P-A      catgacttctttccttccatcagagatctcctagacaccgcctcggctctgtatcgagaa
KP857078_C_P-A      gctgacttctttccttccaccaaagatcttctagacaccgcctcagctctgtatcgagaa
KP857067_C_P-A      tctgacttctttccttccgtcaaagatctcctagacaccgcctcagctctgtatcgagat
KP857074_C_P-A      aatgacttctatccttccgtcaaagatctcctagacaccgcctcagctctgtatcgagaa
KP857073_C_P-A      gctgacttttatccttccgtcagagatctcctagacaccgccacagctctgtatcgagaa
KP857064_C_P-A      gctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477462_C_P-A      catgacttctatccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439821_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcaagaa
JF439926_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439925_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439911_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcggctctgtttcgagat
JF439921_C_P-A      tctgactcctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439915_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439912_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439913_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439914_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439916_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439917_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439918_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439919_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439920_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439922_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439924_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439927_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439923_C_P-A      tctgacttctttccttccgtcagagatctactagacaccgcctcagctctgtttcgagat
JF439931_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439935_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439941_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439933_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439932_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439930_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtctcgagat
JF439928_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439938_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439937_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439939_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439942_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439936_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439940_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439929_C_P-A      tctgactcctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
JF439934_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagat
KP857076_C_P-A      tctgacttctttccttccgccagagatctcctagacaccgcctcagctctgtatagagaa
KP857088_C_P-A      cttgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
GQ477493_C_P-A      actgacttctttccttccgccagggatcttctagacaccgcctcagctctgtatcgagaa
AJ627228_C_P-A      catgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP857081_C_P-A      gctgacttctttccttccgtcaaagatcttctagacaccgcctcagctctgtatcgagaa
GQ477475_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
KM606695_C_P-A      tctgacttctttccttccgtcagagatctcctagataccgcctcagctctatatcgagaa
GQ477501_C_P-A      catgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgacaa
GQ477477_C_P-A      catgacttctttccttccgtcagagatctcctagacaccgccacagctctgtttcaagaa
KT749822_C_P-A      catgacttttttccttccgtcagagatctactagacaccgcctcagctctgtatagagaa
KP857077_C_P-A      attgacttctatccttccgtcagagatctcatagaaaccgcctcagctctgtatcgagaa
GQ477504_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
GQ477499_C_P-A      cttgacttctatccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AJ344115_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KP857059_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477487_C_P-A      catgacttctatccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
GQ477500_C_P-A      actgacttctttccttccgtcaaagatcttctagacaccgcctcagctctgtatcgagaa
EU414052_C_P-A      tctgacttctttccttccgccagagatctcctagacaccgcctcagctctgtatcgagaa
EU414133_C_P-A      tctgacttctttccttccgccagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477491_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603432_C_P-A      tctgacttctttccttcagtactagatcttctagataccgcctcagctctctatcgggaa
EU414049_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtttcgagaa
KP857085_C_P-A      attgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606657_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgacaa
GQ477472_C_P-A      actgacttctttcctggcgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU414050_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgggaa
GQ477488_C_P-A      gctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU827640_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
AF324071_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KM606661_C_P-A      tctgacttctttccttcagtcagagatctcctagacaccgcctcagctctgtatcgggaa
GQ477484_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtttcgagaa
GQ477470_C_P-A      tttgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477465_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctttgtatcgagaa
GQ477490_C_P-A      tctgacttctttccttccgccagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477482_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP718102_C_P-A      tctgacttctttccttccgtccgggatctactcgacaccgcttcagccctgtatcgagaa
KP718092_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KM606653_C_P-A      tctgacttctttccttccgtcaaagatctcctagacaccgcctcagctctgtatcgagat
GQ477494_C_P-A      actgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477498_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
EU185776_C_P-A      tctgacttctttccttccgtcagagatctcctasacaccgcctcagctctgtatcgagaa
EU185777_C_P-A      tctgacttctttccttccktcagagatctcctasacaccgcctcagctctgtatcgagaa
KM606658_C_P-A      tctgacttctatccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779384_C_P-A      tctgacttctttccttccgtcagagatctcctagatacagcctcagctctataccgagaa
KF779221_C_P-A      tctgacttctttccttccgtcagagatctcgtagacaccgcctcagctctgtatcgagaa
GQ477468_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF324126_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606688_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcggcaa
KF779361_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ586809_C_P-A      tctgacttctttccttccgtcaaagatctcctaaacaccgcctcagctctgtatcgagaa
GU563551_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AJ309369_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AJ309371_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AJ309370_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KP995108_C_P-A      tctgacttctatccttccgtcagagatctcgtagacaccgcctcagctctgtatcgagaa
KF779272_C_P-A      tctgacttctttccttccgtcagagatctcgtagacaccgcctcagctctgcatcgagaa
KP718095_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KF779213_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779215_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF324118_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB116076_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcaagaa
AF324122_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcaagaa
EU185774_C_P-A      tctgacttttttccttccgtcagagatctcctaracaccgcctcagctctgtatcgagaa
KT749836_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749833_C_P-A      tctgacttttttccttccgtcagagatctcgtagacaccgcctcagctctgcatcgagaa
KP718100_C_P-A      tctgacttctttccttccgtcagagatytcctagacaccgcctcagctctatatcgagaa
KM606742_C_P-A      tttgacttctttccttccgtcagagatttcctagacaccgcctcagctctgtatcgagaa
KM606692_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779371_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779365_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KF779211_C_P-A      tctgacttctttccttccgtcagagatctcgtagacaccgcctcagctctgtatcgagaa
KC836858_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439830_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477496_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859934_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
DQ788725_C_P-A      tctgacttctttccttccgtaagagatctcctagacaccgcctcagctctgtatcgagaa
AB697488_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KF779280_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcttcagctctgtatcgagaa
KF779281_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcttcagctctgtatcgagaa
KF779334_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
JF439832_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
L13994_C_P-A        tctgacttctttccttccgtaagagatctcctagacaccgcctcagctctgtatcgagaa
KP718089_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcytcagctctatatcgagaa
KF779284_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606672_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606694_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606749_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT426096_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT426095_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KX827298_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctccgctctgtatcgagaa
KX827293_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749831_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606676_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ854709_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779386_C_P-A      tctgacttctttccttccgtccgagatctcctagacaccgcctcagctctgtatcgggaa
KF779385_C_P-A      tctgacttctttccttccgtccgagatctcctagacaccgcctcagctctgtatcgagaa
KF779283_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779282_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779249_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779240_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707662_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ687533_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439859_C_P-A      tctgacttctttccttccgtcagagatctcccagacaccgcctcagctctgtatcgagaa
GQ414522_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtaccgagaa
EU859944_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY233286_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AM282986_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
AY707087_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
AF324148_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
AF324120_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcaagaa
AB116078_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcaagaa
AB064314_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KC836834_C_P-A      tctgacttctttccttctattcgagatctcctagacaccgcctcagctctgtatcgagaa
EU594384_C_P-A      gctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
EU594386_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KP718101_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KP718096_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KF779293_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779346_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
JX096953_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
GQ477503_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
JX096952_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KF779347_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
MW401519_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KP718094_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KP718088_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KP718090_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KP718097_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KP718098_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KP718099_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctatatcgagaa
KP718091_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcytcagctctatatcgagaa
KJ854708_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779268_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcttcagctctgtatcgagaa
KF779360_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779279_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779370_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606674_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KM606684_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KM606685_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KM606691_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
MT426097_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MN507849_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
LC311242_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
LC074724_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
LC311241_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
LC311243_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KT749844_C_P-A      tctgacttctttccttccgtcagagatctacttgacaccgcctcagctctgtatcgagaa
KT749843_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctatgtatcgagaa
KT749839_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749838_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749829_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749824_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP274925_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843182_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779372_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779351_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779336_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779333_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779329_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779323_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779325_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779308_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779299_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779309_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779298_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779297_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779295_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779294_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779287_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779270_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779266_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779257_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779253_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcttcagctctgtatcgagaa
KF779256_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcttcagctctgtatcgagaa
KF779271_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcttcagctctgtatcgagaa
KF779238_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779232_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779227_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT426098_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KC836831_C_P-A      tctgacttctttccttccgtcagagatcttcttgacaccgcctcagctctgtatcgagaa
JX310722_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606652_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749850_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JX310721_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707634_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707623_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707620_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707612_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707609_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707610_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707611_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707613_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707614_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707616_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707617_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707618_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707619_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707621_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707622_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707624_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707625_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707626_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707627_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707628_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707629_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707630_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707631_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707632_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707637_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439864_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439861_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439855_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439853_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439848_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439845_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439839_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439829_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439828_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439826_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439825_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439822_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439820_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439824_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439827_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
