HBVdb

Dataset for nucleotide sequence C of genotype A

[Download (right click)] [Alignment] [Repertoires]

1614 sequence(s)

>gnl|hbvcds|AB014370_C_P-A Feature FT:CDS AB014370_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB064314_C_P-A Feature FT:CDS AB064314_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatacgg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggttccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB076678_C_P-A Feature FT:CDS AB076678_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB076679_C_P-A Feature FT:CDS AB076679_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaggccttagagtctccggagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggtggaattaacgactctagctacctgggtgggtaataatttggaagatcatgca
tccagggacctagtagtcaattatgtaaatgataatatgggactaaagctcagacaactattgtggtttcatatttcttg
ccttacttttggaaaacaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatcgac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagagaccgaggcgggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116076_C_P-A Feature FT:CDS AB116076_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA1911). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcaagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagacactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AB116077_C_P-A Feature FT:CDS AB116077_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA2126). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116078_C_P-A Feature FT:CDS AB116078_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcaagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataacttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116079_C_P-A Feature FT:CDS AB116079_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116080_C_P-A Feature FT:CDS AB116080_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116081_C_P-A Feature FT:CDS AB116081_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116082_C_P-A Feature FT:CDS AB116082_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtagagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcaccgcaccacacag
cactcaggcaagctgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116083_C_P-A Feature FT:CDS AB116083_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgttgagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB116084_C_P-A Feature FT:CDS AB116084_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN81). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcatttttgccgtctgacttctttccttccgt
ccgggatctactagatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgtcaatactaacatgggcttaaagatcaggcaactattgtggtttcatacttcttg
ccttacttttggaagagacactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgcgaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB116085_C_P-A Feature FT:CDS AB116085_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN83). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctttgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116086_C_P-A Feature FT:CDS AB116086_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggacttactctcgtttttgccttctgacttctttccttccgt
ccaggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgtgcattgctcacctcaccatacag
cactaaggcaagccattctctgctggggggaattaaggactctaggtacctgggtgggtaataatttggacgatcaagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagatactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AB116087_C_P-A Feature FT:CDS AB116087_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacgtcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgagtccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB116088_C_P-A Feature FT:CDS AB116088_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacctttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatttcgggaagccttagagtctcctgagcattgctcatctcaccatacag
cactcaggcaagccattgtatgctggggggaattaatgactctaggtacctgggtgggtaataatttggaagatccagaa
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
cctcacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116089_C_P-A Feature FT:CDS AB116089_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagccagtctctgctgggtggaattaatgactctagctacctgggtggggaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaagttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116090_C_P-A Feature FT:CDS AB116090_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacatttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116091_C_P-A Feature FT:CDS AB116091_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagccaccgctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgtcaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagacactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB116092_C_P-A Feature FT:CDS AB116092_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH20). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagtcgcagctctatttcgggatgccttagagtctcctgagcattgctcagctcaccacacag
cactaaggcaagtcattctctgctggggggaattaatgactctagctacctgggtgggtactaatttgcaagatccagca
tccagggatctagtagtcagttatgttaatgataacatgggcctaaagatcaggcaattattatggtttcatacttcttg
cattacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB116093_C_P-A Feature FT:CDS AB116093_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatttactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagagactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB116094_C_P-A Feature FT:CDS AB116094_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctttgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB126580_C_P-A Feature FT:CDS AB126580_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgaccctcataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccctccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctggtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB194950_C_P-A Feature FT:CDS AB194950_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR983). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcatcagcgctatatcgggaagcactagagtctcctgagcattgctcgcctcaccatacag
cactcaggcaagccattctctgctggggggatgtaacgaatctagctacctgggtgggtactaatttggacgatcccgca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB194951_C_P-A Feature FT:CDS AB194951_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctatatcgggaagcccttgagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaacgaatctagccacctgggtgggtactaatttggaagatccggca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaacagtacttgaatatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB194952_C_P-A Feature FT:CDS AB194952_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR711). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagatacctccgcagctctatatcgggaagcccttgagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggagttaatgactctagccacctgggtgggtaataatttgcaagatccggca
tccagggatcaagtagtaaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagacagactgtacttgaatatttggtttctttcggagtgtggattcgcactcctccaccctatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB205118_C_P-A Feature FT:CDS AB205118_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TJ1-1-2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaacaactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB222707_C_P-A Feature FT:CDS AB222707_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate UZTBV102). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB241114_C_P-A Feature FT:CDS AB241114_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB241115_C_P-A Feature FT:CDS AB241115_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggtgaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246317_C_P-A Feature FT:CDS AB246317_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate TA112). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccgtactatgctggggggaattaatgactctagctacctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaggtcagacaactattgtggtttcatatttcttg
cattacttttggaagacaaactgtcggtgagtttttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246335_C_P-A Feature FT:CDS AB246335_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246336_C_P-A Feature FT:CDS AB246336_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactggcgagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactgttgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtacttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246337_C_P-A Feature FT:CDS AB246337_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB246338_C_P-A Feature FT:CDS AB246338_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300366_C_P-A Feature FT:CDS AB300366_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB300367_C_P-A Feature FT:CDS AB300367_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB362931_C_P-A Feature FT:CDS AB362931_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggatgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB453979_C_P-A Feature FT:CDS AB453979_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB453980_C_P-A Feature FT:CDS AB453980_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB453981_C_P-A Feature FT:CDS AB453981_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB453982_C_P-A Feature FT:CDS AB453982_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcatctcaccatactg
cactcaggcaagccattctctgctggggggaattgacgactctaggtacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AB453983_C_P-A Feature FT:CDS AB453983_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctatgctgggtggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggacctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB453984_C_P-A Feature FT:CDS AB453984_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH6). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB453986_C_P-A Feature FT:CDS AB453986_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
tcgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaacgactctaggtacctgggtgggtaataatttgcaagatcaaaca
tccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB453987_C_P-A Feature FT:CDS AB453987_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB453988_C_P-A Feature FT:CDS AB453988_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactccaccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB453989_C_P-A Feature FT:CDS AB453989_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH11). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcagctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactttagctacctgggtgggaaataatttggaagatccagca
tccagggacctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatacttcttg
cattacttttggaagagaaattgtccttgagtatttggtctctttcggagtgtggattcgcactccaccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgataccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AB480036_C_P-A Feature FT:CDS AB480036_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB480038_C_P-A Feature FT:CDS AB480038_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB480039_C_P-A Feature FT:CDS AB480039_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB480040_C_P-A Feature FT:CDS AB480040_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB480041_C_P-A Feature FT:CDS AB480041_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB549213_C_P-A Feature FT:CDS AB549213_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697487_C_P-A Feature FT:CDS AB697487_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccktataaagaatttggagctwctgtggagttactctcktttttgccttctgacttctttccttccrt
ymgagatctyctmgacaccgcctcwgctctgtatcgrgargccttagagtctcckgarcattgytcacctcaccatacwg
cactcaggcaagcyattctstgytggggkgarttgatgamtctrgcyacctgggtgggwartaatttggaagayccagca
tccagggawytagtagtcarytatgtyaatrytaayatgggyytaaaratcagrcaactattgtggtttcayatwtcytg
ycttacttttggaagagaractgtwcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697488_C_P-A Feature FT:CDS AB697488_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgartatttggtstctttyggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697489_C_P-A Feature FT:CDS AB697489_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697491_C_P-A Feature FT:CDS AB697491_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No6). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
rgaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697492_C_P-A Feature FT:CDS AB697492_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No7). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697493_C_P-A Feature FT:CDS AB697493_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697495_C_P-A Feature FT:CDS AB697495_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No10). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcyattctctgctggggggaattgatgactctagcyacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaractgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697496_C_P-A Feature FT:CDS AB697496_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697497_C_P-A Feature FT:CDS AB697497_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697498_C_P-A Feature FT:CDS AB697498_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccktataaagaatttggagctwctgtggagttactctcktttttgccttctgacttctttccktcygt
ymgagatctyctmgacaccgcctcwgctctgtatcgrgargccttagagtctcckgarcattgytcacctcaccatacwg
cactcaggcaagcyattctstgytggggkgarttgatgamtctrgcyacctgggtgggwartaatttggaagaycmagca
tccagggayytagtagtcarytatgtyaatrytaayatgggywtaaaratcagrcaactattgtggtttcayatwtcttg
ycttacttttggaagagaractgtwcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697499_C_P-A Feature FT:CDS AB697499_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No16). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697501_C_P-A Feature FT:CDS AB697501_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697503_C_P-A Feature FT:CDS AB697503_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No22). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697504_C_P-A Feature FT:CDS AB697504_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No23). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697505_C_P-A Feature FT:CDS AB697505_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No25). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697506_C_P-A Feature FT:CDS AB697506_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697507_C_P-A Feature FT:CDS AB697507_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No29). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697508_C_P-A Feature FT:CDS AB697508_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697509_C_P-A Feature FT:CDS AB697509_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697511_C_P-A Feature FT:CDS AB697511_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No36). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB697512_C_P-A Feature FT:CDS AB697512_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB775198_C_P-A Feature FT:CDS AB775198_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0707). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagataccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB775199_C_P-A Feature FT:CDS AB775199_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB775200_C_P-A Feature FT:CDS AB775200_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB775201_C_P-A Feature FT:CDS AB775201_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB937791_C_P-A Feature FT:CDS AB937791_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB937792_C_P-A Feature FT:CDS AB937792_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB937793_C_P-A Feature FT:CDS AB937793_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB937794_C_P-A Feature FT:CDS AB937794_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB937795_C_P-A Feature FT:CDS AB937795_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttag
>gnl|hbvcds|AB937796_C_P-A Feature FT:CDS AB937796_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AB937797_C_P-A Feature FT:CDS AB937797_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1204). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttccgt
caaagatcttctagacaccgcctcagctctgtatcgagatgccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagtcagcctctgctgggtggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaataataacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaayctcaatgttag
>gnl|hbvcds|AB937798_C_P-A Feature FT:CDS AB937798_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF043560_C_P-A Feature FT:CDS AF043560_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF043580_C_P-A Feature FT:CDS AF043580_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF090838_C_P-A Feature FT:CDS AF090838_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcctaacgt
cagagatctcctagacaccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagctattctctgctggggggatgtgatgaatctagctacctgggtgggtgctaatttggaagatcaagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagacactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|AF090839_C_P-A Feature FT:CDS AF090839_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF090840_C_P-A Feature FT:CDS AF090840_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF090841_C_P-A Feature FT:CDS AF090841_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF090842_C_P-A Feature FT:CDS AF090842_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactccaccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF297621_C_P-A Feature FT:CDS AF297621_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 78). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggatctactgtggagttactctcatttttgccttctgacttctttccttcagt
acgggatctacttgatacagcttcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacag
cactcaggcaagccattttatgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgtcaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF297622_C_P-A Feature FT:CDS AF297622_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 79). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
acgggatctactagacacagcatcagctctgtatcgggaagccttagagtctccggagcattgctcccctcaccatacag
cactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF297623_C_P-A Feature FT:CDS AF297623_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 83). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
gcgggatctacttgacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttagacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF297624_C_P-A Feature FT:CDS AF297624_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 80). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF297625_C_P-A Feature FT:CDS AF297625_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 84). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcagggaaactattctttgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtctggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324071_C_P-A Feature FT:CDS AF324071_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A16). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctacagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactggtgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcttcgcagacgcagatctcaatcgccgcgtacgagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324072_C_P-A Feature FT:CDS AF324072_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A19). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctggtttttgccttcggacttctttccttccgt
ccgggatctactagatacagcttcagctctatatcgggaagccttagagtctcctgagcattgcacacctcaccatacag
cactcaggcaagccattctatgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatgtcgggaacatcaatgttag
>gnl|hbvcds|AF324107_C_P-A Feature FT:CDS AF324107_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0012). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctacatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttgatctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AF324118_C_P-A Feature FT:CDS AF324118_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate U2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttaccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaatccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagaaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324120_C_P-A Feature FT:CDS AF324120_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate U4). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcaagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324121_C_P-A Feature FT:CDS AF324121_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate U5). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324122_C_P-A Feature FT:CDS AF324122_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate U6). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcaagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagacactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|AF324123_C_P-A Feature FT:CDS AF324123_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate U7). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctctagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324125_C_P-A Feature FT:CDS AF324125_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate U9). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324126_C_P-A Feature FT:CDS AF324126_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate U10). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggatgtgatgaatctagctacctgggtgggtgctaatttgcaagatccagca
tccagggatttagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324127_C_P-A Feature FT:CDS AF324127_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.19). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagcaattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttactttcggaagagaaactgtccttgagtatttggtctcctttggagggtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcaaacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324128_C_P-A Feature FT:CDS AF324128_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.21). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324133_C_P-A Feature FT:CDS AF324133_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.31). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatgtcgggaatctcaatgttag
>gnl|hbvcds|AF324135_C_P-A Feature FT:CDS AF324135_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9.5). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324136_C_P-A Feature FT:CDS AF324136_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 7.32). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324147_C_P-A Feature FT:CDS AF324147_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I60). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagctttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF324148_C_P-A Feature FT:CDS AF324148_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I68). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcacatatcttg
ccttacttttggaagagagactgtacttgaatatttggtatctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350080_C_P-A Feature FT:CDS AF350080_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1196). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350081_C_P-A Feature FT:CDS AF350081_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1199). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tccagatctcctagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagctattctctgctggggggaactaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtatctttcggagtgtggattcgcactcttccagcttacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350082_C_P-A Feature FT:CDS AF350082_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1213). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacggagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350083_C_P-A Feature FT:CDS AF350083_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1314F79). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattatttgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagct
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350084_C_P-A Feature FT:CDS AF350084_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1315F80). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagct
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350085_C_P-A Feature FT:CDS AF350085_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1316F79). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagct
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350086_C_P-A Feature FT:CDS AF350086_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1330F80). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagct
tccagggatctagtagtcagttatgttaatactaacatgggcctaaagttcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350087_C_P-A Feature FT:CDS AF350087_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1486F125). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
ccgagatctccttgataccgcctcagctctgaatcgtgaagccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagctattctttgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagttaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtctcctttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350088_C_P-A Feature FT:CDS AF350088_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1487F125). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctccttgataccgcctcagctctgtatcgggaagcattagagtctcctgagcactgttcacctcaccatacag
cactcaggcaagctattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagttaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350089_C_P-A Feature FT:CDS AF350089_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1606). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcatcatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcctg
ccttacttttggaagagaaaccgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350090_C_P-A Feature FT:CDS AF350090_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1687). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tcccgggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350091_C_P-A Feature FT:CDS AF350091_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1730F202). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350092_C_P-A Feature FT:CDS AF350092_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1746). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgccgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350093_C_P-A Feature FT:CDS AF350093_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1747). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgttcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350094_C_P-A Feature FT:CDS AF350094_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1800). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatcttctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350095_C_P-A Feature FT:CDS AF350095_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1815F214). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350096_C_P-A Feature FT:CDS AF350096_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1817F214). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagcgacctgggtgggtaataatttggaagatccagca
tccagagatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350097_C_P-A Feature FT:CDS AF350097_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1835F222). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF350098_C_P-A Feature FT:CDS AF350098_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Gam1841F222). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctttatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419534_C_P-A Feature FT:CDS AF419534_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I5-Fam B). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgtctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcattcttcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419535_C_P-A Feature FT:CDS AF419535_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I6-Fam B). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgtctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatactncttg
cattacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF419536_C_P-A Feature FT:CDS AF419536_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate I7-Fam B). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctagtgtggagttactctcgtttttgcctcatgacttctttccttccgt
cagagatctcctagacaccgtctcagctctgtatcgagaagccttagagtctcctgagcattgctctcctcaccatactg
caatcaggcaagccattctctgctgggggcaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatgataacatgggtttaatgatcaggcaactattgtggtttcattcttcttg
cattacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacggcaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF536524_C_P-A Feature FT:CDS AF536524_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcaactctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AF537371_C_P-A Feature FT:CDS AF537371_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacgcttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|AF537372_C_P-A Feature FT:CDS AF537372_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacttgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagatgtcggggccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ012207_C_P-A Feature FT:CDS AJ012207_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ309369_C_P-A Feature FT:CDS AJ309369_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcactgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggatgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ309370_C_P-A Feature FT:CDS AJ309370_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaaccccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ309371_C_P-A Feature FT:CDS AJ309371_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgttgagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcactgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcattcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ344115_C_P-A Feature FT:CDS AJ344115_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgtcaatactaacatgggtttgaagatcaggcaactattgtggtttcatatatcttg
cctcacttttggaaaagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AJ627226_C_P-A Feature FT:CDS AJ627226_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20952). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgcctcctgacttctttccttccgc
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcatctatcttg
tattatgtttggaagagacattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627227_C_P-A Feature FT:CDS AJ627227_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacctttataaagaatttggagctagtgtggagttactctcgtttttgcctkctgacttctatccttccgt
cagagatctcctagacaccgccwcagctctrtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
caatcaggcaagccattgtctgctggggwgaattgacgaatctaggtacttgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaatcatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagaaacactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttrttagacgamgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AJ627228_C_P-A Feature FT:CDS AJ627228_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 34408). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttggagtctcctgagcattgctcacctcatcatactg
caatcaggcaatgcgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgattatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaattcttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AM180624_C_P-A Feature FT:CDS AM180624_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgagatctcctagataccgcctcagctctatttcgggaagcactagagtctcctgagcatggttctsctcaccatacag
camtcaggcaagccattctttgctggggggakgtaatgactctagccacctgggtgggtrmtaatttggaagatccagca
tcccgggatctagtagtcaattatgtcaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgttcttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttag
>gnl|hbvcds|AM184125_C_P-A Feature FT:CDS AM184125_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgaacattgctctcctcaccatacag
cactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactgttgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM184126_C_P-A Feature FT:CDS AM184126_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcaccatacag
cactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcatatttcttg
ccttacttttggaagagaaacggtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM282986_C_P-A Feature FT:CDS AM282986_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM295795_C_P-A Feature FT:CDS AM295795_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM295796_C_P-A Feature FT:CDS AM295796_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM295797_C_P-A Feature FT:CDS AM295797_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM410963_C_P-A Feature FT:CDS AM410963_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AM494718_C_P-A Feature FT:CDS AM494718_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAR204). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttcttcccttctgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtttccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY034878_C_P-A Feature FT:CDS AY034878_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVKL). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgcacacctcaccatactg
cactcaggcaagccattctatgctggggggaattgatgactctagctacctgggtgggtaataatttggacgatccagca
tccaaggatctagtagtcaattatgttaatactaaacatgggttaaagatcaggcaactattgtgggttcatacatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaa
caacaaatgcccctatcttatcaacacttccggaagctactgttgttagacaacgggaccgacgcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY128092_C_P-A Feature FT:CDS AY128092_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY152726_C_P-A Feature FT:CDS AY152726_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.22). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgggaagccctagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161138_C_P-A Feature FT:CDS AY161138_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161139_C_P-A Feature FT:CDS AY161139_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161142_C_P-A Feature FT:CDS AY161142_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgcggggaattaatgaccttagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtgcttgagtatgtggtctctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agactcccttcgccttgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161143_C_P-A Feature FT:CDS AY161143_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgcggggaattaatgaccttagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtgcttgagtatgtggtctctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY161144_C_P-A Feature FT:CDS AY161144_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatatggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgcggggaattaatgaccttagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtgcttgagtatgtggtctctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcagcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY230111_C_P-A Feature FT:CDS AY230111_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggcaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY230113_C_P-A Feature FT:CDS AY230113_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctctcctcaccatactg
cactcaggcttgccattgtatgctggtgagaattgatgaatctagctacctgggtgggtaataattggcaagatccagca
tccagggatgtagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagagattgtacttgaatatttggtctctttcggagtgtggattcgctctcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatttcaatcgccgcgtcacagaagatctcgatctcggggatcccaatgttag
>gnl|hbvcds|AY233274_C_P-A Feature FT:CDS AY233274_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaggagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233275_C_P-A Feature FT:CDS AY233275_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttccttccgt
ccgggatctacttgatacagcctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233276_C_P-A Feature FT:CDS AY233276_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1839). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcttcagctctgtatcgggaagccttagagtctccggagcattgttcccctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233278_C_P-A Feature FT:CDS AY233278_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233279_C_P-A Feature FT:CDS AY233279_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcttcagctttgtatcgggaagccttagagtctccggagcattgctcccctcaccatacag
cacacaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
tcttacttttggaagagaaacggtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233280_C_P-A Feature FT:CDS AY233280_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233281_C_P-A Feature FT:CDS AY233281_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctacttgatacagcctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaaaatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|AY233282_C_P-A Feature FT:CDS AY233282_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 306). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagcaattctctgctggggggaattaatgactctagctacctgggtggggaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233283_C_P-A Feature FT:CDS AY233283_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4038). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggccccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233284_C_P-A Feature FT:CDS AY233284_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5283). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctacttgatacagcctcagcactgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggggtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233285_C_P-A Feature FT:CDS AY233285_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctcagtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtggggaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggacccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233286_C_P-A Feature FT:CDS AY233286_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 818). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
cctcacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233287_C_P-A Feature FT:CDS AY233287_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8225). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcttcagctctgtatcgggaagccttagagtctccggagcattgctcccctcaccatacag
cactcaggcaagccattctctgctggggggaattaatggctctagccacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcctatcaacacttccggaaactactgttgttagacgacgagatcgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233288_C_P-A Feature FT:CDS AY233288_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 823). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgataccgcctcagctctgtaccgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattatggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233289_C_P-A Feature FT:CDS AY233289_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtggggaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY233290_C_P-A Feature FT:CDS AY233290_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgccttctgatttctttccttcagt
acgggatctacttgatacagcctcagctctgtatcgggaagccttagaatctccggagcattgctcccctcaccatacag
cactcaggcaagccattctatgctggggggatgttatgaatctagcttcctgggtgggtaataatttggacgatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagacaaactgttcttgagtatttagtctctttcggagtgtggatacgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY236165_C_P-A Feature FT:CDS AY236165_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagagattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccggcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY236166_C_P-A Feature FT:CDS AY236166_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacgttgacacttataaagaatttggcgctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaangcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY236167_C_P-A Feature FT:CDS AY236167_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgaggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaangcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggctggtcccatagaaga
agaactccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY236168_C_P-A Feature FT:CDS AY236168_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagccacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagagattgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY236169_C_P-A Feature FT:CDS AY236169_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattgcctgctggggagaattgatgaatttagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttgtcaacacttccggagactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|AY373428_C_P-A Feature FT:CDS AY373428_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatttactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY373429_C_P-A Feature FT:CDS AY373429_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtctcatatttcttg
ccttacttttggaagagaaactgcccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagtaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY373432_C_P-A Feature FT:CDS AY373432_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603429_C_P-A Feature FT:CDS AY603429_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 15T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcgattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603430_C_P-A Feature FT:CDS AY603430_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 19T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603431_C_P-A Feature FT:CDS AY603431_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgaatcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603432_C_P-A Feature FT:CDS AY603432_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24T). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttcagt
actagatcttctagataccgcctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagttaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603435_C_P-A Feature FT:CDS AY603435_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 31T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603436_C_P-A Feature FT:CDS AY603436_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 32T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603438_C_P-A Feature FT:CDS AY603438_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 36T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgaatcgcagacgcagagctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603441_C_P-A Feature FT:CDS AY603441_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 59T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY603446_C_P-A Feature FT:CDS AY603446_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11T). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttccggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY707087_C_P-A Feature FT:CDS AY707087_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-N10). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagcaattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY738139_C_P-A Feature FT:CDS AY738139_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaaaatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY738140_C_P-A Feature FT:CDS AY738140_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY738141_C_P-A Feature FT:CDS AY738141_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaatattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY738142_C_P-A Feature FT:CDS AY738142_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY738143_C_P-A Feature FT:CDS AY738143_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaaaatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY862867_C_P-A Feature FT:CDS AY862867_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY862868_C_P-A Feature FT:CDS AY862868_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggcttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY902775_C_P-A Feature FT:CDS AY902775_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MTB162). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY903452_C_P-A Feature FT:CDS AY903452_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcgttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934763_C_P-A Feature FT:CDS AY934763_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctggacaccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934764_C_P-A Feature FT:CDS AY934764_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtaccgggaagcattagagtctcctgagcattgctcacctcaccacacag
cactaaggcaagccattctttgttggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcttatcgac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934765_C_P-A Feature FT:CDS AY934765_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24306). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgttggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tctagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934766_C_P-A Feature FT:CDS AY934766_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
gcgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtttccttcggagtgtggattcgcactcctccagcctataggc
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934767_C_P-A Feature FT:CDS AY934767_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgt
ccgggatctactagatacagcttcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccggca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934768_C_P-A Feature FT:CDS AY934768_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934769_C_P-A Feature FT:CDS AY934769_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23719). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934770_C_P-A Feature FT:CDS AY934770_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 953642). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatctggaagatccagca
tctagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934771_C_P-A Feature FT:CDS AY934771_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
tcgggatctactagatactgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934772_C_P-A Feature FT:CDS AY934772_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934773_C_P-A Feature FT:CDS AY934773_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttccttctgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagcaattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|AY934774_C_P-A Feature FT:CDS AY934774_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctacagtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ020002_C_P-A Feature FT:CDS DQ020002_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 380). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctgcttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ020003_C_P-A Feature FT:CDS DQ020003_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgtgaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ298161_C_P-A Feature FT:CDS DQ298161_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggcaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|DQ298162_C_P-A Feature FT:CDS DQ298162_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctctcctcaccatactg
cactcaggcttgccattgtatgctggggagaattgatgaatctagctacctgggtgggtaataattggcaagatccagca
tccagggatgtagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagagattgtacttgaatatttggtctctttcggagtgtggattcgctctcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatttcaatcgccgcgtcacagaagatctcgatctcggggatcccaatgttag
>gnl|hbvcds|DQ298163_C_P-A Feature FT:CDS DQ298163_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagccacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagagattgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|DQ298164_C_P-A Feature FT:CDS DQ298164_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacgttgacacttataaagaatttggcgctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|DQ298165_C_P-A Feature FT:CDS DQ298165_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttgctctcttttttgcctggtgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggagaattgatgaatctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctcgtagtcaattatgttaatactaacatgggtataaagatcaggcaactattgaggtttcatatatcttg
cattacttttggaagagaggttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggctggtcccatagaaga
agaactccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttag
>gnl|hbvcds|DQ315784_C_P-A Feature FT:CDS DQ315784_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI03101). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|DQ315785_C_P-A Feature FT:CDS DQ315785_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI0386). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctttgctggggggaattaatgactctaggtacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|DQ315786_C_P-A Feature FT:CDS DQ315786_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI057). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|DQ788725_C_P-A Feature FT:CDS DQ788725_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
aagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtcgcccgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttgggagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF103278_C_P-A Feature FT:CDS EF103278_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ran60). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttttttccttccgt
ccgagatctactagatacagcctcagctctgtatcgggaagccttagaatctcctgagcattgctcacatcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggtctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaaaacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagatgtcgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EF208113_C_P-A Feature FT:CDS EF208113_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU054331_C_C-A Feature FT:CDS EU054331_C_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctcgataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcaccatacag
cactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU086721_C_P-A Feature FT:CDS EU086721_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU185746_C_P-A Feature FT:CDS EU185746_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MSM9). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatarac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU185750_C_P-A Feature FT:CDS EU185750_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MSM13). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=554 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatg
>gnl|hbvcds|EU185774_C_P-A Feature FT:CDS EU185774_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H-IDU1). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=555 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctaracaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactatkgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|EU185776_C_P-A Feature FT:CDS EU185776_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H-IDU3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=555 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctasacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactcttgctacctgggtgggtaataatttggaagatccacca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactatkgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctataaac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgt
>gnl|hbvcds|EU185777_C_P-A Feature FT:CDS EU185777_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H-IDU4). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=556 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcckt
cagagatctcctasacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctytgctggggggaattgatgactcttgctacctgggtgggtaataatttggaagatccacca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactatkgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctataaac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcattcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtt
>gnl|hbvcds|EU185786_C_P-A Feature FT:CDS EU185786_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU11). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctaatgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgacgactctaggtacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU185787_C_P-A Feature FT:CDS EU185787_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU185789_C_P-A Feature FT:CDS EU185789_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU304331_C_P-A Feature FT:CDS EU304331_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA84). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcktttttgcctymtgacttctttccttccgt
ccgggatctactagacacagcctcagctttgtatcgggaagccttagagtctcctgagcattgctcatctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatytcttg
ccttacttttggaagagacaytgtccttgagtatttggtctckttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacaacgacaccgaggcaggtcccctagagga
agaactccctcgcctcgcagacsaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU366129_C_P-A Feature FT:CDS EU366129_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA92). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttttttccttccgt
ccgggatctactagatacagccgcagctctgtttcgggaggccttagagtctcctgagcattgctcacctcaccatacag
caatcaggcaagccattctatgctggggagaattaatgactctagctacctgggtgggtaataatttggamgatccagca
tccagggatctagtagtcaattatgttaatactcacatgggcctraagatcaggcaactattgtggtttcatmtttcttg
catttgttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagtccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|EU410082_C_P-A Feature FT:CDS EU410082_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ph81). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414048_C_P-A Feature FT:CDS EU414048_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctatgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcagacaactattgtggtttcatatctcttg
ccttacttttggaagagagactgtacttgaatatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414049_C_P-A Feature FT:CDS EU414049_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcktttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggkggawktgaygactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaaaagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
casyaaatgcccctatcttatcaacacttccggaaactactgttrttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagawctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414050_C_P-A Feature FT:CDS EU414050_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagctactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggatgtgacgaatctagctacctgggtgggtactaatttgaatgatcctgca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414052_C_P-A Feature FT:CDS EU414052_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttccgc
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggcggatgtgacgaatctagctacctgggtgggtaataatttggaagatcaagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttg
ccttacttttggaagagagactgtacttgaatatttrgtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggaaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU414132_C_P-A Feature FT:CDS EU414132_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagstactgkggagktactctcgtttttkccttytgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaarccttagagtctcytgagcattgctcacctcmccatactg
cactcaggcaagccattctytgctggggggaakkgakgactctagctacctgggtgggtaataatttggaagatccagca
tccmmggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttk
ccttacttttggaagagagactgtacttgaatatttggtctctttyggagtgtggattcgcactcctccasccyatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaygwcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatytyaatgttag
>gnl|hbvcds|EU414133_C_P-A Feature FT:CDS EU414133_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttccgc
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggcggatgtgacgaatctagctacctgggtgggtaataatttggaagatcaagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttg
ccttacttttggaagagagactgtacttgaatatttrgtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacggaaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594383_C_P-A Feature FT:CDS EU594383_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594384_C_P-A Feature FT:CDS EU594384_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594385_C_P-A Feature FT:CDS EU594385_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594386_C_P-A Feature FT:CDS EU594386_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594387_C_P-A Feature FT:CDS EU594387_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594388_C_P-A Feature FT:CDS EU594388_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594389_C_P-A Feature FT:CDS EU594389_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594390_C_P-A Feature FT:CDS EU594390_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594391_C_P-A Feature FT:CDS EU594391_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594392_C_P-A Feature FT:CDS EU594392_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594393_C_P-A Feature FT:CDS EU594393_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594394_C_P-A Feature FT:CDS EU594394_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU594395_C_P-A Feature FT:CDS EU594395_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU747320_C_P-A Feature FT:CDS EU747320_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V51). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagaaatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|EU859898_C_P-A Feature FT:CDS EU859898_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859899_C_P-A Feature FT:CDS EU859899_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P44). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859900_C_P-A Feature FT:CDS EU859900_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859901_C_P-A Feature FT:CDS EU859901_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P37). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859902_C_P-A Feature FT:CDS EU859902_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P32). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859903_C_P-A Feature FT:CDS EU859903_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859904_C_P-A Feature FT:CDS EU859904_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P39). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859905_C_P-A Feature FT:CDS EU859905_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P38). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859906_C_P-A Feature FT:CDS EU859906_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859907_C_P-A Feature FT:CDS EU859907_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859908_C_P-A Feature FT:CDS EU859908_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859909_C_P-A Feature FT:CDS EU859909_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859910_C_P-A Feature FT:CDS EU859910_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859911_C_P-A Feature FT:CDS EU859911_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859912_C_P-A Feature FT:CDS EU859912_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttggtagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859913_C_P-A Feature FT:CDS EU859913_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859914_C_P-A Feature FT:CDS EU859914_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859915_C_P-A Feature FT:CDS EU859915_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859916_C_P-A Feature FT:CDS EU859916_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859917_C_P-A Feature FT:CDS EU859917_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859918_C_P-A Feature FT:CDS EU859918_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859919_C_P-A Feature FT:CDS EU859919_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttcctctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859920_C_P-A Feature FT:CDS EU859920_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P21). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859921_C_P-A Feature FT:CDS EU859921_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P08). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859922_C_P-A Feature FT:CDS EU859922_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859923_C_P-A Feature FT:CDS EU859923_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859924_C_P-A Feature FT:CDS EU859924_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859925_C_P-A Feature FT:CDS EU859925_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P22). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859926_C_P-A Feature FT:CDS EU859926_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P06). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859927_C_P-A Feature FT:CDS EU859927_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859928_C_P-A Feature FT:CDS EU859928_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P01). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859929_C_P-A Feature FT:CDS EU859929_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859930_C_P-A Feature FT:CDS EU859930_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859931_C_P-A Feature FT:CDS EU859931_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C96). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859932_C_P-A Feature FT:CDS EU859932_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C69). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859933_C_P-A Feature FT:CDS EU859933_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859934_C_P-A Feature FT:CDS EU859934_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859935_C_P-A Feature FT:CDS EU859935_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859936_C_P-A Feature FT:CDS EU859936_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859937_C_P-A Feature FT:CDS EU859937_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859938_C_P-A Feature FT:CDS EU859938_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcgtg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttag
>gnl|hbvcds|EU859939_C_P-A Feature FT:CDS EU859939_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859940_C_P-A Feature FT:CDS EU859940_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C122). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859941_C_P-A Feature FT:CDS EU859941_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C153). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859942_C_P-A Feature FT:CDS EU859942_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tctagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859943_C_P-A Feature FT:CDS EU859943_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859944_C_P-A Feature FT:CDS EU859944_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctcaagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859945_C_P-A Feature FT:CDS EU859945_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859946_C_P-A Feature FT:CDS EU859946_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859947_C_P-A Feature FT:CDS EU859947_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859948_C_P-A Feature FT:CDS EU859948_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C151). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859949_C_P-A Feature FT:CDS EU859949_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859950_C_P-A Feature FT:CDS EU859950_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859951_C_P-A Feature FT:CDS EU859951_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859952_C_P-A Feature FT:CDS EU859952_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccctataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctccttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tcttacttttggaagagaaactgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859953_C_P-A Feature FT:CDS EU859953_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C55). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859954_C_P-A Feature FT:CDS EU859954_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C42). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859955_C_P-A Feature FT:CDS EU859955_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C39). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|EU859956_C_P-A Feature FT:CDS EU859956_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349222_C_P-A Feature FT:CDS FJ349222_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H20). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349224_C_P-A Feature FT:CDS FJ349224_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H71). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ349296_C_P-A Feature FT:CDS FJ349296_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactggggagttactctcttttttgccttctgacttctttccttccgt
tcgagatcttctaaacaccgcctcagctctctatcgggaagccctaaagtctcctgggcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggcaataatttggaaaatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactatgggggtttcatatttcttg
tcttacttttggaagagaaacagtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcatatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692554_C_P-A Feature FT:CDS FJ692554_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
tcgagatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692555_C_P-A Feature FT:CDS FJ692555_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24074). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcttttttgcctcatgacttctttccttccgt
ccgagatctcctagataccgcctcasctctgtatcgggaagcactagagtctcctgagcattgctcacctcmccatacag
caatcaggcaagccattctytgctggggggaattaatgactctagctacctgggtgggcaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacctttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
cacmaaatgcccctatcttatcaacacttccggaaactrctgttgttagatgtcgggaccgaggcaggtcctctagaaga
agaactccctcacctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692557_C_P-A Feature FT:CDS FJ692557_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48004). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692558_C_P-A Feature FT:CDS FJ692558_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttatgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatgcagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcacatttcttg
cattacttttggaagagaagttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgtggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692559_C_P-A Feature FT:CDS FJ692559_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48032). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
caatcaggcaagccgtdctatgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacrcttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttag
>gnl|hbvcds|FJ692561_C_P-A Feature FT:CDS FJ692561_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgcctymtgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaayatgggcctaaaaatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttyggagtgtggattcgcactcctccaccytatagac
caccaaatgcccctatcttatcaacacttccggaractgctgttgttagatgtcgagcccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692562_C_P-A Feature FT:CDS FJ692562_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctatgctggggggaattaatgaccctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtyaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagaccaactgtccttgagtatttggtctctttcggggtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692563_C_P-A Feature FT:CDS FJ692563_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48049). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggactaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692564_C_P-A Feature FT:CDS FJ692564_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48074). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgc
ccgggatctactagatacagcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaacgactctagctacctgggtgggtactaatttggaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
cmttacttttggaagagaagttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggccgaggcaggtcccctcgaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692565_C_P-A Feature FT:CDS FJ692565_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48077). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgc
ccgggatctactagatacagcctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaacgactctagctacctgggtgggtactaatttggaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaagttgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
camcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccctmgaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggsaatctcaatgttag
>gnl|hbvcds|FJ692566_C_P-A Feature FT:CDS FJ692566_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgggatctactagatacagccgcagctctgtatcgggaatccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692567_C_P-A Feature FT:CDS FJ692567_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48113). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggatggcttggagtctcctgagcattgcwcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
cacaaaatgcccctatcttatcaacacttccggagactactgttgttagatgtcgaaaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacmtcaatgttag
>gnl|hbvcds|FJ692570_C_P-A Feature FT:CDS FJ692570_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50010). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaacgaatctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctgaaaatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagacaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692571_C_P-A Feature FT:CDS FJ692571_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50011). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccacgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692572_C_P-A Feature FT:CDS FJ692572_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50013). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
tcgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccgttctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|FJ692573_C_P-A Feature FT:CDS FJ692573_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50014). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagt
ccgggatctacttgataccgcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatcctgca
tccagggatctagttgtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaagttgtccttgagtatttggtttccttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcatcacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgcctcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692574_C_P-A Feature FT:CDS FJ692574_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50015). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692575_C_P-A Feature FT:CDS FJ692575_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatacttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692576_C_P-A Feature FT:CDS FJ692576_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttccgt
ccgagatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaattgtccttgagtttttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaggacgaccccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692577_C_P-A Feature FT:CDS FJ692577_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50024). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccatwctatgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcaggcaactattgtggtttcatatttcttg
ccttacttttggaamamaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692578_C_P-A Feature FT:CDS FJ692578_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692579_C_P-A Feature FT:CDS FJ692579_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692580_C_P-A Feature FT:CDS FJ692580_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692581_C_P-A Feature FT:CDS FJ692581_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50086). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692582_C_P-A Feature FT:CDS FJ692582_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692583_C_P-A Feature FT:CDS FJ692583_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50089). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692584_C_P-A Feature FT:CDS FJ692584_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692585_C_P-A Feature FT:CDS FJ692585_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50091). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692586_C_P-A Feature FT:CDS FJ692586_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50099). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttccgc
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggacttaacgactctaggttcctgggtgggtaataatttggaagaccaagca
tccagggctctagtagtcaattatgttgatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttcagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgaaaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagrtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692587_C_P-A Feature FT:CDS FJ692587_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50115). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcctaatgacttctttccttcagt
ccgggatctacttgataccgccgcagctttgtatcgggaggccttrgagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctaggcacctgggtgggtaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtttttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgcaaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692588_C_P-A Feature FT:CDS FJ692588_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50119). Complete genome. [Hepadnaviridae] (length=561 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
ccgggatctattagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccggcaaggcaggtcccctaga
agaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtta
g
>gnl|hbvcds|FJ692590_C_P-A Feature FT:CDS FJ692590_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692591_C_P-A Feature FT:CDS FJ692591_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50167). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692592_C_P-A Feature FT:CDS FJ692592_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50175). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctatccttcagt
ccgggatctacttgataccgcctcagctttgtatcgggaaggcttagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgstggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgca
tccagggatctagtggtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtttccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|FJ692593_C_P-A Feature FT:CDS FJ692593_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Non-functional genomic sequence. [Hepadnaviridae] (length=552 residues).
atggacattgacctktataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtttcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctatgctggggggaattaatgactctagctacctgggtgggtaataatttggacgatccagta
tccagggatctagtagtcaattatgttaatactaacatgggcctaaggatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatarac
cacaaaatgcccctatcttatcaacacttccggaaactrctgttgttagacgacgaggcaggtcccctagaagacgaact
ccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692595_C_P-A Feature FT:CDS FJ692595_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48093). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcctaatgacttctttccttccgt
ccgagatctcctagataccgccacagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatgataacatgggcataaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
cactaaatgcccctatcttatcaacacttccggaaactactgttgttagacaacgataccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692596_C_P-A Feature FT:CDS FJ692596_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48103). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgttgagttactctcttttttgcctkctgacttctttccttccgt
ccgagatctactagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctctcctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatacttcttc
cattacttttggaagagaamttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692597_C_P-A Feature FT:CDS FJ692597_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48125). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatygacccttataaagaatttggagcttctgtggagttactctcttttttgcctactgacttcttcccttccgt
ccgagatcttytagataccgcctcagctctgtttygggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctytgytggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaataytaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagacattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacwacgamtccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692598_C_P-A Feature FT:CDS FJ692598_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtrgagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaagtaatgratctaggtaactgggtgggtaataatttggaagatcmagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagamactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
cayyaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692599_C_P-A Feature FT:CDS FJ692599_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50033). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcttttttgccttctgatttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgcacacctcaccatacag
caatcaggcaagccattctytgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagatactgtacttgaatatttggtgtctttcggagtgtggattcgcactcctccagcctatagac
cagtaaatgcccctatcctatcgacacttcctgaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692600_C_P-A Feature FT:CDS FJ692600_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=558 residues).