HE576988_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
Z35717_C_P-A        tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU563558_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU563550_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
FJ349222_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859956_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439836_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843218_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859942_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP274927_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749825_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749826_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749842_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749846_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749847_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749849_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859919_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859912_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859899_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859900_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859901_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859902_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859903_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859904_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859905_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859906_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859907_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859908_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859909_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859910_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859911_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859913_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859915_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859916_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859917_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859920_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859921_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859922_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859923_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859924_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859925_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859926_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859927_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859928_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP274928_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749837_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859898_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594394_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594395_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU185746_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY862868_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439835_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439837_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AM295796_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AM295795_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AM295797_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AM410963_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594383_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779255_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779259_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT426094_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT426099_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF324147_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF324133_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF090839_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF090840_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594389_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594390_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594391_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594392_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859945_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859950_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779231_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779319_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779379_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ854710_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM519454_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606648_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB697511_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AF324135_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KF779252_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697491_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB480040_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KY886219_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB116081_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB116079_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB116080_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB300367_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB453979_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB453980_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB453984_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB480038_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB480041_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697489_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697496_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697497_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697499_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697501_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697503_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697504_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697505_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697508_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697509_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB697512_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB937798_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AY161138_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AY161139_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KF779305_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
LC517161_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
MH932713_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
X07911_C_P-A        tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB116077_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ687529_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859935_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859936_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439862_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439852_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779313_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB246337_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB246338_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB300366_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB453981_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB480039_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB549213_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB697492_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB697506_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB697507_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF043580_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF297624_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF324125_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF324128_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF324136_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY128092_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY233280_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY862867_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU086721_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU185750_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594385_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594393_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859914_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859918_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859929_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859930_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859931_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859932_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859933_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859937_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859940_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859941_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859943_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859946_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859947_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859948_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859949_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859951_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859953_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859954_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859955_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
FJ349224_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477461_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477467_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU563546_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU563553_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU563554_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU563555_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU563562_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439819_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439823_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439831_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439833_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439834_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439838_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439840_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439841_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439842_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439843_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439844_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439846_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439847_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439849_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439850_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439851_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439854_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439856_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439857_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439858_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439860_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439865_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439866_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439867_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439868_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KC836832_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KC836849_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KC836854_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779243_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779244_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779245_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779246_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779247_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779248_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779251_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779258_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779262_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779263_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779273_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779274_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779275_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779286_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779290_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779291_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779304_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779306_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779307_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779310_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779314_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779324_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779326_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779337_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779338_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779339_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779344_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779345_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779348_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779350_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779352_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779355_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779362_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779363_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779364_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779366_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779367_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779368_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779369_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779373_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779378_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779383_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843186_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606683_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606687_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606700_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606746_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP718093_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749830_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749835_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749840_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KU605516_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KU605517_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KU605532_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KY003230_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT426093_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
Z72478_C_P-A        tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606662_C_P-A      catgacttctttccgtcggcgccagacctcctggataccgctgctgctctgtatcgggaa
AY230113_C_P-A      cctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
DQ298162_C_P-A      cctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
AY236169_C_P-A      ggtgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
AY236167_C_P-A      ggtgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
DQ298165_C_P-A      ggtgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
AY236168_C_P-A      cctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
DQ298163_C_P-A      cctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
AY236165_C_P-A      cctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
AY230111_C_P-A      ggtgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
DQ298161_C_P-A      ggtgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
AY236166_C_P-A      ggtgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
DQ298164_C_P-A      ggtgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
KP857068_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagcgctttatcgagat
AJ627227_C_P-A      kctgacttctatccttccgtcagagatctcctagacaccgccwcagctctrtatcgagaa
JF439767_C_P-A      tgtgacttctttccttccgtgccagatctcctacacgccgcctcaacttggtatcaggaa
KM606671_C_P-A      catgatttctttccttccgtcagagatctcctagacaccgcctcagctctatttcgagaa
KP857089_C_P-A      tctgacttctttcctaacatcagagatctcctagacaccgcctcagctctgtttcgagaa
KP857087_C_P-A      catgacttctatccttccgtcagagatctcctagacaccgcctcggctctgtttcgagaa
KP857075_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477474_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP857070_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
KP857071_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB937797_C_P-A      actgacttctttccttccgtcaaagatcttctagacaccgcctcagctctgtatcgagat
KP857060_C_P-A      cctgacttctttccttccgccagagatctgctagacaccgccgcagcactgtttcgagaa
GQ477502_C_P-A      gctgacttctttcctaacgttagagatctcctagacaccgcctcagccctatatcgagaa
AY034878_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgagaa
GQ477480_C_P-A      tctgacttctttcctaacgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477469_C_P-A      ctggacttctttccttccgttagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477476_C_P-A      actgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
AF419536_C_P-A      catgacttctttccttccgtcagagatctcctagacaccgtctcagctctgtatcgagaa
KP857086_C_P-A      gctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AJ627226_C_P-A      cctgacttctttccttccgccagagatctcctagacaccgcctcagctctgtttcgagat
JF439967_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439958_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439963_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439973_C_P-A      tctgactcctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439971_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439969_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439992_C_P-A      tctgacctctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439986_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439985_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439983_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439982_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439981_C_P-A      tctgacttctttccttccgtcagagatctcctaggcaccgcctcagctctgtatcgagaa
JF439978_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439972_C_P-A      tctgacttctttccttccgtccgagatctcctagacaccgcctcagctctgtatcgagaa
JF439970_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439962_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439953_C_P-A      cctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439954_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439944_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439975_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439976_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439990_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439984_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439979_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439968_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439966_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439964_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439960_C_P-A      tctgacttctttccctccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439957_C_P-A      tctgacttctttccttccgtcagagacctcctagacaccgcctcagctctgtatcgagaa
JF439956_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439955_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439952_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439949_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439980_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439752_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439753_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439754_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439755_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439756_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439757_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439758_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439759_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439760_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439761_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439762_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439763_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439764_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439765_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439766_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439943_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439945_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439946_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439947_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439948_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439950_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439951_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439959_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439961_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439965_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439977_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439987_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439988_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439989_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439991_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439993_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439974_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP857082_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgcgac
AF090838_C_P-A      tctgacttctttcctaacgtcagagatctcctagacaccgcctcagctctgtttcgggaa
JQ707328_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KP857069_C_P-A      tctgacttctttccttccgccagagatctcctagacaccgcctcagctctgtatcgagaa
KM606693_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
EU414048_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KP857092_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
GQ477497_C_P-A      tctgacttctttccttccgtccgagatctcctagacaccgcctcagctctgtatcgagaa
KP857083_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
AF537372_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KC875260_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707368_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctttgtatcgggaa
MT448620_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779234_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgggaa
JF439774_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
AF324121_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439874_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439880_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439869_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439870_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439871_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439872_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439876_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439877_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439878_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439879_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439881_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439882_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439883_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439873_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439875_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
AJ012207_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF090841_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439768_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439769_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439770_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439771_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439772_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439773_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439775_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439777_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF439778_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JF440016_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
X51970_C_P-A        tctgacttctttccttccgtcagagatctcctagacaccgcctcggctctgtatcgggaa
KF779321_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KX827294_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KX827296_C_P-A      tctgacttctttccttccgtcggagatctcctagacaccgcctcagctctgtatcgggaa
KX827295_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779342_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779320_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779260_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779239_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779312_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779328_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779330_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779331_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779354_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779358_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779359_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707388_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707346_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707369_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707360_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707356_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707353_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707361_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707352_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707351_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707349_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707350_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707355_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707358_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707363_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707365_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707367_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707348_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707354_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707357_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707362_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707364_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707366_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707370_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707347_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707359_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707345_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707325_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707300_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707314_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707321_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707322_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707337_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
KF779311_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779269_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707419_C_P-A      tctgacttctttccttccgtcagagatctccttgacaccgcctcagctctgtatcgggaa
JQ707339_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707332_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707324_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgggaa
JQ707315_C_P-A      tctggcttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707312_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779277_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779265_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707303_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707323_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707299_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707319_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779374_C_P-A      tctgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779349_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779356_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779261_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779276_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707415_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707414_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcaactctgtatcgggaa
JQ707407_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707408_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707404_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707401_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707396_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707395_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707392_C_P-A      tccgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707387_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707386_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707382_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707377_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707336_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgcatcgggaa
JQ707335_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707334_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707331_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707329_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707327_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707318_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707313_C_P-A      tctgacttctttccttccgtcagagatcttctggacaccgcctcagctctgtatcgggaa
JQ707310_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707311_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707330_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707343_C_P-A      tctgacttctttccttccgtcagagatctcctggacaccgcctcagctctgtatcgggaa
JQ707308_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707305_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707301_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgggaa
JQ707306_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgggaa
JQ707317_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgggaa
JQ707326_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgggaa
JQ707344_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgggaa
AY902775_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707371_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707372_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707373_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707374_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707375_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707376_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707378_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707379_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707380_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707381_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707383_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707385_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707389_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707390_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707391_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707393_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707394_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707397_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707398_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707399_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707400_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707402_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707403_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707405_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707406_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707409_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707410_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707411_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707412_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707413_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707416_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707417_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707418_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707420_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779264_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779335_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
KF779375_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707302_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707304_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707307_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707309_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707316_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707320_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707333_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707338_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707340_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707341_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707342_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707384_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
GQ477478_C_P-A      actgactactatccttccgtcagagatcttctagacaccgcctcagctctgtatcgagaa
AB453982_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477466_C_P-A      tctgacttctttccttccgtcagagatctcctrgacaccgcctcagctctgtatcgagaa
KP857084_C_P-A      tctgacttctttccttccgccagagatctcctagccaccgcctcagctctgtatcgagaa
KP857061_C_P-A      catgacttttttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477486_C_P-A      catgacttctttccttccgtcagagatctcctagacaccgccgcagctctgtttcgagaa
KP857080_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606650_C_P-A      tctgacttctttcctgccgtcagagatctcctagataccgcctcagctctgtatcgagaa