atggayattgacccttataaagaatttggagctactgtggagttactctcttttttgcctactgattactatccwtccgt
ccgagatctcctagataccgcctcagctctstatcgggawgcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccatwctmtgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatcwagtagtcaattatgttaatmataacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgasaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692601_C_P-A Feature FT:CDS FJ692601_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692602_C_P-A Feature FT:CDS FJ692602_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50041). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtagagttactctcttttttgcctgctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgcatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggacttatcgactctagctacctgggtgggtaataatttggcagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagacaaattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692603_C_P-A Feature FT:CDS FJ692603_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgaccattataaagaatttggagctwctgtggagttactctcttttttgccttctgacttctatccttccgt
ccgagatctcctagataccgccacagctctgtatcgggamkcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagaactcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692604_C_P-A Feature FT:CDS FJ692604_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggacttaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaccacgggcctaaggatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692605_C_P-A Feature FT:CDS FJ692605_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgaccmttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcrgctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggawgatccagcr
tccagggatctagtagtcaattatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaaytgtacttgaatatttggtctctttcggagtgtggatacgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgtactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgttag
>gnl|hbvcds|FJ692606_C_P-A Feature FT:CDS FJ692606_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgcacacctcaccatacag
cactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692607_C_P-A Feature FT:CDS FJ692607_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttccttccgt
acgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccatactatgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcccgca
tccagggatctagtagtcaattatgtcaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacctttggaagagaaattgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
cacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaggagaccgaggcaggtcccttagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692608_C_P-A Feature FT:CDS FJ692608_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50075). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgcacacctcaccatacag
cactcaggcaagccattctctgctggggggagttaatgactctagctacctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692609_C_P-A Feature FT:CDS FJ692609_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50098). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctagtgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaacgactctaggtacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcarttatgttaatactcacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccascctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgtactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692610_C_P-A Feature FT:CDS FJ692610_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacmcgtataaagaatttggagctagtgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcckgagcatwkctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaacgactctagstacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcrattatgttaatactcacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
yaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagrccgaggcaggtcccctagaaga
cgtactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FJ692611_C_P-A Feature FT:CDS FJ692611_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagcttcctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagaccaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ692612_C_P-A Feature FT:CDS FJ692612_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgaccmttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactmacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccascctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaayctcaatgttag
>gnl|hbvcds|FJ692613_C_P-A Feature FT:CDS FJ692613_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccat
ccgagatctcctagataccgcctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacag
caatcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataacttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggagactactgttattagacgacgagatcgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcactgttag
>gnl|hbvcds|FJ904411_C_P-A Feature FT:CDS FJ904411_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A55). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctatccttcagt
ccgggatctcctagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattaacggatctaggttcctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaatatgggcctaaagatcaggcaaatattgtggtttcatatctcttg
tcttacttttgggagggaaactgtacttgagtatttggtctctttcggggtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FJ904434_C_P-A Feature FT:CDS FJ904434_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate B21). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcgtgacttctttccttcagt
ccgggatctcctagataccgcctcagctctgtatcgggaagccttagagtcacctgagcattgctcacctcaccataccg
caattcggcaaatcattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttgsaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatctcttg
ccttacttttggaagagaaactgtaattgagtatttggtctctttcggggtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FM199974_C_P-A Feature FT:CDS FM199974_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcggt
ccgggatctacttgatacagcctcagctctgtatcgggatgccttggagtctcctgagcattgctcccctcaccatacag
cactcaggcaagccattctctgctggggggaattaatggctctagcctcctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatacttcttg
cattacttttggaagggaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FM199975_C_P-A Feature FT:CDS FM199975_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctatatcgggaagccttagagtctyctgagcattgcwcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatcctgca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttrtcaacacttccggaaactactgttgttagatgtcgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|FM199976_C_P-A Feature FT:CDS FM199976_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
tcgggatctacttgacacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccrttctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaamtattgtggtttcatatttcttg
ccttacttttggaagagagactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggyaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FM199977_C_P-A Feature FT:CDS FM199977_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgcagcgggaagccttagagtctcatgagcattgctcacctcatcatacag
cactcaggcaagccattctttgctggggagaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttactttcggaagagatactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
cwccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
cgaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FM199978_C_P-A Feature FT:CDS FM199978_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtcacctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttagaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttgggagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FM199979_C_P-A Feature FT:CDS FM199979_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttactttcggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FM199980_C_P-A Feature FT:CDS FM199980_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagcaattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttactttcggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcacacctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FM199981_C_P-A Feature FT:CDS FM199981_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctrtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgwctctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagagacactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccrcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545825_C_P-A Feature FT:CDS FN545825_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctatatcgggaagcccttgagtctcctgagcattgttcaccgcaccatacag
cactaaggcaagccgttctctgctggggggagttaatgactctagccacctgggtgggtaataatttgcaagatccagca
tccagggacctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tcttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagawctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545826_C_P-A Feature FT:CDS FN545826_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttaatctcgtttttgccttctgacttctttccttccgt
tcgagatcttctagataccgcctcagctctctatcgggaagcactagagtctcctgagcattgttcacctcaccatacmg
cactcaggcaagccattctctgctggggggacttaatgactttagctacctgggtgggcaataatttggaagatccggca
tccagggatctagtagtcaattatgttaataataccacgggcttaaagatcaggcaactattgtggtttcayatttcttg
tcttacttttggaagagacaccgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FN545828_C_P-A Feature FT:CDS FN545828_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggcgctactgtagagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtttcgggaagcattggaatcacctgagcattgtacacctcaccatacag
cactcaggcaagccattctttgctggggggaattaatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcgattatgttaacactaacatgggcctaaaaatcaggcaactattgtggtttcatatttcttg
tctcacttttggaagacaaactgtacttgagtatttggtatcttttggagtgtggattcgtactcctccaccctacagac
cactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggacccaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545829_C_P-A Feature FT:CDS FN545829_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgc
ccgagatctcctagataccgcctcagccctgtatcgggaaggattggaatcacctgagcattgtacacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctcgtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tctcacttttggaagagaggttgtacttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgagctcggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545830_C_P-A Feature FT:CDS FN545830_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagatacagcctcagccctgtttcgggaagcattggaatcacctgagcattgtacacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tctcacttttggaagagatattgtactggagtatttggtatcttttggagtgtggattcgcactcctccagcctacagac
cactaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgaagggaccgaggtcggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|FN545831_C_P-A Feature FT:CDS FN545831_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tcttacttttggaagagaaacggtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545832_C_P-A Feature FT:CDS FN545832_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttccttccgt
ycgagatctcctagataccgcctcagctctgtttcgggamgctttggaatcaccagagcattgtacacctcaccatacag
cactcaggcaagccattctctgctggggggaaktaatgactctagctacctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgtyaatactmacatgggcctaaagatcagrcaactattgtggtttcatatttcttg
tctcacttttggaagagaaaytgtgcttsagtatttggtatcttttggagtgtggattcgcactcctccagcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaygmagggaccgaggtcggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctmaatgttag
>gnl|hbvcds|FN545833_C_P-A Feature FT:CDS FN545833_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtttcgggaagcattagagtcacctgagcattgttcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaactatgttaatactaacatgggcctaaagatcaggcaaatattgtggtttcatatttcttg
tctcacttttggaagagaagttgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545834_C_P-A Feature FT:CDS FN545834_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgc
ccgagatctcctagagaccgcctcagctctgtatcgggaagcattagagtcacctgagcattgttcacctcaccatacag
cactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggatgatccagca
tccagggatctagtagtcaactatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tatcacttttggaagagaagttgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545835_C_P-A Feature FT:CDS FN545835_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggaagcattggaatcacctgagcattgtacacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaacactaacatgggcctaaaaatcaggcaactattgtggtttcatatttcttg
tctcacttttggaagagaaactgtacttgagtatttggtatcttttggagtgtggattcgtactcctccagcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545836_C_P-A Feature FT:CDS FN545836_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagacctcctagataccgcctcagctctatatcgggaagcactagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtacttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545837_C_P-A Feature FT:CDS FN545837_C_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcgactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctgcttgacactgcctcagcgctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatacgg
ccctcaggcaagccattctytgctggggggaattaatgamtctagctacctgggtgggcaataatttgcaagacccagct
tccagggatttagtggtcaattatgtcaacactaacatgggcttaaagattagacaamtattgtggtttcatatctcttg
ccttacttttggaagagaaaccgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccagcatacagac
cacttaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtcggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545838_C_P-A Feature FT:CDS FN545838_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctatttcgggaagcattagagtctcctgagcattgctctcctcaccatacgg
cactcaggcaagccattctctgctggggggatgtaatgtctctagctacctgggtgggtactaatttggaagatccagca
tccagggaacaagtagtcagttatgttaatactaatatgggcctgaagatcaggcaactgttgtggtttcatatttcttg
ccttacttttggaagagaagttgtacttgagtatttggtctcttttggggtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagactacggaaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545839_C_P-A Feature FT:CDS FN545839_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctkcggacttctttccttccgt
ccgagatctcctagataccgcctcagctctgtatcgggatgcattggaatcacctgagcattgtacacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagccacctgggtgggcaataatttggatgatccagca
tccagggatctagtagtcaattatgttaatactcacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tctcacttttggaagagamactgtgcttcagtatttggtatcttttggagtgtggattcgcactcctccagcctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagakgtagggaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|FN545840_C_P-A Feature FT:CDS FN545840_C_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagagtttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagccctgtatcgggaagcattggaatcacctgagcattgtacacctcaccatacag
cactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tctcacttttggaagagaaactgtgcttgagtatttggtatcttttggagtgtggattcgcactcctccaccctacagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtcggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ161813_C_P-A Feature FT:CDS GQ161813_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
aagagatcttctagataccgcctcagctctgtatcgggatgccttagaatctcctgagcattgctcacctcaccacacwg
cactmaggcaagccattctttgytggggggaattaatgactctagctacctgggtgggcaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtctctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ184323_C_P-A Feature FT:CDS GQ184323_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ184324_C_P-A Feature FT:CDS GQ184324_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactctggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ222208_C_P-A Feature FT:CDS GQ222208_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1123). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggcgggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|GQ331046_C_P-A Feature FT:CDS GQ331046_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-188). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccctataaagaatttggagctactgtggagttactctcatttttgcctgctgacttctttccttccgt
ccgggatctactagataccgcctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgtcaatactaacatgggcctaaagatcaggcaactattgtggtttcacatctcttg
tcttacttttggaagagaagttgtacttgagtatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ331047_C_P-A Feature FT:CDS GQ331047_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccctataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctccttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
tcttacttttggaagagaaactgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|GQ414522_C_P-A Feature FT:CDS GQ414522_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtaccgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477461_C_P-A Feature FT:CDS GQ477461_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477462_C_P-A Feature FT:CDS GQ477462_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcatgacttctatccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgacgagtctaggcacctgggtgggtaataatttggacgatcaagca
tccagggatctagtagtcaattatgttaatactaacatgggcttaaagctcaggcaactattgtggtttcacatatcttg
ccttacttttggaagagagactgtaattgaatatttggtctctttcggagtgtggattcgcactcctcaagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttag
>gnl|hbvcds|GQ477463_C_P-A Feature FT:CDS GQ477463_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgatcattgcacacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagcttcctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaactcttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ477464_C_P-A Feature FT:CDS GQ477464_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcttgacttctttccttcagt
ccgagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatctcttg
cattacttttggaagagaaactgtacttgagtatttagtctctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GQ477465_C_P-A Feature FT:CDS GQ477465_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P10). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctttgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcgattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgtttgtagacgacgggtccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477466_C_P-A Feature FT:CDS GQ477466_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctrgacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacatcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatctatcttg
ccttatgtttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477467_C_P-A Feature FT:CDS GQ477467_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477468_C_P-A Feature FT:CDS GQ477468_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctatgctggggggacgtgatgacyctagctacctgggtgggtaataatttggaagatcttgca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477469_C_P-A Feature FT:CDS GQ477469_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgctgagttactctcatttttgcctctggacttctttccttccgt
tagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcagctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatcaagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaatccttccggaaactactgttattagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477470_C_P-A Feature FT:CDS GQ477470_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttttgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgacgaatctaggtacctgggtgggtaataatttggaagatcaagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactccttcagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477472_C_P-A Feature FT:CDS GQ477472_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttcctggcgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaacgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaataccaacatgggtttaaaaatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaatacttccggaaactactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477473_C_P-A Feature FT:CDS GQ477473_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcttgacttctttccttccgc
cagagatctcctagacaccgcctcagctctgtatcgagaaggcttagagtcacctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaacggctctagctacctgggtgggtggcaatttggacgatccagca
tccagggatcaagtagtcaattatgttaacactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgattatttggtctcttttggagtgtggattcgcactcctccggcctatagac
cacaaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttag
>gnl|hbvcds|GQ477474_C_P-A Feature FT:CDS GQ477474_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttaatctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtcttctgagcattgctcacctcaccatactg
caatcaggcatgtccttctctgctgggtggaattgatgactctagctaactgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagacagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttattagacgacgggaccgagtcaggtcccctagaaga
agaactccctcgcctcgcagacgcmgatctcaatcgccgcgtcgcagaagatctccatctcgggaacctcaatgttag
>gnl|hbvcds|GQ477475_C_P-A Feature FT:CDS GQ477475_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
caatccggcaagtcgttctatgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatcaagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
cactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477476_C_P-A Feature FT:CDS GQ477476_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggcgctactgctgagttactctcgtttttgcctactgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaagtactctagctacctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatgtatcttg
cattatttttggaagagagatagtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477477_C_P-A Feature FT:CDS GQ477477_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgcgagcttactctcgtttttgcctcatgacttctttccttccgt
cagagatctcctagacaccgccacagctctgtttcaagaagccttagagtctcctgagcattgctcatctcaccatactg
caatcaggcaagccattctctgctggggggaattgatgtctctagcttcctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477478_C_P-A Feature FT:CDS GQ477478_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P34). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttacctactgactactatccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaaatactgttgttagaccacggggccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|GQ477479_C_P-A Feature FT:CDS GQ477479_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctgctgactactatccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477480_C_P-A Feature FT:CDS GQ477480_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagcttctacggagttactctcgtttttgccttctgacttctttcctaacgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgaatctagctacctgggtgggtagtaatttgcaagatccagca
tccagggatctagtagtcaattatgtcaatactaacatgggtttaaagttcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477482_C_P-A Feature FT:CDS GQ477482_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgaccattataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattatctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagctcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477484_C_P-A Feature FT:CDS GQ477484_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggatgtgatgtctctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacagcaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477486_C_P-A Feature FT:CDS GQ477486_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctcatgacttctttccttccgt
cagagatctcctagacaccgccgcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctatgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477487_C_P-A Feature FT:CDS GQ477487_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P60). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctcatgacttctatccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgtcgactctagctacctgggtgggtaataatttgcaagattcagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctataggc
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggccggtcccctagagga
agaactccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477488_C_P-A Feature FT:CDS GQ477488_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P64). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgcctgctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacatcaccatactg
caatcaggcaagccattctctgctggggggaattgatgactctagcttcctgggtgggtaataatttggatgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagattgtacttgaatttttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477490_C_P-A Feature FT:CDS GQ477490_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P74). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtcgagttactctcgtttttgccttctgacttctttccttccgc
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggatgtgatgactctagctacctgggtgggtagtaatttggaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477491_C_P-A Feature FT:CDS GQ477491_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P75). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagcttctgtggacttactctcttttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcattcatcttg
cattacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
cactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttag
>gnl|hbvcds|GQ477493_C_P-A Feature FT:CDS GQ477493_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P79). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttccgc
cagggatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
caatcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaacaatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
cattacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
cactaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgccggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477494_C_P-A Feature FT:CDS GQ477494_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P80). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgtgctatgctggggggaattgatgactttagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477495_C_P-A Feature FT:CDS GQ477495_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P89). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgttccgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagttgtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caacaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477496_C_P-A Feature FT:CDS GQ477496_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P94). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatacatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgagtcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477497_C_P-A Feature FT:CDS GQ477497_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P98). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgacgactctaggtacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttattagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcactgttag
>gnl|hbvcds|GQ477498_C_P-A Feature FT:CDS GQ477498_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P100). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtaattgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477499_C_P-A Feature FT:CDS GQ477499_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P105). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgcctcttgacttctatccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgacgcaggtcccctagaaga
agaactccctcgcctcgcagacgcaaatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477500_C_P-A Feature FT:CDS GQ477500_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P107). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttccgt
caaagatcttctagacaccgcctcagctctgtatcgagaagccttagagtcttctgagcattgctcacctcaccatactg
caattaggcaagtcattctctgctggggggatgtgatgactctaggtacctgggtgggtaataatttggaagatccagcc
tccaaggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477501_C_P-A Feature FT:CDS GQ477501_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P116). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctacagtggagttactctcgtttttgcctcatgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgacaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctatgctggggggaattgacgactttaggtacctgggtgggtaataatttgaacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaatgcttccggaaactgctgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477502_C_P-A Feature FT:CDS GQ477502_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P123). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtggagttactctcgtttttgcctgctgacttctttcctaacgt
tagagatctcctagacaccgcctcagccctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggacttgatgaatctagctacctgggtgggtggtaatttgcaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttcaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagaccacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|GQ477503_C_P-A Feature FT:CDS GQ477503_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P130). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GQ477504_C_P-A Feature FT:CDS GQ477504_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P131). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagagtttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgtcgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaggttgtacatgaatatttggtctcttttggggtgtggattcgcactcctccagcctatagac
caataaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563545_C_P-A Feature FT:CDS GU563545_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagt
ccgggatctatgtgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgtcaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563546_C_P-A Feature FT:CDS GU563546_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563547_C_P-A Feature FT:CDS GU563547_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-23). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactacggacttactctcttttttgccttctgacttctttccttcagt
ccgggatctacgtgatacaacctcagctctgtatcgggaagccttagagtctcctgagcattgctcatctcaccatacag
caatcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatctttcttg
cattacttttggaagagacactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|GU563548_C_P-A Feature FT:CDS GU563548_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-108). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggacctagtagtcaattatgttaatactaacatgggcctaaagattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563550_C_P-A Feature FT:CDS GU563550_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-204). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactggggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563551_C_P-A Feature FT:CDS GU563551_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-124). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|GU563553_C_P-A Feature FT:CDS GU563553_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-10). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563554_C_P-A Feature FT:CDS GU563554_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-25). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563555_C_P-A Feature FT:CDS GU563555_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563557_C_P-A Feature FT:CDS GU563557_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-78). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563558_C_P-A Feature FT:CDS GU563558_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-90). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccggca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU563562_C_P-A Feature FT:CDS GU563562_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-189). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|GU827640_C_P-A Feature FT:CDS GU827640_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMC25B). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgacgtctctaggtacctgggtgggtaataatttggaagatcaagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|HE576988_C_P-A Feature FT:CDS HE576988_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaataataacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HE576989_C_P-A Feature FT:CDS HE576989_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P2.2.11). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM011485_C_P-A Feature FT:CDS HM011485_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgcwcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggatgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagacaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccaaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042263_C_P-A Feature FT:CDS HM042263_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 469). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagt
acgagatcttctagataccgcctcagctctgtatcgggatgccttagagtctgctgagcattgctcacctcaccatactg
cactcaggcaagcaattctgtgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM042278_C_P-A Feature FT:CDS HM042278_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 484). Partial genome (Contains: HBc, HBSP). [Hepadnaviridae] (length=552 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
tcgggatctactagatacagcctcagctctatatcgggaagccttagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM363612_C_P-A Feature FT:CDS HM363612_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagatacctccgcagctctatatcgggaagcccttgagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggagttaatgactctagccacctgggtgggtaataatttgcaagatccggca
tccagggatcaagtagtaaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagacagactgtacttgaatatttggtttctttcggagtgtggattcgcactcctccaccctatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM363613_C_P-A Feature FT:CDS HM363613_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V103). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagatacctccgcagctctatatcgggaagcccttgagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggagttaatgactctagccacctgggtgggtaataatttgcaagatccggca
tccagggatcaagtagtaaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagacagactgtacttgaatatttggtttctttcggagtgtggattcgcactcctccaccctatagac
ctccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM535200_C_P-A Feature FT:CDS HM535200_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 947 Harare). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcagacaactattgcggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|HM535205_C_P-A Feature FT:CDS HM535205_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 72 Mutare). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaattagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcggacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439720_C_P-A Feature FT:CDS JF439720_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL437). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
acgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439721_C_P-A Feature FT:CDS JF439721_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL444). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttaccctcatttttgccttctgacttctttccttccgt
acgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439722_C_P-A Feature FT:CDS JF439722_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL445). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439723_C_P-A Feature FT:CDS JF439723_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL448). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439724_C_P-A Feature FT:CDS JF439724_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL450). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcggggagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagacattctctgctggggggaattaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcgactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439725_C_P-A Feature FT:CDS JF439725_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL451). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439726_C_P-A Feature FT:CDS JF439726_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL452). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcgacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439727_C_P-A Feature FT:CDS JF439727_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL453). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439728_C_P-A Feature FT:CDS JF439728_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL454). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaaagtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439729_C_P-A Feature FT:CDS JF439729_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL455). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagacattctctgctggggggaattaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcgactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439730_C_P-A Feature FT:CDS JF439730_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL456). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaaagtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439731_C_P-A Feature FT:CDS JF439731_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL458). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaaagtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439732_C_P-A Feature FT:CDS JF439732_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL459). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439733_C_P-A Feature FT:CDS JF439733_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL460). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439734_C_P-A Feature FT:CDS JF439734_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL461). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagacattctctgctggggggaattaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439735_C_P-A Feature FT:CDS JF439735_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL462). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439736_C_P-A Feature FT:CDS JF439736_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL463). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439737_C_P-A Feature FT:CDS JF439737_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL465). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgagcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439738_C_P-A Feature FT:CDS JF439738_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL466). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttatagagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439740_C_P-A Feature FT:CDS JF439740_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL468). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccctctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattaggatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcccccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439741_C_P-A Feature FT:CDS JF439741_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL469). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaaagtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439742_C_P-A Feature FT:CDS JF439742_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL471). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439743_C_P-A Feature FT:CDS JF439743_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL472). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
acgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggccccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439744_C_P-A Feature FT:CDS JF439744_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL473). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagacattctctgctgggggggattaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcgactattgtggtttcatatttcctg
ccttacttttggaagagagactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439746_C_P-A Feature FT:CDS JF439746_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL485). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439747_C_P-A Feature FT:CDS JF439747_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL489). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcgacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439748_C_P-A Feature FT:CDS JF439748_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL490). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggatattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cacccaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatcccaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439750_C_P-A Feature FT:CDS JF439750_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL498). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439751_C_P-A Feature FT:CDS JF439751_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL499). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaagcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagacattctctgctggggggaattaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcgactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctcaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439752_C_P-A Feature FT:CDS JF439752_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439753_C_P-A Feature FT:CDS JF439753_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439754_C_P-A Feature FT:CDS JF439754_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439755_C_P-A Feature FT:CDS JF439755_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A4). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439756_C_P-A Feature FT:CDS JF439756_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439757_C_P-A Feature FT:CDS JF439757_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439758_C_P-A Feature FT:CDS JF439758_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439759_C_P-A Feature FT:CDS JF439759_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439760_C_P-A Feature FT:CDS JF439760_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439761_C_P-A Feature FT:CDS JF439761_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439762_C_P-A Feature FT:CDS JF439762_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439763_C_P-A Feature FT:CDS JF439763_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439764_C_P-A Feature FT:CDS JF439764_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439765_C_P-A Feature FT:CDS JF439765_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439766_C_P-A Feature FT:CDS JF439766_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439767_C_P-A Feature FT:CDS JF439767_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcggttttgccttgtgacttctttccttccgt
gccagatctcctacacgccgcctcaacttggtatcaggaagtcttaaagtctcctgggcattgctcgcctcaccataccg
cactcttgcatgccattctctgctggcgggaattgatgactctagctacctgggtgggtgataatttggaagatcccgca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439768_C_P-A Feature FT:CDS JF439768_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439769_C_P-A Feature FT:CDS JF439769_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439770_C_P-A Feature FT:CDS JF439770_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B12). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439771_C_P-A Feature FT:CDS JF439771_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C3). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439772_C_P-A Feature FT:CDS JF439772_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C5). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439773_C_P-A Feature FT:CDS JF439773_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C7). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439774_C_P-A Feature FT:CDS JF439774_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcagggaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatcccgca
tccagggatctagtagtcaattatgttaatactaacatgggattaaaggtcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439775_C_P-A Feature FT:CDS JF439775_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C9). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439777_C_P-A Feature FT:CDS JF439777_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05D2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439778_C_P-A Feature FT:CDS JF439778_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05D3). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439819_C_P-A Feature FT:CDS JF439819_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97A1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439820_C_P-A Feature FT:CDS JF439820_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97B1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439821_C_P-A Feature FT:CDS JF439821_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97B2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
agggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcaagaagccttaaagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatcttgtattcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttagttttggaagaaagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagactataaac
taccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgacgccggttccctaaaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcamtctcgggaatctcaatgttag
>gnl|hbvcds|JF439822_C_P-A Feature FT:CDS JF439822_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97C1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatttcgggaatctcaatgttag
>gnl|hbvcds|JF439823_C_P-A Feature FT:CDS JF439823_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97C2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439824_C_P-A Feature FT:CDS JF439824_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97D1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439825_C_P-A Feature FT:CDS JF439825_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97D2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcagctattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439826_C_P-A Feature FT:CDS JF439826_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97E1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctgctgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439827_C_P-A Feature FT:CDS JF439827_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97E2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439828_C_P-A Feature FT:CDS JF439828_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97F1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaacctcgggaatctcaatgttag
>gnl|hbvcds|JF439829_C_P-A Feature FT:CDS JF439829_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97F2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatgctg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439830_C_P-A Feature FT:CDS JF439830_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97G2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacgttgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatggctctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgcacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439831_C_P-A Feature FT:CDS JF439831_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97H1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439832_C_P-A Feature FT:CDS JF439832_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97H2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgggcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatacttggcctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439833_C_P-A Feature FT:CDS JF439833_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99H4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439834_C_P-A Feature FT:CDS JF439834_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99A4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439835_C_P-A Feature FT:CDS JF439835_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99B3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggcttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439836_C_P-A Feature FT:CDS JF439836_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99B4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439837_C_P-A Feature FT:CDS JF439837_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99C3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggcttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439838_C_P-A Feature FT:CDS JF439838_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99C4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439839_C_P-A Feature FT:CDS JF439839_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99D3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagctactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439840_C_P-A Feature FT:CDS JF439840_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99D4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439841_C_P-A Feature FT:CDS JF439841_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99E4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439842_C_P-A Feature FT:CDS JF439842_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99F3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439843_C_P-A Feature FT:CDS JF439843_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99F4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439844_C_P-A Feature FT:CDS JF439844_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99H3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439845_C_P-A Feature FT:CDS JF439845_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00H6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agagctccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439846_C_P-A Feature FT:CDS JF439846_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00A5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439847_C_P-A Feature FT:CDS JF439847_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00A6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439848_C_P-A Feature FT:CDS JF439848_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00B5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JF439849_C_P-A Feature FT:CDS JF439849_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00B6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439850_C_P-A Feature FT:CDS JF439850_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00C5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439851_C_P-A Feature FT:CDS JF439851_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00C6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439852_C_P-A Feature FT:CDS JF439852_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00D5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaacgttag
>gnl|hbvcds|JF439853_C_P-A Feature FT:CDS JF439853_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00D6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
catcaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439854_C_P-A Feature FT:CDS JF439854_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00E5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439855_C_P-A Feature FT:CDS JF439855_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00E6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtccctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439856_C_P-A Feature FT:CDS JF439856_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00F5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439857_C_P-A Feature FT:CDS JF439857_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00F6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439858_C_P-A Feature FT:CDS JF439858_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00G5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439859_C_P-A Feature FT:CDS JF439859_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00G6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcccagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaaggtcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439860_C_P-A Feature FT:CDS JF439860_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00H5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439861_C_P-A Feature FT:CDS JF439861_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05H8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaaggtccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439862_C_P-A Feature FT:CDS JF439862_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05B7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439864_C_P-A Feature FT:CDS JF439864_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05D7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacactcccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439865_C_P-A Feature FT:CDS JF439865_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05D8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439866_C_P-A Feature FT:CDS JF439866_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05F7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439867_C_P-A Feature FT:CDS JF439867_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05G8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439868_C_P-A Feature FT:CDS JF439868_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05H7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439869_C_P-A Feature FT:CDS JF439869_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439870_C_P-A Feature FT:CDS JF439870_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439871_C_P-A Feature FT:CDS JF439871_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439872_C_P-A Feature FT:CDS JF439872_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439873_C_P-A Feature FT:CDS JF439873_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF439874_C_P-A Feature FT:CDS JF439874_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439875_C_P-A Feature FT:CDS JF439875_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF439876_C_P-A Feature FT:CDS JF439876_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439877_C_P-A Feature FT:CDS JF439877_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439878_C_P-A Feature FT:CDS JF439878_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439879_C_P-A Feature FT:CDS JF439879_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439880_C_P-A Feature FT:CDS JF439880_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439881_C_P-A Feature FT:CDS JF439881_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439882_C_P-A Feature FT:CDS JF439882_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439883_C_P-A Feature FT:CDS JF439883_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagacaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439886_C_P-A Feature FT:CDS JF439886_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F1). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439887_C_P-A Feature FT:CDS JF439887_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F2_rev_comp). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439888_C_P-A Feature FT:CDS JF439888_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F3). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439889_C_P-A Feature FT:CDS JF439889_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F4). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttacggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439890_C_P-A Feature FT:CDS JF439890_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F5). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439891_C_P-A Feature FT:CDS JF439891_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F6). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439892_C_P-A Feature FT:CDS JF439892_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F8). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439893_C_P-A Feature FT:CDS JF439893_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F9). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439894_C_P-A Feature FT:CDS JF439894_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F11). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439895_C_P-A Feature FT:CDS JF439895_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BIL2001F12). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|JF439896_C_P-A Feature FT:CDS JF439896_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439897_C_P-A Feature FT:CDS JF439897_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439898_C_P-A Feature FT:CDS JF439898_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439899_C_P-A Feature FT:CDS JF439899_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439900_C_P-A Feature FT:CDS JF439900_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctctggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439901_C_P-A Feature FT:CDS JF439901_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439902_C_P-A Feature FT:CDS JF439902_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439903_C_P-A Feature FT:CDS JF439903_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439904_C_P-A Feature FT:CDS JF439904_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439905_C_P-A Feature FT:CDS JF439905_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439906_C_P-A Feature FT:CDS JF439906_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439907_C_P-A Feature FT:CDS JF439907_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439908_C_P-A Feature FT:CDS JF439908_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggtgggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439909_C_P-A Feature FT:CDS JF439909_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
cacaaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439910_C_P-A Feature FT:CDS JF439910_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgagatctcctagataccgcctcagctctctatcgggaatcattagaatctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggatgtaatgactctagctacctgggtgggtactaatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcctg
ccttacttttggaagagaaactgtacttgagtatttggtttctttcggagtgtggattcgcacgcctccggcctatagac
caccaaatgcccctatcttatcaacacttcctgaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439911_C_P-A Feature FT:CDS JF439911_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcggctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtttcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439912_C_P-A Feature FT:CDS JF439912_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439913_C_P-A Feature FT:CDS JF439913_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439914_C_P-A Feature FT:CDS JF439914_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439915_C_P-A Feature FT:CDS JF439915_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcgtatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439916_C_P-A Feature FT:CDS JF439916_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439917_C_P-A Feature FT:CDS JF439917_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439918_C_P-A Feature FT:CDS JF439918_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439919_C_P-A Feature FT:CDS JF439919_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439920_C_P-A Feature FT:CDS JF439920_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439921_C_P-A Feature FT:CDS JF439921_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgactcctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439922_C_P-A Feature FT:CDS JF439922_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439923_C_P-A Feature FT:CDS JF439923_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgtgag
>gnl|hbvcds|JF439924_C_P-A Feature FT:CDS JF439924_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439925_C_P-A Feature FT:CDS JF439925_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgctcctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439926_C_P-A Feature FT:CDS JF439926_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B4). Partial genome (Contains: HBc, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactaatgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgtccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439927_C_P-A Feature FT:CDS JF439927_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggcgctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctactagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagcttcctgggtgggtaataatttgcaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttag
>gnl|hbvcds|JF439928_C_P-A Feature FT:CDS JF439928_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccaggaatctagtagtcaattatgttagtactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439929_C_P-A Feature FT:CDS JF439929_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgactcctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaataccaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccggggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439930_C_P-A Feature FT:CDS JF439930_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtctcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaataccaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439931_C_P-A Feature FT:CDS JF439931_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagaaatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccagggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439932_C_P-A Feature FT:CDS JF439932_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttaccaacacttccggaatgtactgttgttagacgaagggaccgagtcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439933_C_P-A Feature FT:CDS JF439933_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagagtttggagctactgcagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439934_C_P-A Feature FT:CDS JF439934_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaataccaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccggggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439935_C_P-A Feature FT:CDS JF439935_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaaccattgtggtttcatatatcttg
ccttacttttggaagaaatactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccagggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439936_C_P-A Feature FT:CDS JF439936_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccggggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439937_C_P-A Feature FT:CDS JF439937_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439938_C_P-A Feature FT:CDS JF439938_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagccactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439939_C_P-A Feature FT:CDS JF439939_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439940_C_P-A Feature FT:CDS JF439940_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccggggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439941_C_P-A Feature FT:CDS JF439941_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgacactagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtcccttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439942_C_P-A Feature FT:CDS JF439942_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagctactgtagagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtttcgagatgccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagatactgtaattgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaatgtactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439943_C_P-A Feature FT:CDS JF439943_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439944_C_P-A Feature FT:CDS JF439944_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacatggacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgctag
>gnl|hbvcds|JF439945_C_P-A Feature FT:CDS JF439945_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439946_C_P-A Feature FT:CDS JF439946_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439947_C_P-A Feature FT:CDS JF439947_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439948_C_P-A Feature FT:CDS JF439948_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439949_C_P-A Feature FT:CDS JF439949_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaaggtcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439950_C_P-A Feature FT:CDS JF439950_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439951_C_P-A Feature FT:CDS JF439951_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439952_C_P-A Feature FT:CDS JF439952_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgccttgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439953_C_P-A Feature FT:CDS JF439953_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgcctcctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttggatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439954_C_P-A Feature FT:CDS JF439954_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggatactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcgatctcgggaatctcaatgttag
>gnl|hbvcds|JF439955_C_P-A Feature FT:CDS JF439955_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagggagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439956_C_P-A Feature FT:CDS JF439956_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagagatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439957_C_P-A Feature FT:CDS JF439957_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagacctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439958_C_P-A Feature FT:CDS JF439958_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggaggaattgatgactctagctacctgggtgggcaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcccatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagagga
ggaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439959_C_P-A Feature FT:CDS JF439959_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439960_C_P-A Feature FT:CDS JF439960_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccctccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439961_C_P-A Feature FT:CDS JF439961_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439962_C_P-A Feature FT:CDS JF439962_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcatctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtccctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439963_C_P-A Feature FT:CDS JF439963_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttatacgacgagactgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacttcaatgttag
>gnl|hbvcds|JF439964_C_P-A Feature FT:CDS JF439964_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcgatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439965_C_P-A Feature FT:CDS JF439965_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439966_C_P-A Feature FT:CDS JF439966_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c8). Partial genome (Contains: HBe, HBc, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439967_C_P-A Feature FT:CDS JF439967_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactggggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttctgaaaatagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagtc
cactaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcacgtcccctacaaca
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439968_C_P-A Feature FT:CDS JF439968_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctttgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439969_C_P-A Feature FT:CDS JF439969_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattggcccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttgctttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctccatgttag
>gnl|hbvcds|JF439970_C_P-A Feature FT:CDS JF439970_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagctactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttaggcgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439971_C_P-A Feature FT:CDS JF439971_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcctttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
aggactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439972_C_P-A Feature FT:CDS JF439972_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactcccatttttgccttctgacttctttccttccgt
ccgagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439973_C_P-A Feature FT:CDS JF439973_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgactcctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttggagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccgttctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439974_C_P-A Feature FT:CDS JF439974_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatattag
>gnl|hbvcds|JF439975_C_P-A Feature FT:CDS JF439975_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactctctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439976_C_P-A Feature FT:CDS JF439976_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactctctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439977_C_P-A Feature FT:CDS JF439977_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439978_C_P-A Feature FT:CDS JF439978_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439979_C_P-A Feature FT:CDS JF439979_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattccctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439980_C_P-A Feature FT:CDS JF439980_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaaggtcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439981_C_P-A Feature FT:CDS JF439981_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctaggcaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaagtatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439982_C_P-A Feature FT:CDS JF439982_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggcgctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttag
>gnl|hbvcds|JF439983_C_P-A Feature FT:CDS JF439983_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagacccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
ggaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439984_C_P-A Feature FT:CDS JF439984_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagaccaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439985_C_P-A Feature FT:CDS JF439985_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttaccctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcgctcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439986_C_P-A Feature FT:CDS JF439986_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttatatagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgctgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439987_C_P-A Feature FT:CDS JF439987_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439988_C_P-A Feature FT:CDS JF439988_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439989_C_P-A Feature FT:CDS JF439989_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439990_C_P-A Feature FT:CDS JF439990_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttaccaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439991_C_P-A Feature FT:CDS JF439991_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439992_C_P-A Feature FT:CDS JF439992_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacctctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcgggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF439993_C_P-A Feature FT:CDS JF439993_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JF440016_C_P-A Feature FT:CDS JF440016_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B11). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggattaaagatcaggcaactcttgtggtttcatatctcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182318_C_P-A Feature FT:CDS JN182318_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182319_C_P-A Feature FT:CDS JN182319_C_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182320_C_P-A Feature FT:CDS JN182320_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182321_C_P-A Feature FT:CDS JN182321_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182322_C_P-A Feature FT:CDS JN182322_C_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182323_C_P-A Feature FT:CDS JN182323_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcctacggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182324_C_P-A Feature FT:CDS JN182324_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182325_C_P-A Feature FT:CDS JN182325_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatacag
cactcaggcaagccattctccgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182326_C_P-A Feature FT:CDS JN182326_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttggagtctcctgagcattgctcacctcaccatacag
cactcaggcaaaccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182327_C_P-A Feature FT:CDS JN182327_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagcg
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182328_C_P-A Feature FT:CDS JN182328_C_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182329_C_P-A Feature FT:CDS JN182329_C_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacgactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182330_C_P-A Feature FT:CDS JN182330_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182331_C_P-A Feature FT:CDS JN182331_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccctctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182332_C_P-A Feature FT:CDS JN182332_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaacgattgtggtttcatatttcttg
ccttacttttggaagagaaactgcccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182333_C_P-A Feature FT:CDS JN182333_C_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaactaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JN182334_C_P-A Feature FT:CDS JN182334_C_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctacttgataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaaccaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctggtagtcaattatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggccggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagtagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ023660_C_P-A Feature FT:CDS JQ023660_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1160). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaaggcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaagtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ023661_C_P-A Feature FT:CDS JQ023661_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1158). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaaggcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ023662_C_P-A Feature FT:CDS JQ023662_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1164). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaaggcccctatcttatcaacacttccggaaactactgttgtttgacgacgagaccgaggcaggtcccctaaaaga
agaactccctcgcctcgcagacgaaaatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ023663_C_P-A Feature FT:CDS JQ023663_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1159). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagacttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaaggcccctatcttatcaacacttccggaaactactgttgtttgacgacgagaccgaggccggtcccctaaaaga