X02763_C_C-A        tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707577_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707595_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707596_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707605_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707600_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749834_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB697495_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707582_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagccctgtatcgagaa
JQ707594_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707607_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707598_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707551_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707578_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707563_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707602_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707576_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707593_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707590_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707581_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707603_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707580_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707574_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707575_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707579_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707583_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707584_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707585_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707586_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707587_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707588_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707589_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707591_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707597_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707599_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707604_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707606_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707608_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707592_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP718087_C_P-A      tctgacttctttccttccgtcagagatctcctagataccgcctcagctctgtatcgagaa
KM606663_C_P-A      tctgacttctttccttccgtcagagatctcctagataccgcctcagctctgtatcgagaa
KM606669_C_P-A      tctgacttctttccttccgtcagagatctcctagataccgcctcagctctgtatcgagaa
JQ707565_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707550_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707539_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707534_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB775198_C_P-A      tctgacttctttccttccgtcagagatctcctagataccgcctcagctctgtatcgagaa
AB697493_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB775199_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB775200_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB775201_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB937792_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB937793_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB937794_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707531_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707532_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707533_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707535_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707536_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707537_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707538_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707540_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707541_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707542_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707543_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707544_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707545_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707546_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707547_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707548_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707549_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707552_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707553_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707554_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707556_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707557_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707558_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707559_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707560_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707561_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707562_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707564_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707566_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707567_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707568_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707569_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707570_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707571_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707572_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707573_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707601_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
LC430617_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
LC458430_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
LC458431_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
LC592168_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
LC592169_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
LC592170_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707555_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KT749832_C_P-A      gctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
KX827297_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcaactctgtatcgagaa
KP857062_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtttcgagaa
GQ477495_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgttccgagaa
KJ843172_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477463_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU185786_C_P-A      aatgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY152726_C_P-A      tctgacttctttccttccgtcagagatcttctagacaccgcctcagctctgtatcgggaa
AB453983_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439886_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439887_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439888_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439890_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439891_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439892_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439893_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439894_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439895_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JF439889_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF419534_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgtctcagctctgtatcgagaa
AF419535_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgtctcagctctgtatcgagaa
KM606659_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU859938_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP857058_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB362931_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB222707_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB126580_C_P-A      tctgacttctttccctccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ477479_C_P-A      gctgactactatccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779210_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT448623_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
OK106253_C_P-A      tctgacttcttcccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KP857063_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843188_C_P-A      tctgacttctttccttccgtccgagatctcctagacaccgcctcagctctgtatcgagaa
KF779381_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
JQ707655_C_P-A      tctgatttctttccttccgtcagagagctcctagacaccgcctcagctctgtatcgagaa
EU859939_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgggaa
EU185787_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU185789_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF537371_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF324123_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GU563557_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JX310724_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JX310725_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
V00866_C_P-A        tctgacttctttccttccgtacgagatctcctagacaccgcctcagctctgtatcgagaa
GQ222208_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU747320_C_P-A      tctgacttctttccttccgtcagaaatctcctagacaccgcctcagctctgtatcgagaa
JQ707635_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707615_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707633_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707636_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707638_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707639_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707640_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707641_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707642_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707643_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707644_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707645_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707646_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707647_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707648_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707649_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707650_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707651_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707652_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707653_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707654_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707656_C_P-A      tctgatttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
X70185_C_P-A        tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843184_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779254_C_P-A      tctgacttctttcctttcgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603441_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AF536524_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcaactctgtatcgagaa
AB205118_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB014370_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AB480036_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EF208113_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779315_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779316_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779317_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KF779322_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606665_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606666_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603431_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603438_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603446_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603429_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603430_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603435_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY603436_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT448622_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
MT448626_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843166_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843173_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843215_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594388_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JX310723_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843192_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843214_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843216_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KJ843217_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606656_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606677_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606678_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KM606680_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY738140_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY738141_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY738139_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY738143_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
AY738142_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707665_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ184324_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
EU594387_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
GQ184323_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
HE576989_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707658_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707659_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707661_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707663_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707664_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707667_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707669_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707670_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707672_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707674_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707675_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707676_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
JQ707681_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
KY382410_C_P-A      tctgacttctttccttccgtcagagatctcctagacaccgcctcagctctgtatcgagaa
FN545837_C_P-A      tctgacttctttccttccgtccgagatctgcttgacactgcctcagcgctgtatcgggaa
AB076679_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggag
MH464811_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagctgcagctctgtatcgggaa
KF922429_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagccttagctctgtatcgggaa
KF922431_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagccttagctctgtatcgggaa
KF922430_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagccttagctctgtatcgggaa
MH464808_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcttcagctctgtatcgggaa
MH464809_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcttcagctttgtatcgggaa
KF922421_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
KF922417_C_P-A      tctgacttctttccttcagtacgggatttacttgatacagcatcagctctgtatcgggaa
KF922416_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
KF922420_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
KF922414_C_P-A      tctgacttctttccttcagtacgggatttacttgatacagcatcagctctgtatcgggaa
KF922415_C_P-A      tctgacttctttccttcagtacgggatttacttgatacagcatcagctctgtatcgggaa
KF922418_C_P-A      tctgacttctttccttcagtacgggatttacttgatacagcatcagctctgtatcgggaa
KF922419_C_P-A      tctgacttctttccttcagtacgggatttacttgatacagcatcagctctgtatcgggaa
AY233290_C_P-A      tctgatttctttccttcagtacgggatctacttgatacagcctcagctctgtatcgggaa
KF922435_C_P-A      tctgacttctttccttcagtacgggatctactggatacagcctcagctctgtatcgggaa
KF922436_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcctcagctctgtatcgggaa
MH464817_C_P-A      cctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
AF297622_C_P-A      tctgacttctttccttcagtacgggatctactagacacagcatcagctctgtatcgggaa
AF297621_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcttcagctctgtatcgggaa
KF922433_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcttcagctctgtatcgggaa
KF922434_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcttcagctctgtatcgggaa
KU605536_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
KU605537_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
KU605538_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
KU605539_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
MT210032_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcatcagctctgtatcgggaa
FJ692573_C_P-A      gctgacttctttccttcagtccgggatctacttgataccgcctcagctttgtatcgggaa
AB246317_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctttgtatcgggaa
GU563547_C_P-A      tctgacttctttccttcagtccgggatctacgtgatacaacctcagctctgtatcgggaa
FM199974_C_P-A      tctgacttttttccttcggtccgggatctacttgatacagcctcagctctgtatcgggat
FJ692587_C_P-A      aatgacttctttccttcagtccgggatctacttgataccgccgcagctttgtatcgggag
KF922437_C_P-A      tctgacttctttccttcagtacgggatctacttgatacagcctcagcactatatcgagaa
MT731865_C_P-A      tctgacttctttccttcagtccgggatctacttgataccgcctcagctctgtatcgggaa
KP168426_C_P-A      tctgacttctttccttcagtgcgggatctacttgatacagccttagctctgtatcgggaa
KP168422_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctctgcgctatatcgggaa
AY233279_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcttcagctttgtatcgggaa
AY233276_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcttcagctctgtatcgggaa
AY233287_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcttcagctctgtatcgggaa
FJ692592_C_P-A      tctgacttctatccttcagtccgggatctacttgataccgcctcagctttgtatcgggaa
MH464825_C_P-A      tctgacttctttcccccggtccgggatctacttggaacagccgcagctctgtatcgggaa
MK512464_C_P-A      tctgacttttttccttcagtccgggatctacttgatactgcctcagctctgtatcgggaa
MK512455_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgaatcgggaa
FM199977_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgcagcgggaa
KP168427_C_P-A      tctgacttctttccttcagtgcgggatctacttgatacagcctcagctctgtaccgagaa
KX357646_C_P-A      tctgacttctttccttcagtgcgggatctacttgatacagcctcagctctgtatcgggaa
FM199975_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctatatcgggaa
MT731929_C_P-A      tctgatttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
MK512461_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512475_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
AF297623_C_P-A      tctgacttctttccttcagtgcgggatctacttgacacagcctcagctctgtatcgggaa
AY233284_C_P-A      tctgacttctttccttccgtccgggatctacttgatacagcctcagcactgtatcgggaa
KT347087_C_P-A      tctgacttctttccttccgtccgggatctacttgatacagcctcagcactgtatcgggaa
AY233275_C_P-A      tctgacttctttccttccgtccgggatctacttgatacagcctcagcactgtatcgggaa
AY233281_C_P-A      tctgacttctttccttccgtccgggatctacttgatacagcctcagcactgtatcgggaa
KX648549_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgagaa
JN182334_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182332_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182326_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182325_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182331_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182329_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182328_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182327_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182323_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182318_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182320_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182321_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182322_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182324_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182330_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182333_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
JN182319_C_P-A      tctgacttctttccttccgtccgggatctacttgacaccgcctcagctctgtatcgggaa
AB076678_C_P-A      tctgacttctttccttccgtccgggatctacttgataccgcctcagctctgtatcgggaa
AM494718_C_P-A      tctgacttcttcccttctgtccgggatctacttgataccgcctcagctctgtatcgggaa
AY934773_C_P-A      tctgacttttttccttctgtccgggatctacttgataccgcctcagctctgtatcgggaa
AF297625_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512477_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512465_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagccctgtatcgggaa
MK512456_C_P-A      tctgacttctttccttcagcccgggatctacttgagacagcctcagctctgtttcgggaa
FM199976_C_P-A      tctgacttctttccttcagttcgggatctacttgacacagcctcagctctgtatcgggaa
JX154579_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
JX154580_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
JX154581_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
JX154582_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MT426092_C_P-A      tctgacttctttccttcagttcgggatctacttgatacagcctcagctctgtatcgggaa
MK512463_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512462_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
AY934766_C_P-A      tctgacttctttccttcagtgcgggatctacttgatacagcctcagctctgtatcgggaa
MK512476_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512469_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcatcagctctgtatcgggaa
FM199981_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctrtatcgggaa
MK512467_C_P-A      tctgacttctttccttcagttcgggatctacttgatacagcctcagctctgtatcgggaa
MK512474_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512458_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512460_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KP168435_C_P-A      tctgacttctttccttcagtgcgggatctacttgatacagcctcagctctgtatcgggaa
MK512466_C_P-A      tctgacttctttccttcagtccgggatttacttgatacagcctcagctctgtatcgggaa
DQ020002_C_P-A      tctgacttctttccttcagtccgggatctgcttgatacagcctcagctctgtatcgggaa
MK512471_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagccggagctctgtatcgggaa
GU563545_C_P-A      tctgacttctttccttcagtccgggatctatgtgatacagcctcagctctgtatcgggaa
MK512472_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512468_C_P-A      tctgacttctttccttcagtccgggatttacttgatacggcctcagctctgtatcgggaa
MK512459_C_P-A      tctgacttctttccttcagttcgggatctacttgatacagcctcagctctgtatcgggaa
FM199980_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctttgtatcgggaa
FM199978_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
AF324127_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512457_C_P-A      tctgatttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KP168423_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU736918_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU736919_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512473_C_P-A      tctgatttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
GU563548_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
FM199979_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MK512470_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MT426090_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MT426091_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctctatcgggaa
AY934772_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KP168424_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KP168425_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
AY233288_C_P-A      tctgacttctttccttcagtccgggatctacttgataccgcctcagctctgtaccgggaa
MH464812_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KX648547_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KP168434_C_P-A      tctgacttctttccttcagtccgggatctgctagatacagcctcagctctgtatcgggaa
HM535205_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
AY233282_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464829_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464824_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464826_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464827_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU605519_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU605518_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU605533_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU605534_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KX648548_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464821_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KF922409_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KF922407_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
HM535200_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
AY233285_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctcagtatcgggaa
AY233274_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464815_C_P-A      tctgacttttttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KT347088_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KF922408_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
AY233289_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
AY233283_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KF922406_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KJ010776_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KJ010777_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KJ010778_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU605520_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU605521_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU605522_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
KU605535_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464828_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464822_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464814_C_P-A      tctgacttctttccttcagwccgggatctacttgatacagcctcagctctgtatcgggaa
MH464810_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464813_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464818_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
MH464830_C_P-A      tctgacttctttccttcagtccgggatctacttgatacagcctcagctctgtatcgggaa
FJ692597_C_P-A      actgacttcttcccttccgtccgagatcttytagataccgcctcagctctgtttygggaa
FJ692607_C_P-A      gctgacttctttccttccgtacgagatctcctagataccgcctcagctctgtatcgggaa
FJ692609_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692610_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692600_C_P-A      actgattactatccwtccgtccgagatctcctagataccgcctcagctctstatcgggaw
FJ692599_C_P-A      tctgatttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692595_C_P-A      aatgacttctttccttccgtccgagatctcctagataccgccacagctctgtatcgggaa
FJ692593_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtttcgggaa
FJ692598_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692596_C_P-A      kctgacttctttccttccgtccgagatctactagataccgcctcagctctgtatcgggaa
FJ692613_C_P-A      tctgacttctttccttccatccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692611_C_P-A      gctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692602_C_P-A      gctgacttctttccttccgtccgagatctcctagataccgcctcagctctgcatcgggaa
FJ692605_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcrgctctgtatcgggaa
FJ692604_C_P-A      gctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692603_C_P-A      tctgacttctatccttccgtccgagatctcctagataccgccacagctctgtatcgggam
FJ692612_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692601_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692606_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FJ692608_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FN545832_C_P-A      gctgacttctttccttccgtycgagatctcctagataccgcctcagctctgtttcgggam
MF536820_C_P-A      tctgacttctttccttccgttcgagatctcctacacaccgcctcagctctctatcgggaa
AY934764_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtaccgggaa
GQ161813_C_P-A      tctgacttctttccttcagtaagagatcttctagataccgcctcagctctgtatcgggat
FN545839_C_P-A      kcggacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggat
LT992448_C_P-A      tctgacttctttccttcagtccgagatctcctagataccgcctcagctctgtatcgggaa
FN545833_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtttcgggaa
FN545834_C_P-A      tctgacttctttccttccgcccgagatctcctagagaccgcctcagctctgtatcgggaa
MH580627_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
MH580639_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
MH580642_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
MH580643_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
LT992440_C_P-A      tctgacttctttccttcggtccgagatctcctagataccgcctcagctctgtatcgggaa
LT992441_C_P-A      tctgacttctttccttcagtccgagatctactagataccgcctcagctctctatcgggaa
FN545828_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtttcgggaa
FN545829_C_P-A      tctgacttctttccttccgcccgagatctcctagataccgcctcagccctgtatcgggaa
FN545835_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctgtatcgggaa
FN545830_C_P-A      tctgacttctttccttccgtccgagatctcctagatacagcctcagccctgtttcgggaa
FN545840_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagccctgtatcgggaa
FN545838_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctatttcgggaa
AM180624_C_P-A      tctgacttctttccttccgttcgagatctcctagataccgcctcagctctatttcgggaa
AB194950_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcatcagcgctatatcgggaa
KY271391_C_P-A      tctgacttctttccttccgtccgggaccttctagataccgcctcagctctatatcgggaa
KY271389_C_P-A      tctgacttctttccttccgtccgggatctcctagataccgcctcagctctatatcgggaa
KY271390_C_P-A      tctgacttctttccttccgtccgagatctcctagataccacctcagctctatgtcgggaa
AM184126_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctatatcgggaa
EU054331_C_C-A      tctgacttctttccttccgtccgagatctcctcgataccgcctcagctctatatcgggaa
AM184125_C_P-A      tctgacttctttccttccgtccgggatctcctagataccgcctcagctctatatcgggaa
MF536814_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctgtaccgggaa
MN544634_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctatatcgggaa
MF536815_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatttcgggaa
MF536810_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536811_C_P-A      tctgacttctttccttccgtccgagatctcctacacaccgcctcagctctatatcgggaa
FN545825_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctatatcgggaa
AB194952_C_P-A      tctgacttctttccttccgtccgagatctcctagatacctccgcagctctatatcgggaa
HM363612_C_P-A      tctgacttctttccttccgtccgagatctcctagatacctccgcagctctatatcgggaa
HM363613_C_P-A      tctgacttctttccttccgtccgagatctcctagatacctccgcagctctatatcgggaa
AB194951_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctatatcgggaa
MT622525_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctatatcgggaa
MF536846_C_P-A      tctgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536823_C_P-A      actgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536827_C_P-A      actgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536836_C_P-A      actgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536821_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536819_C_P-A      tctgacttctttccttccgtccgagatcttctacataccgcctcagctctatatcgggaa
MF536867_C_P-A      tctgacttctttccttccgtccgagatcttctacataccgcctcagctctatatcgggaa
MF536869_C_P-A      tctgacttctttccttccgtccgagatcttctacataccgcctcagctctatatcgggaa
MF536824_C_P-A      tcggacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536828_C_P-A      tcggacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536833_C_P-A      tcggacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536837_C_P-A      tcggacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536843_C_P-A      tcggacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536845_C_P-A      tcggacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536848_C_P-A      tcggacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536849_C_P-A      tcggacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536816_C_P-A      tctgacttctttccttccgttcgagatctcctacataccgcctcagctctatatcgggaa
MF536853_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536857_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536808_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536831_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536825_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536839_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536841_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536842_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536807_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536830_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536852_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536865_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536868_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536817_C_P-A      tctgacttctttccttccgttcgagatctcctacataccgcctcagctctatatcgggaa
MF536861_C_P-A      tctgacttctttccttccgttcgagatctcctacataccgcctcagctctatatcgggaa
MF536862_C_P-A      tctgacttctttccttccgttcgagatctcctacataccgcctcagctctatatcgggaa
MF536818_C_P-A      tctgacttctttccttccgctcgagatctcctacataccgcctcagctctatatcgggaa
MF536854_C_P-A      tctgacttctttccttccgttcgagatctcctacataccgcctcagctctatatcgggaa
MF536855_C_P-A      tctgacttctttccttccgttcgagatctcctacataccgcctcagctctatatcgggaa
MF536858_C_P-A      tctgacttctttccttccgttcgagatctcctacataccgcctcagctctatatcgggaa
MF536809_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536832_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536859_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536860_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536813_C_P-A      tctgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536822_C_P-A      tctgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536826_C_P-A      tctgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536835_C_P-A      tctgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536840_C_P-A      tctgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536844_C_P-A      tctgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536850_C_P-A      tctgacttttttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536847_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcctcagctctatatcgggaa
MF536812_C_P-A      tctgacttctttccttccgtccgagatctcctacataccgcatcagctctatatcgggaa
MF536806_C_P-A      tctgacttctttccttccgtacgagatctcctacataccgcctcagctctatatcgggaa
MF536829_C_P-A      tctgacttctttccttccgtacgagatctcctacataccgcctcagctctatatcgggaa
MF536838_C_P-A      tctgacttctttccttccgtacgagatctcctacataccgcctcagctctatatcgggaa
MF536851_C_P-A      tctgacttctttccttccgtacgagatctcctacataccgcctcagctctatatcgggaa
MF536856_C_P-A      tctgacttctttccttccgtacgagatctcctacataccgcctcagctctatatcgggaa
MF536863_C_P-A      tctgacttctttccttccgtacgagatctcctacataccgcctcagctctatatcgggaa
MF536864_C_P-A      tctgacttctttccttccgtacgagatctcctacataccgcctcagctctatatcgggaa
MF536866_C_P-A      tctgacttctttccttccgtacgagatctcctacataccgcctcagctctatatcgggaa
MN585097_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctatatcgggaa
FN545826_C_P-A      tctgacttctttccttccgttcgagatcttctagataccgcctcagctctctatcgggaa
FJ692555_C_P-A      catgacttctttccttccgtccgagatctcctagataccgcctcasctctgtatcgggaa
MW567969_C_P-A      tccgacttctttccttccgtccgagatctcctagacaccgcctcagctctgtatcgggaa
EU304331_C_P-A      ymtgacttctttccttccgtccgggatctactagacacagcctcagctttgtatcgggaa
MG877723_C_P-A      yctgacttctwtccttccgtccgggatctactagacacagcctcagctttgtatcgggaa
MG877724_C_P-A      yctgacttctwtccttccgtccgggatctactagacacagcctcagctttgtatcgggaa
MG877725_C_P-A      yctgacttctwtccttccgtccgggatctactagacacagcctcagctttgtatcgggaa
MW567968_C_P-A      ggggacttctatccttccgtccgagacctcctagacaccgcctcagctttatatcgggaa
FJ349296_C_P-A      tctgacttctttccttccgttcgagatcttctaaacaccgcctcagctctctatcgggaa
EU366129_C_P-A      tctgacttttttccttccgtccgggatctactagatacagccgcagctctgtttcgggag
FJ904411_C_P-A      tctgacttctatccttcagtccgggatctcctagataccgcctcagctctgtttcgggaa
MN585096_C_P-A      tctgacttctttccttccgtccgagatctactagataccgcctcagctctgtatcgggaa
MT210034_C_P-A      nntgacttctntccttccgtccgggatctcctagatacagcctcagctctgtatcgagaa
FJ904434_C_P-A      cgtgacttctttccttcagtccgggatctcctagataccgcctcagctctgtatcgggaa
MF772345_C_P-A      tctgacttctttccttcaatccgggatctcctagacactgcctcagctctgtatcgggaa
AB116084_C_P-A      tctgacttctttccttccgtccgggatctactagatactgcctcagctctgtatcgggaa
MT114170_C_P-A      tctgacttctttccttccgtccgggatctactagatactgcctcagctctgtatcgggaa
KY353919_C_P-A      gctgacttctttccttccgtccgggatctactagatacatcctcagctctgtttcgggaa
GQ331046_C_P-A      gctgacttctttccttccgtccgggatctactagataccgcctcagctctgtttcgggaa
FJ692561_C_P-A      ymtgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
MF925362_C_P-A      catgacttctttccgaatgtccgggatctactagatacagcctcagctctgtttcgggaa
KJ854701_C_P-A      tctgatttctttcctaccgcccgggatctacttgatacagcctcagctctgtatcgggaa
KY353918_C_P-A      tctgacttctttccttcagtacgggatctactagatacagccgcagctctgtttcgggat
KM606649_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctttgtatcgggaa
AB116092_C_P-A      tctgacttctttccttccgtccgggatctactagatacagtcgcagctctatttcgggat
FJ692586_C_P-A      gctgacttctttccttccgcccgggatctactagatacagcctcagctctgtatcgggaa
AF350081_C_P-A      tctgacttctttccttcagttccagatctcctagataccgcctcagctctgtatcgggaa
MF772348_C_P-A      tctgacttctttccttcagtccgggatctcctagacaccgcctcagctctgtttcgggaa
MF772346_C_P-A      tctgacttctttccttcagtccgggatctcctagacaccgcctcagctctgtatcgagaa
MF772347_C_P-A      tctgacttctttccttcagtccgggatctcctagacaccgcctcagctctgtatcgggaa
GQ477464_C_P-A      cttgacttctttccttcagtccgagatctcctggacaccgcctcagctctgtatcgggaa
MF772344_C_P-A      tctgacttctttccttcagtccgggatctcctagacaccgcctcagctctgtatcgggaa
KM606660_C_P-A      tctgacttctttccttcagtccgagatctcctagacaccgcctcagctctgtatcgggaa
MF772350_C_P-A      tctgacttctttccttcagtccgggatctcctagacaccgcctcagctctgtatcgggaa
KP168428_C_P-A      tccgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
AY161142_C_P-A      tctgacttctttccttccgtcagagatctcctagatacagcctcagctctatatcgggaa
AY161143_C_P-A      tctgacttctttccttccgtcagagatctcctagatacagcctcagctctatatcgggaa
AY161144_C_P-A      tctgacttctttccttccgtcagagatctcctagatacagcctcagctctatatcgggaa
KX276769_C_P-A      tctgacttctttccttccgtccgggatctactagatactgcctcagctctgtttcgggaa
HM042263_C_P-A      tctgacttctttccttcagtacgagatcttctagataccgcctcagctctgtatcgggat
KX357650_C_P-A      gctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
AB453989_C_P-A      tctgacttctttccttccgtccgagatctactagatacagcctcagctctgtatcgggaa
AF350087_C_P-A      tctgacttctttccttcagtccgagatctccttgataccgcctcagctctgaatcgtgaa
AF350088_C_P-A      tctgacttctttccttccgtccgagatctccttgataccgcctcagctctgtatcgggaa
KX357649_C_P-A      cgagacttctatccttccgtccgggatctaatagacacagcctcagctctatttcgggaa
AB116086_C_P-A      tctgacttctttccttccgtccaggatctactagatacagcctcagctctgtatcgggaa
FJ692564_C_P-A      tctgacttctttccttccgcccgggatctactagatacagcctcagctctctatcgggaa
FJ692565_C_P-A      tctgacttctttccttccgcccgggatctactagatacagcctcagctctctatcgggaa
KX357640_C_P-A      tctgacttttttccttccgttcgggatctcctagacacagcctcagctctatatcgggaa
EF103278_C_P-A      tctgacttttttccttccgtccgagatctactagatacagcctcagctctgtatcgggaa
OK318690_C_P-A      tctgacttctttccttccatccgggatctactagatacagcctcagctctatatcgggat
KP857065_C_P-A      tctgacttttatccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KT151612_C_P-A      tctgacttctttccttccgtycgggatctactagatacagcctcagctctgtatcgggaa
KT151617_C_P-A      tctgacttctttccttccgttcgggatctactagatacagcctcagctctgtatcgggaa
MF925368_C_P-A      tctgacttctttccttcagtacgggatctactagataccgcctcagctctgtatcgggaa
AF324072_C_P-A      tcggacttctttccttccgtccgggatctactagatacagcttcagctctatatcgggaa
KR905427_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcatcagctttatatcgggaa
FJ692558_C_P-A      tatgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgagaa
AB116088_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatttcgggaa
MF925400_C_P-A      tctgacttctttccttcagtacgggatctactagataccgcctcagctctgtatcgggaa
EU859952_C_P-A      tctgacttctttccttccgtccgggatctccttgataccgcctcagctctgtatcgggaa
GQ331047_C_P-A      tctgacttctttccttccgtccgggatctccttgataccgcctcagctctgtatcgggaa
OK318683_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatttcgcgaa
KF214666_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
MW567976_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctaccgggaa
KP168431_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692567_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggat
AB116082_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
MW567972_C_P-A      tctgacttctttccttccgcccgagatctcctggataccgcctcagctctctatcgggaa
FJ692576_C_P-A      actgacttctttccttccgtccgagatctactagatacagcctcagctctgtatcgggaa
KJ854685_C_P-A      tctgacttctttccttccgtccgggatctactggacacagcctcagctctgtatcgggaa
OK318682_C_P-A      tctgacttctttccttcagtycgggatctactagatacagcctcagctctatatcgggaa
KY353916_C_P-A      tctgacttttttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KY353917_C_P-A      tctgacttctttccttcagtacgggatctactagataccgcctcagctctgtatcgggaa
KY353915_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KP857090_C_P-A      tctgacttctttccttccgcccgagacctcctagataccgcctcagctctatatcgggaa
OK318691_C_P-A      tctgacttctttcctaacgtccgggatctactagatacagcctcagctctatatcgggaa
KM606647_C_P-A      ttggacttctttccttccgcccgggatctactagagacagcctcagctctgtatcgggaa
AB453986_C_P-A      tctgacttctttccttccgttcgggatctactagatacagcctcagctctatatcgggaa
AB116091_C_P-A      tctgacttctttccttccgtccgggatctactagatacagccaccgctctgtatcgagaa
JF439744_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439724_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggga
JF439729_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439751_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439748_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439740_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439734_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439738_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439750_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439743_C_P-A      tctgacttctttccttccgtacgagatctcctagataccgcctcagctctctatcgggaa
JF439720_C_P-A      tctgacttctttccttccgtacgagatctcctagataccgcctcagctctctatcgggaa
JF439721_C_P-A      tctgacttctttccttccgtacgagatctcctagataccgcctcagctctctatcgggaa
JF439731_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439730_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439741_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439728_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439726_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439747_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439723_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439727_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439735_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439736_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439746_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439725_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439908_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439900_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439897_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439898_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439899_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439901_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439902_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439903_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439904_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439905_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439906_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439907_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439910_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439896_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439909_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439737_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439722_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439732_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439733_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
JF439742_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350089_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
MW567975_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
MW567973_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350094_C_P-A      tctgacttctttccttccgtccgagatcttctagataccgcctcagctctctatcgggaa
AF350090_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
KM606737_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350096_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctttatcgggaa
AF350093_C_P-A      tctgacttttttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350092_C_P-A      tctgacttttttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350082_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctttatcgggaa
AF350095_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctttatcgggaa
AF350091_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350097_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350080_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctttatcgggaa
AF350098_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctttatcgggaa
AF350083_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350084_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350085_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
AF350086_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctctatcgggaa
OK318696_C_P-A      tctgacttctttccttccgtccgggatctgctagatacagcctcagctctatatcgggaa
FJ692577_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
LC462120_C_P-A      tctgacttctttccttccgtccgagatctcctarataccgcctcagctctgtatcgggaa
FN545831_C_P-A      tctgacttctttccttccgtccgagatctcctagataccgcctcagctctatatcgggaa
FJ692554_C_P-A      tctgacttctttccttccgttcgagatctcctagataccgcctcagctctatatcgggaa
FN545836_C_P-A      tctgacttctttccttccgtccgagacctcctagataccgcctcagctctatatcgggaa
KY353913_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KX357644_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KF214660_C_P-A      tctgacttctttccttccgtccgggatctacaagatacagcctcagctctatatcgggaa
FJ692562_C_P-A      gctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
AY934763_C_P-A      tctgacttctttccttccgtccgagatctcctggacaccgcctcagctctgtatcgggaa
KP168429_C_P-A      tctgacttctttccttccgtccgggatctactagatacascctcagctctgtatcgggaa
JQ023663_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
JQ023662_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
JQ023660_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
JQ023661_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KP168433_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KP168432_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcttcagctctgtatcgggaa
MN476101_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KP168430_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
MN476102_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692570_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692559_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KY353926_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KJ194506_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgcatcgggaa
OK318685_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcatcagctctatatcgggaa
KF214661_C_P-A      tctgacttctttccttccgtacgggatctactagatacagcctcagctctatatcgggaa
AB246336_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcttcagctctgtatcgggaa
AB116087_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
OK318692_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KY353909_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KF214662_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
HM011485_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
AF324107_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctacatcgggaa
DQ315785_C_P-A      tctgacttttttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AB116089_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
FJ692572_C_P-A      tctgacttctttccttccgttcgggatctactagatacagcctcagctctgtatcgggaa
AB116090_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcttcagctctgtatcgggaa
AY903452_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
MF925373_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ854686_C_P-A      tctgacttctttccttccgtccgggatctactagacaccgcctcagctctgtatcgggaa
KF779332_C_P-A      tctgacttctttccttccgtccgggatctactagacaccgcctcagctctgtatcgggaa
AB116093_C_P-A      tctgacttctttccttccgtccgggatttactagatacagcctcagctctgtatcgggaa
AY934771_C_P-A      tctgacttctttccttccgttcgggatctactagatactgcctcagctctgtatcgggaa
OK318688_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KU736920_C_P-A      tctgacttctttccttccgtccgggatctwctagatacmgcctcagctctatatcgggaa
KJ854700_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcatcagctctgtatcgggaa
KJ854690_C_P-A      tctgatttctttccctccgtccgggatctacttgatacatcctcagctctgtatcgggaa
MF772353_C_P-A      tctgacttttttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KX686607_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KM606748_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KM606673_C_P-A      tctgatttctttccttccgtccgggatttacttgatacagcctcagctctgtatcgggaa
KJ854698_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KJ854694_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
DQ020003_C_P-A      tctgacttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KJ854687_C_P-A      tctgacttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KJ854707_C_P-A      tctgacttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
MF772351_C_P-A      tctgacttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KP718085_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KP718086_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KC836846_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KJ854693_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KJ854699_C_P-A      tctgatttctttccttccgtccgggatctacttgatacagcctcagctctgtatcgggaa
KT151615_C_P-A      yytgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF798265_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatttcgggaa
KR905425_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatttcgggaa
KT366466_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatttcgggaa
KX357645_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KT151611_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KJ854706_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KF798292_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF798267_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KR905426_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KT366467_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875257_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
FJ692575_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctttgtatcgggaa
AY934765_C_P-A      tctgatttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
AB116085_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
FJ692588_C_P-A      tctgacttttttccttccgtccgggatctattagatacagcctcagctctgtatcgggaa
AB116083_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
AY934767_C_P-A      tctgatttctttccttccgtccgggatctactagatacagcttcagctctgtatcgggaa
AY934770_C_P-A      tctgatttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
AY934768_C_P-A      tctgatttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
AY934769_C_P-A      tctgatttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692566_C_P-A      tctgacttctttccttccgtccgggatctactagatacagccgcagctctgtatcgggaa
AY373429_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
MF925372_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875259_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
OK318695_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
MF925361_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KM243029_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KJ854704_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ854688_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KF798310_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF798266_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcttcagctctatatcgggaa
KF214659_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KM519452_C_P-A      tctgacttctttccttccgtccgggatctactagatactgcctcagctctgtatcgggaa
KM519453_C_P-A      tctgacttctttccttccgtccgggatctactagatactgcctcagctctgtatcgggaa
KF798271_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KR905429_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF214658_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
MF925385_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
AB116094_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
AB937795_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
MF925407_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
MZ093431_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
AB453987_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
OK318687_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
OK318686_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
OK318694_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
OK318693_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AB453988_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KJ854703_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
DQ315786_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KX357647_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KX357642_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KX357643_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
OK274310_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
M74501_C_P-A        tctgacttctttccttccgtccgggatctactagacacagcctcagctttgtatcgggaa
LK995385_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcatcagctctatatcgggaa
KT151614_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KJ854702_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ854691_C_P-A      tctgacttttttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ843183_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ854697_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KF922426_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KF922427_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KF922428_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KF922424_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KF922425_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
KF798291_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF798286_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KT366469_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctatatcgggaa
KF214657_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875255_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875253_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875251_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
EU410082_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AY373428_C_P-A      tctgacttctttccttccgtccgggatttactagatacagcctcagctctgtatcgggaa
AF090842_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
M57663_C_P-A        tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
HM042278_C_P-A      tctgacttctttccttccgttcgggatctactagatacagcctcagctctatatcgggaa
FJ692590_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
FJ692591_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AB937791_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AB937796_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AY233278_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
LC051141_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AY934774_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
OK318684_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
MT426088_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KT151618_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KT151616_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KT151613_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KR905431_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgagaa
KF798314_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcttcagctctatatcgggaa
KF798302_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF798290_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF798285_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgagaa
KF798311_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgagaa
KT366468_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgagaa
KF798279_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgagaa
KF798289_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgagaa
KR905430_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgagaa
KT366470_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgagaa
KF798278_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF214663_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875258_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875256_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875252_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
DQ315784_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AB241114_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AB246335_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KY353912_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
AY373432_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KC875254_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF214665_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF798308_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KF798309_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
KT366471_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
OK318689_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctatatcgggaa
FJ692571_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692563_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
AF043560_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ854705_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
AB241115_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692557_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692574_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692578_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692579_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692580_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692581_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692582_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692583_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692584_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
FJ692585_C_P-A      tctgacttctttccttccgtccgggatctactagatacagcctcagctctgtatcgggaa
MT448635_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
MT448636_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ854689_C_P-A      tctgacttttttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ854692_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
KJ854696_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
MN053840_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
MT448633_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
MT448637_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
MT448624_C_P-A      tctgacttctttccttccgtccgggatctactagacacagcctcagctctgtatcgggaa
                       *     *  **           *  *        *        *             

AB697487_C_P-A      gccttagagtctcckgarcattgytcacctcaccatacwgcactcaggcaagcyattcts
AB697498_C_P-A      gccttagagtctcckgarcattgytcacctcaccatacwgcactcaggcaagcyattcts
KP857066_C_P-A      gccttagagtctccggagcattgcacacatcatcatactgcactcaggcaagccattctc
EU414132_C_P-A      rccttagagtctcytgagcattgctcacctcmccatactgcactcaggcaagccattcty
GQ477473_C_P-A      ggcttagagtcacctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP857072_C_P-A      gccttagagtctcctgagcatggctcatctcaccatactgcactcaggcaagccattctc
KP857079_C_P-A      gccttagagtctcctgagcatgkctcacctcaccatactgcactcaggcaagccattctm
KP857091_C_P-A      gccttagagtctcctgagcattgctcacatcaccataccgcaatcaggcaagccattctc
KP857078_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
KP857067_C_P-A      gccttagagtctgctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP857074_C_P-A      gccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctc
KP857073_C_P-A      gccttagagtctcctgagcattgctcagctcaccatactgcaatcaggcaagccattcta
KP857064_C_P-A      gccttagaggctcctgagcattgctcacctcaccatactgcactcaggcaagccattcta
GQ477462_C_P-A      gccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439821_C_P-A      gccttaaagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439926_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439925_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439911_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439921_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439915_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439912_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439913_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439914_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439916_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439917_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439918_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439919_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439920_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439922_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439924_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439927_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439923_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439931_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439935_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439941_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439933_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439932_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439930_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439928_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439938_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439937_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439939_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439942_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439936_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439940_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439929_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
JF439934_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
KP857076_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP857088_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcaatcaggcaagccattctc
GQ477493_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcaatcaggcaagccattctc
AJ627228_C_P-A      gccttggagtctcctgagcattgctcacctcatcatactgcaatcaggcaatgcgttctc
KP857081_C_P-A      gccttagagtctcmtgagcattgcacacctcaccatactgcactcaggcaagccattctc
GQ477475_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcaatccggcaagtcgttcta
KM606695_C_P-A      gccttagagtctcatgagcattgctcacctcaccatactgcactcaggcaagccattcta
GQ477501_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattcta
GQ477477_C_P-A      gccttagagtctcctgagcattgctcatctcaccatactgcaatcaggcaagccattctc
KT749822_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattcta
KP857077_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctc
GQ477504_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477499_C_P-A      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccattctc
AJ344115_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
KP857059_C_P-A      gccttagagtctcctgagcattgctcatctcaccatactgcactcaggcaagccattctc
GQ477487_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477500_C_P-A      gccttagagtcttctgagcattgctcacctcaccatactgcaattaggcaagtcattctc
EU414052_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU414133_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477491_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AY603432_C_P-A      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctc
EU414049_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP857085_C_P-A      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccattctc
KM606657_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477472_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU414050_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477488_C_P-A      gccttagagtctcctgagcattgctcacatcaccatactgcaatcaggcaagccattctc
GU827640_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
AF324071_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606661_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477484_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477470_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477465_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477490_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477482_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattatc
KP718102_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718092_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattyts
KM606653_C_P-A      gccttggagtctcctgagcattgctcacctcaccatactgcactcaggcaagaaattctc
GQ477494_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgtgcta
GQ477498_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
EU185776_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU185777_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattcty
KM606658_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779384_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779221_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattgtc
GQ477468_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattcta
AF324126_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606688_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccgttctc
KF779361_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
KJ586809_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GU563551_C_P-A      gccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagccattctc
AJ309369_C_P-A      gccttagagtctcctgagcactgctcacctcaccatactgcactcaggcaagccattctc
AJ309371_C_P-A      gccttagagtctcctgagcactgctcacctcaccatactgcactcaggcaagccattctc
AJ309370_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP995108_C_P-A      gccttagagtctcctgagcatggctcacctcaccatactgcactcaggcaagccattgtc
KF779272_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattgtc
KP718095_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779213_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779215_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324118_C_P-A      tccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagaaattctc
AB116076_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324122_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU185774_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749836_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749833_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattgtc
KP718100_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606742_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
KM606692_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779371_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779365_C_P-A      gctttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779211_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattgtc
KC836858_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439830_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477496_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859934_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
DQ788725_C_P-A      gccttagagtcgcccgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697488_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779280_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779281_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779334_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439832_C_P-A      gccttagagtctcctgggcattgctcacctcaccatactgcactcaggcaagccattctc
L13994_C_P-A        gccttagagtcgcccgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718089_C_P-A      gccttagagtytcctgagcattgctcacctcaccatactgcactcaggcaagccattyty
KF779284_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606672_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606694_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606749_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
MT426096_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
MT426095_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KX827298_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KX827293_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749831_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606676_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattcta
KJ854709_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779386_C_P-A      gccttagagtctcctgagcattgctcacctcaccatachgcactcaggcaagccattctc
KF779385_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779283_C_P-A      gccttagagtcacctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779282_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcagacaagccattctc
KF779249_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779240_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707662_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ687533_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439859_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ414522_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859944_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AY233286_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AM282986_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctc
AY707087_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctc
AF324148_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324120_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB116078_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB064314_C_P-A      gccttagagtctcctgagcattgctcacctcaccatacggcactcaggcaagccattctc
KC836834_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594384_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594386_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718101_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718096_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779293_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779346_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JX096953_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477503_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JX096952_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779347_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
MW401519_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718094_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718088_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718090_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718097_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718098_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718099_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP718091_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KJ854708_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779268_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779360_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779279_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779370_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606674_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606684_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606685_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606691_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
MT426097_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
MN507849_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
LC311242_C_P-A      gccttagagtctcctgagcattgttcacctaaccatactgcactcaggcaagccattctc
LC074724_C_P-A      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctc
LC311241_C_P-A      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctc
LC311243_C_P-A      gccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctc
KT749844_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749843_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749839_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749838_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749829_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749824_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP274925_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KJ843182_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779372_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779351_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779336_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779333_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779329_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779323_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779325_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779308_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779299_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779309_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779298_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779297_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779295_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779294_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779287_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779270_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779266_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779257_C_P-A      gccttagagtctcctgagcattgctcaccgcaccatactgcactcaggcaagccattctc
KF779253_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779256_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779271_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779238_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779232_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779227_C_P-A      gccttagagtctcctgagcattgctctcctcaccatactgcactcaggcaagccattctc
MT426098_C_P-A      gccttagagtctcctgagcattgctctcctcaccatactgcactcaggcaagccattctc
KC836831_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JX310722_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606652_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749850_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JX310721_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707634_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707623_C_P-A      gccttagagtttcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707620_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707612_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707609_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707610_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707611_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707613_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707614_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707616_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707617_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707618_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707619_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707621_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707622_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707624_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707625_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707626_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707627_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707628_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707629_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707630_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707631_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707632_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ707637_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439864_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439861_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439855_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439853_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439848_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439845_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439839_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439829_C_P-A      gccttagagtctcctgagcattgctcacctcaccatgctgcactcaggcaagccattctc
JF439828_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439826_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439825_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439822_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439820_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439824_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439827_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
HE576988_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
Z35717_C_P-A        gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GU563558_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GU563550_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
FJ349222_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859956_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439836_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KJ843218_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859942_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KP274927_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749825_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749826_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749842_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749846_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749847_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KT749849_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859919_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859912_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859899_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859900_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859901_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859902_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859903_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859904_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859905_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859906_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859907_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859908_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859909_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859910_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859911_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859913_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859915_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859916_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859917_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859920_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859921_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859922_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859923_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859924_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859925_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859926_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859927_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859928_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
KP274928_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
KT749837_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU859898_C_P-A      gccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagccattctc
EU594394_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594395_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU185746_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AY862868_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439835_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439837_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AM295796_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AM295795_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AM295797_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AM410963_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594383_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779255_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779259_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
MT426094_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
MT426099_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324147_C_P-A      gctttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324133_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF090839_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF090840_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594389_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594390_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594391_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594392_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859945_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859950_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779231_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779319_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779379_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KJ854710_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM519454_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KM606648_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697511_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324135_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779252_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697491_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB480040_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KY886219_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB116081_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB116079_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB116080_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB300367_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB453979_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB453980_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB453984_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB480038_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB480041_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697489_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697496_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697497_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697499_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697501_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697503_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697504_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697505_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697508_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697509_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697512_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB937798_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AY161138_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AY161139_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779305_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
LC517161_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
MH932713_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
X07911_C_P-A        gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB116077_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JQ687529_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859935_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859936_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439862_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439852_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
KF779313_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB246337_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB246338_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB300366_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB453981_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB480039_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB549213_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697492_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697506_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AB697507_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF043580_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF297624_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324125_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324128_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AF324136_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AY128092_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AY233280_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
AY862867_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU086721_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU185750_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594385_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU594393_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859914_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859918_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859929_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859930_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859931_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859932_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859933_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859937_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859940_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859941_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859943_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859946_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859947_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859948_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859949_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859951_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859953_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859954_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
EU859955_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
FJ349224_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477461_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GQ477467_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GU563546_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GU563553_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GU563554_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GU563555_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
GU563562_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439819_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439823_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439831_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439833_C_P-A      gccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
JF439834_C_P-A      gccttagagtctcctgagca<