agaactccctcgcctcgcaaacgaaaatctcaatcgccgcgtcgcaaaaaatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ687529_C_P-A Feature FT:CDS JQ687529_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 176). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ687533_C_P-A Feature FT:CDS JQ687533_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Srb 210). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggcaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcaaacgcagatctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707299_C_P-A Feature FT:CDS JQ707299_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggacgatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707300_C_P-A Feature FT:CDS JQ707300_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C11). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707301_C_P-A Feature FT:CDS JQ707301_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C12). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707302_C_P-A Feature FT:CDS JQ707302_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C13). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707303_C_P-A Feature FT:CDS JQ707303_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagacccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707304_C_P-A Feature FT:CDS JQ707304_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C15). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707305_C_P-A Feature FT:CDS JQ707305_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C16). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707306_C_P-A Feature FT:CDS JQ707306_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C17). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707307_C_P-A Feature FT:CDS JQ707307_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C18). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707308_C_P-A Feature FT:CDS JQ707308_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C19). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707309_C_P-A Feature FT:CDS JQ707309_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707310_C_P-A Feature FT:CDS JQ707310_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C20). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707311_C_P-A Feature FT:CDS JQ707311_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C21). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707312_C_P-A Feature FT:CDS JQ707312_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C22). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttaatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707313_C_P-A Feature FT:CDS JQ707313_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C23). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707314_C_P-A Feature FT:CDS JQ707314_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C24). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707315_C_P-A Feature FT:CDS JQ707315_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C25). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctggcttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttggagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707316_C_P-A Feature FT:CDS JQ707316_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C26). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707317_C_P-A Feature FT:CDS JQ707317_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707318_C_P-A Feature FT:CDS JQ707318_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707319_C_P-A Feature FT:CDS JQ707319_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggacgatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707320_C_P-A Feature FT:CDS JQ707320_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C30). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707321_C_P-A Feature FT:CDS JQ707321_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C31). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707322_C_P-A Feature FT:CDS JQ707322_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C32). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707323_C_P-A Feature FT:CDS JQ707323_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C33). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707324_C_P-A Feature FT:CDS JQ707324_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C34). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagagatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacctttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707325_C_P-A Feature FT:CDS JQ707325_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C35). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaaacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707326_C_P-A Feature FT:CDS JQ707326_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C36). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707327_C_P-A Feature FT:CDS JQ707327_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707328_C_P-A Feature FT:CDS JQ707328_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttggagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctgtgctggggggaattgatgactctagctacctgggtgggtaataatttgtaagatccagca
tcaagggatctagtattcaattatgttaattctaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
cattacttttggaagagagaaggtactagaatatttggtccctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707329_C_P-A Feature FT:CDS JQ707329_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C39). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaaaacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707330_C_P-A Feature FT:CDS JQ707330_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707331_C_P-A Feature FT:CDS JQ707331_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactgctgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707332_C_P-A Feature FT:CDS JQ707332_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaattcggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaaacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707333_C_P-A Feature FT:CDS JQ707333_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C42). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707334_C_P-A Feature FT:CDS JQ707334_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C43). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaacgttag
>gnl|hbvcds|JQ707335_C_P-A Feature FT:CDS JQ707335_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C44). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttag
>gnl|hbvcds|JQ707336_C_P-A Feature FT:CDS JQ707336_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C45). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgcatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707337_C_P-A Feature FT:CDS JQ707337_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C46). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707338_C_P-A Feature FT:CDS JQ707338_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C47). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707339_C_P-A Feature FT:CDS JQ707339_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C48). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagggtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgtcaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707340_C_P-A Feature FT:CDS JQ707340_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C5). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707341_C_P-A Feature FT:CDS JQ707341_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C6). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707342_C_P-A Feature FT:CDS JQ707342_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C7). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707343_C_P-A Feature FT:CDS JQ707343_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707344_C_P-A Feature FT:CDS JQ707344_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM1-C9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707345_C_P-A Feature FT:CDS JQ707345_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C1). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttagtctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707346_C_P-A Feature FT:CDS JQ707346_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C12). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagaaccagca
tcaagggatctagtagtcaactatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagactatagat
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707347_C_P-A Feature FT:CDS JQ707347_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C13). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707348_C_P-A Feature FT:CDS JQ707348_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707349_C_P-A Feature FT:CDS JQ707349_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C15). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707350_C_P-A Feature FT:CDS JQ707350_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C16). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707351_C_P-A Feature FT:CDS JQ707351_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtttctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707352_C_P-A Feature FT:CDS JQ707352_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C20). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagccactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707353_C_P-A Feature FT:CDS JQ707353_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C21). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707354_C_P-A Feature FT:CDS JQ707354_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C22-2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707355_C_P-A Feature FT:CDS JQ707355_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C25). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707356_C_P-A Feature FT:CDS JQ707356_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgagtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707357_C_P-A Feature FT:CDS JQ707357_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C29-2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707358_C_P-A Feature FT:CDS JQ707358_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C33). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707359_C_P-A Feature FT:CDS JQ707359_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707360_C_P-A Feature FT:CDS JQ707360_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C36). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccatcctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707361_C_P-A Feature FT:CDS JQ707361_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C37). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707362_C_P-A Feature FT:CDS JQ707362_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C39). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707363_C_P-A Feature FT:CDS JQ707363_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707364_C_P-A Feature FT:CDS JQ707364_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707365_C_P-A Feature FT:CDS JQ707365_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C43). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707366_C_P-A Feature FT:CDS JQ707366_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C44). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707367_C_P-A Feature FT:CDS JQ707367_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C46). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactttcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707368_C_P-A Feature FT:CDS JQ707368_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C47). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttctaaagaatttggagctactgtggagttactctcgtttctgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctttgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcgtatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggttccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707369_C_P-A Feature FT:CDS JQ707369_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C48). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcctttttgccctctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcacactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707370_C_P-A Feature FT:CDS JQ707370_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BMM3-C5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgt
cagagatctcctggacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707371_C_P-A Feature FT:CDS JQ707371_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707372_C_P-A Feature FT:CDS JQ707372_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C11). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707373_C_P-A Feature FT:CDS JQ707373_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707374_C_P-A Feature FT:CDS JQ707374_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C15). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707375_C_P-A Feature FT:CDS JQ707375_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C17-2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707376_C_P-A Feature FT:CDS JQ707376_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707377_C_P-A Feature FT:CDS JQ707377_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C21). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707378_C_P-A Feature FT:CDS JQ707378_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C22). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707379_C_P-A Feature FT:CDS JQ707379_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C24-9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707380_C_P-A Feature FT:CDS JQ707380_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707381_C_P-A Feature FT:CDS JQ707381_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707382_C_P-A Feature FT:CDS JQ707382_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtggataataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707383_C_P-A Feature FT:CDS JQ707383_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C31). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707384_C_P-A Feature FT:CDS JQ707384_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C32). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagacggtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707385_C_P-A Feature FT:CDS JQ707385_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C33). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707386_C_P-A Feature FT:CDS JQ707386_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C34). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttaccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707387_C_P-A Feature FT:CDS JQ707387_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C36). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactcccgcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707388_C_P-A Feature FT:CDS JQ707388_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C37). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctactagtcaattatgttaatggtgacatgggtttaaaaattaggcaactagggaggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707389_C_P-A Feature FT:CDS JQ707389_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C38). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707390_C_P-A Feature FT:CDS JQ707390_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C39). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707391_C_P-A Feature FT:CDS JQ707391_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707392_C_P-A Feature FT:CDS JQ707392_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707393_C_P-A Feature FT:CDS JQ707393_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C42). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707394_C_P-A Feature FT:CDS JQ707394_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C44). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707395_C_P-A Feature FT:CDS JQ707395_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C46). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgcggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707396_C_P-A Feature FT:CDS JQ707396_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C47). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatattaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707397_C_P-A Feature FT:CDS JQ707397_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C48). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707398_C_P-A Feature FT:CDS JQ707398_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707399_C_P-A Feature FT:CDS JQ707399_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA1-C6). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707400_C_P-A Feature FT:CDS JQ707400_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707401_C_P-A Feature FT:CDS JQ707401_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C10). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttagaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707402_C_P-A Feature FT:CDS JQ707402_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C11-3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707403_C_P-A Feature FT:CDS JQ707403_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C16). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707404_C_P-A Feature FT:CDS JQ707404_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C17). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cgctcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707405_C_P-A Feature FT:CDS JQ707405_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C18). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707406_C_P-A Feature FT:CDS JQ707406_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C19). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707407_C_P-A Feature FT:CDS JQ707407_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C20-9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707408_C_P-A Feature FT:CDS JQ707408_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C23). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707409_C_P-A Feature FT:CDS JQ707409_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C26-5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707410_C_P-A Feature FT:CDS JQ707410_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707411_C_P-A Feature FT:CDS JQ707411_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707412_C_P-A Feature FT:CDS JQ707412_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C32). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707413_C_P-A Feature FT:CDS JQ707413_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C34). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707414_C_P-A Feature FT:CDS JQ707414_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcaactctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707415_C_P-A Feature FT:CDS JQ707415_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgtcaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707416_C_P-A Feature FT:CDS JQ707416_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707417_C_P-A Feature FT:CDS JQ707417_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C44). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707418_C_P-A Feature FT:CDS JQ707418_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C47). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707419_C_P-A Feature FT:CDS JQ707419_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C48). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctccttgacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccggggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707420_C_P-A Feature FT:CDS JQ707420_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HOLA3-C6). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707531_C_P-A Feature FT:CDS JQ707531_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707532_C_P-A Feature FT:CDS JQ707532_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C10). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707533_C_P-A Feature FT:CDS JQ707533_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C11). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707534_C_P-A Feature FT:CDS JQ707534_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C12). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagtctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707535_C_P-A Feature FT:CDS JQ707535_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C13). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707536_C_P-A Feature FT:CDS JQ707536_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707537_C_P-A Feature FT:CDS JQ707537_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C15). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707538_C_P-A Feature FT:CDS JQ707538_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C16). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707539_C_P-A Feature FT:CDS JQ707539_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C17). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaatatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707540_C_P-A Feature FT:CDS JQ707540_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C18). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707541_C_P-A Feature FT:CDS JQ707541_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C19). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707542_C_P-A Feature FT:CDS JQ707542_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C21). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707543_C_P-A Feature FT:CDS JQ707543_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C22). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707544_C_P-A Feature FT:CDS JQ707544_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C23). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707545_C_P-A Feature FT:CDS JQ707545_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C24). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707546_C_P-A Feature FT:CDS JQ707546_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C26). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707547_C_P-A Feature FT:CDS JQ707547_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707548_C_P-A Feature FT:CDS JQ707548_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707549_C_P-A Feature FT:CDS JQ707549_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C29). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707550_C_P-A Feature FT:CDS JQ707550_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggatcgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707551_C_P-A Feature FT:CDS JQ707551_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C30). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactttagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707552_C_P-A Feature FT:CDS JQ707552_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C31). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707553_C_P-A Feature FT:CDS JQ707553_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C32). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707554_C_P-A Feature FT:CDS JQ707554_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C33). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707555_C_P-A Feature FT:CDS JQ707555_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C34). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggggaaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707556_C_P-A Feature FT:CDS JQ707556_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707557_C_P-A Feature FT:CDS JQ707557_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C36). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707558_C_P-A Feature FT:CDS JQ707558_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C38). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707559_C_P-A Feature FT:CDS JQ707559_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707560_C_P-A Feature FT:CDS JQ707560_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707561_C_P-A Feature FT:CDS JQ707561_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707562_C_P-A Feature FT:CDS JQ707562_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C42). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707563_C_P-A Feature FT:CDS JQ707563_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C43). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctcgctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707564_C_P-A Feature FT:CDS JQ707564_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C44). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707565_C_P-A Feature FT:CDS JQ707565_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C45). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattcctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707566_C_P-A Feature FT:CDS JQ707566_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C46). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707567_C_P-A Feature FT:CDS JQ707567_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C47). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707568_C_P-A Feature FT:CDS JQ707568_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C48). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707569_C_P-A Feature FT:CDS JQ707569_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707570_C_P-A Feature FT:CDS JQ707570_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C6). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707571_C_P-A Feature FT:CDS JQ707571_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C7). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707572_C_P-A Feature FT:CDS JQ707572_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707573_C_P-A Feature FT:CDS JQ707573_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM1-C9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707574_C_P-A Feature FT:CDS JQ707574_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C10). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707575_C_P-A Feature FT:CDS JQ707575_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C13). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707576_C_P-A Feature FT:CDS JQ707576_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C14). Complete genome. [Hepadnaviridae] (length=558 residues).
atgaacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactcacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707577_C_P-A Feature FT:CDS JQ707577_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C15). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707578_C_P-A Feature FT:CDS JQ707578_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C16). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactcttgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccggca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707579_C_P-A Feature FT:CDS JQ707579_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C17). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707580_C_P-A Feature FT:CDS JQ707580_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C18). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggggctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707581_C_P-A Feature FT:CDS JQ707581_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C19). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtactcgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707582_C_P-A Feature FT:CDS JQ707582_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C2). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagccctgtatcgagaagccttagagtctcctgagcattgctcatctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707583_C_P-A Feature FT:CDS JQ707583_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C21). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707584_C_P-A Feature FT:CDS JQ707584_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C22). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707585_C_P-A Feature FT:CDS JQ707585_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C23). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707586_C_P-A Feature FT:CDS JQ707586_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C24). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707587_C_P-A Feature FT:CDS JQ707587_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C25). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707588_C_P-A Feature FT:CDS JQ707588_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C26). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707589_C_P-A Feature FT:CDS JQ707589_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707590_C_P-A Feature FT:CDS JQ707590_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggcgctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707591_C_P-A Feature FT:CDS JQ707591_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C29). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707592_C_P-A Feature FT:CDS JQ707592_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaa
>gnl|hbvcds|JQ707593_C_P-A Feature FT:CDS JQ707593_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C33). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactcgcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707594_C_P-A Feature FT:CDS JQ707594_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C34). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707595_C_P-A Feature FT:CDS JQ707595_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707596_C_P-A Feature FT:CDS JQ707596_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C36). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707597_C_P-A Feature FT:CDS JQ707597_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C37). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707598_C_P-A Feature FT:CDS JQ707598_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C38). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707599_C_P-A Feature FT:CDS JQ707599_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707600_C_P-A Feature FT:CDS JQ707600_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C40). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|JQ707601_C_P-A Feature FT:CDS JQ707601_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707602_C_P-A Feature FT:CDS JQ707602_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C42). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagacattctctgctgggggaaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707603_C_P-A Feature FT:CDS JQ707603_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C43). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtactcgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707604_C_P-A Feature FT:CDS JQ707604_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C44). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707605_C_P-A Feature FT:CDS JQ707605_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C45). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagacattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaacgatcaggcgactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707606_C_P-A Feature FT:CDS JQ707606_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C48). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707607_C_P-A Feature FT:CDS JQ707607_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagatgtcgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707608_C_P-A Feature FT:CDS JQ707608_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PM3-C9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtaaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707609_C_P-A Feature FT:CDS JQ707609_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707610_C_P-A Feature FT:CDS JQ707610_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C10). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707611_C_P-A Feature FT:CDS JQ707611_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C11). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707612_C_P-A Feature FT:CDS JQ707612_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C13). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcctg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707613_C_P-A Feature FT:CDS JQ707613_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C15). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707614_C_P-A Feature FT:CDS JQ707614_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C17). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707615_C_P-A Feature FT:CDS JQ707615_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C18). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
ctctcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707616_C_P-A Feature FT:CDS JQ707616_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707617_C_P-A Feature FT:CDS JQ707617_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C21). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707618_C_P-A Feature FT:CDS JQ707618_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C22). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707619_C_P-A Feature FT:CDS JQ707619_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C23). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707620_C_P-A Feature FT:CDS JQ707620_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C24). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707621_C_P-A Feature FT:CDS JQ707621_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C26). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707622_C_P-A Feature FT:CDS JQ707622_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707623_C_P-A Feature FT:CDS JQ707623_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtttcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707624_C_P-A Feature FT:CDS JQ707624_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707625_C_P-A Feature FT:CDS JQ707625_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C30). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707626_C_P-A Feature FT:CDS JQ707626_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C31). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707627_C_P-A Feature FT:CDS JQ707627_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C32). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707628_C_P-A Feature FT:CDS JQ707628_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C33). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707629_C_P-A Feature FT:CDS JQ707629_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C34). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707630_C_P-A Feature FT:CDS JQ707630_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C35). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707631_C_P-A Feature FT:CDS JQ707631_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C36-6). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707632_C_P-A Feature FT:CDS JQ707632_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C4). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707633_C_P-A Feature FT:CDS JQ707633_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707634_C_P-A Feature FT:CDS JQ707634_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C42). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggaactagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707635_C_P-A Feature FT:CDS JQ707635_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C45). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgccacgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707636_C_P-A Feature FT:CDS JQ707636_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C46). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707637_C_P-A Feature FT:CDS JQ707637_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT1-C5-5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707638_C_P-A Feature FT:CDS JQ707638_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C12). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707639_C_P-A Feature FT:CDS JQ707639_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C13-9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707640_C_P-A Feature FT:CDS JQ707640_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707641_C_P-A Feature FT:CDS JQ707641_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C17). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707642_C_P-A Feature FT:CDS JQ707642_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707643_C_P-A Feature FT:CDS JQ707643_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C20-7). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707644_C_P-A Feature FT:CDS JQ707644_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C22). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707645_C_P-A Feature FT:CDS JQ707645_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C24). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707646_C_P-A Feature FT:CDS JQ707646_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C26). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707647_C_P-A Feature FT:CDS JQ707647_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C27). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707648_C_P-A Feature FT:CDS JQ707648_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707649_C_P-A Feature FT:CDS JQ707649_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707650_C_P-A Feature FT:CDS JQ707650_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C30). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707651_C_P-A Feature FT:CDS JQ707651_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C33). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707652_C_P-A Feature FT:CDS JQ707652_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C34). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707653_C_P-A Feature FT:CDS JQ707653_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C38). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707654_C_P-A Feature FT:CDS JQ707654_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C40). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707655_C_P-A Feature FT:CDS JQ707655_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccgtctgatttctttccttccgt
cagagagctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707656_C_P-A Feature FT:CDS JQ707656_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate RT3-C43). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707658_C_P-A Feature FT:CDS JQ707658_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_13). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707659_C_P-A Feature FT:CDS JQ707659_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707661_C_P-A Feature FT:CDS JQ707661_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_18). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707662_C_P-A Feature FT:CDS JQ707662_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_19). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggacctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707663_C_P-A Feature FT:CDS JQ707663_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707664_C_P-A Feature FT:CDS JQ707664_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_20). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707665_C_P-A Feature FT:CDS JQ707665_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_21). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcaccccaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707667_C_P-A Feature FT:CDS JQ707667_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_25). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707669_C_P-A Feature FT:CDS JQ707669_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_28). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707670_C_P-A Feature FT:CDS JQ707670_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_29). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707672_C_P-A Feature FT:CDS JQ707672_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_32). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707674_C_P-A Feature FT:CDS JQ707674_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_38). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707675_C_P-A Feature FT:CDS JQ707675_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_41). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707676_C_P-A Feature FT:CDS JQ707676_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_42). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JQ707681_C_P-A Feature FT:CDS JQ707681_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S11_9-12). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX096952_C_P-A Feature FT:CDS JX096952_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11-10165). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX096953_C_P-A Feature FT:CDS JX096953_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 12-8957). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttaccctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX154579_C_P-A Feature FT:CDS JX154579_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS36). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagctattgtctgctggggggaattaatgactctaggtacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggaaatctcaatgttag
>gnl|hbvcds|JX154580_C_P-A Feature FT:CDS JX154580_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS46). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagctattgtctgctggggggaattaatgactctaggtacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX154581_C_P-A Feature FT:CDS JX154581_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS51). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagctattgtctgctggggggaattaatgactctaggtacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX154582_C_P-A Feature FT:CDS JX154582_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVFLS64). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacctttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagctattgtctgctggggggaattaatgactctaggtacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcagacaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcctttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagacagaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX310721_C_P-A Feature FT:CDS JX310721_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggagaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX310722_C_P-A Feature FT:CDS JX310722_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcatatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX310723_C_P-A Feature FT:CDS JX310723_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D5). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactgttgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX310724_C_P-A Feature FT:CDS JX310724_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|JX310725_C_P-A Feature FT:CDS JX310725_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate D3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagaatctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC836831_C_P-A Feature FT:CDS KC836831_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH2). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttcttgacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC836832_C_P-A Feature FT:CDS KC836832_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH3). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC836834_C_P-A Feature FT:CDS KC836834_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH5). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttctat
tcgagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC836846_C_P-A Feature FT:CDS KC836846_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH22). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgt
ccgggatctacttgatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatttagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC836849_C_P-A Feature FT:CDS KC836849_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH25). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC836854_C_P-A Feature FT:CDS KC836854_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH32). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC836858_C_P-A Feature FT:CDS KC836858_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate AH38). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875251_C_P-A Feature FT:CDS KC875251_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV1). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagggtctcctgagcattgctcacctcaccatccag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875252_C_P-A Feature FT:CDS KC875252_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV3). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattcactgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875253_C_P-A Feature FT:CDS KC875253_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV23). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacgttgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactaaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875254_C_P-A Feature FT:CDS KC875254_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV12). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875255_C_P-A Feature FT:CDS KC875255_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV24). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagacaaactgtccttgagtatttggtccctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875256_C_P-A Feature FT:CDS KC875256_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV27). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgcgcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875257_C_P-A Feature FT:CDS KC875257_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV14). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgaatctagctacctgggcgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
cgccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875258_C_P-A Feature FT:CDS KC875258_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV66). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccaggctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875259_C_P-A Feature FT:CDS KC875259_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV73). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttatcaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcatg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaacttgtgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KC875260_C_P-A Feature FT:CDS KC875260_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV5). Non-functional genomic sequence. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctctcctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagccacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
tcttacttttggaagacagactgtgctagaatatttggtctctttcggagtgtggattcgcactcctccagcttatagac
caccaaatgcccctatcttatcaacacttccggagactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214657_C_P-A Feature FT:CDS KF214657_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-1). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagatactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214658_C_P-A Feature FT:CDS KF214658_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-6). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggggaaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttg
ccttactttcggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214659_C_P-A Feature FT:CDS KF214659_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2009-2). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggtgaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214660_C_P-A Feature FT:CDS KF214660_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-9). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggcgctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctacaagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacatcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggacttagtagtcaattatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214661_C_P-A Feature FT:CDS KF214661_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-8). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
acgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggagagctgttctgtgttggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tctagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214662_C_P-A Feature FT:CDS KF214662_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-14). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcc
tccagggatctagtagtcaattatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214663_C_P-A Feature FT:CDS KF214663_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2007-11). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaaaatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214665_C_P-A Feature FT:CDS KF214665_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2008-3). Complete genome. [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF214666_C_P-A Feature FT:CDS KF214666_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate IND-2010-7). Complete genome. [Hepadnaviridae] (length=552 residues).
atggacatcgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccgttctctgctggggggaattaacgactttagctggctgggtgggtcataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctcttttggagtgtggattcgcactcctccaccttatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaact
ccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KF779210_C_P-A Feature FT:CDS KF779210_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5547). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggagcctactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KF779211_C_P-A Feature FT:CDS KF779211_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5691). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacacttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcgtagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttag
>gnl|hbvcds|KF779213_C_P-A Feature FT:CDS KF779213_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5744). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgatagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctccacctccgcaatctcaatgttag
>gnl|hbvcds|KF779215_C_P-A Feature FT:CDS KF779215_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5763). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagaaactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgatagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctccacctccgcaatctcaatgttag
>gnl|hbvcds|KF779221_C_P-A Feature FT:CDS KF779221_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN5934). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcgtagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattgtctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatagtgatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779227_C_P-A Feature FT:CDS KF779227_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6061). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctctcctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779231_C_P-A Feature FT:CDS KF779231_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6084). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779232_C_P-A Feature FT:CDS KF779232_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6088). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggcaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779234_C_P-A Feature FT:CDS KF779234_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6104). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatctcttg
ccttacttttggaagagaaacagtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779238_C_P-A Feature FT:CDS KF779238_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6119). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779239_C_P-A Feature FT:CDS KF779239_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6120). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcatacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779240_C_P-A Feature FT:CDS KF779240_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6123). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatttagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779243_C_P-A Feature FT:CDS KF779243_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6142). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779244_C_P-A Feature FT:CDS KF779244_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6152). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779245_C_P-A Feature FT:CDS KF779245_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6156). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779246_C_P-A Feature FT:CDS KF779246_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6163). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779247_C_P-A Feature FT:CDS KF779247_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6164). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779248_C_P-A Feature FT:CDS KF779248_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6168). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779249_C_P-A Feature FT:CDS KF779249_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate DEN6173). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggatgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779251_C_P-A Feature FT:CDS KF779251_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3787). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779252_C_P-A Feature FT:CDS KF779252_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3809). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779253_C_P-A Feature FT:CDS KF779253_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3817). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcttcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779254_C_P-A Feature FT:CDS KF779254_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3820). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttcctttcgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779255_C_P-A Feature FT:CDS KF779255_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3825). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779256_C_P-A Feature FT:CDS KF779256_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3829). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcttcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779257_C_P-A Feature FT:CDS KF779257_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3857). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcaccgcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779258_C_P-A Feature FT:CDS KF779258_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3864). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779259_C_P-A Feature FT:CDS KF779259_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3892). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779260_C_P-A Feature FT:CDS KF779260_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3894). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaacattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779261_C_P-A Feature FT:CDS KF779261_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3896). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattagacaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779262_C_P-A Feature FT:CDS KF779262_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3898). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779263_C_P-A Feature FT:CDS KF779263_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3903). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779264_C_P-A Feature FT:CDS KF779264_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3945). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779265_C_P-A Feature FT:CDS KF779265_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3946). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcttatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779266_C_P-A Feature FT:CDS KF779266_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3949). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccggcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779268_C_P-A Feature FT:CDS KF779268_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA3966). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcttcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcatctctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779269_C_P-A Feature FT:CDS KF779269_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4207). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctggctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattagacaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779270_C_P-A Feature FT:CDS KF779270_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4219). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaagggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779271_C_P-A Feature FT:CDS KF779271_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4233). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcttcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779272_C_P-A Feature FT:CDS KF779272_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4236). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcgtagacaccgcctcagctctgcatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattgtctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagataaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779273_C_P-A Feature FT:CDS KF779273_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4237). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779274_C_P-A Feature FT:CDS KF779274_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4259). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779275_C_P-A Feature FT:CDS KF779275_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4283). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779276_C_P-A Feature FT:CDS KF779276_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4314). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattagacaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779277_C_P-A Feature FT:CDS KF779277_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4322). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779279_C_P-A Feature FT:CDS KF779279_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4359). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779280_C_P-A Feature FT:CDS KF779280_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4364). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcttcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaataattggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779281_C_P-A Feature FT:CDS KF779281_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4390). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcttcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaaaagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779282_C_P-A Feature FT:CDS KF779282_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4392). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcagacaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779283_C_P-A Feature FT:CDS KF779283_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JFA4394). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtcacctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcgggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779284_C_P-A Feature FT:CDS KF779284_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0574). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagtctcccatatcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779286_C_P-A Feature FT:CDS KF779286_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0606). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779287_C_P-A Feature FT:CDS KF779287_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0613). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgctgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779290_C_P-A Feature FT:CDS KF779290_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0756). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779291_C_P-A Feature FT:CDS KF779291_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0765). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779293_C_P-A Feature FT:CDS KF779293_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0787). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcggctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779294_C_P-A Feature FT:CDS KF779294_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0796). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcggctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779295_C_P-A Feature FT:CDS KF779295_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0854). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tctagggatctagtagtcaattatgttaatactaacatgggtttaaagttcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779297_C_P-A Feature FT:CDS KF779297_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0874). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctctatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779298_C_P-A Feature FT:CDS KF779298_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0908). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagttcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcggctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779299_C_P-A Feature FT:CDS KF779299_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT0943). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779304_C_P-A Feature FT:CDS KF779304_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1039). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779305_C_P-A Feature FT:CDS KF779305_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1043). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779306_C_P-A Feature FT:CDS KF779306_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1093). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779307_C_P-A Feature FT:CDS KF779307_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1227). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779308_C_P-A Feature FT:CDS KF779308_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1293). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779309_C_P-A Feature FT:CDS KF779309_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MLT1294). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779310_C_P-A Feature FT:CDS KF779310_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3845). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779311_C_P-A Feature FT:CDS KF779311_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3863). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779312_C_P-A Feature FT:CDS KF779312_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3907). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779313_C_P-A Feature FT:CDS KF779313_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3958). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtaag
>gnl|hbvcds|KF779314_C_P-A Feature FT:CDS KF779314_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF3985). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779315_C_P-A Feature FT:CDS KF779315_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4204). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779316_C_P-A Feature FT:CDS KF779316_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4247). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779317_C_P-A Feature FT:CDS KF779317_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4308). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779319_C_P-A Feature FT:CDS KF779319_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4323). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779320_C_P-A Feature FT:CDS KF779320_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4350). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctttgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779321_C_P-A Feature FT:CDS KF779321_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4362). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaaaatcaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccggcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779322_C_P-A Feature FT:CDS KF779322_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4406). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctgggtggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779323_C_P-A Feature FT:CDS KF779323_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4414). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779324_C_P-A Feature FT:CDS KF779324_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4416). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779325_C_P-A Feature FT:CDS KF779325_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4422). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgttcttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779326_C_P-A Feature FT:CDS KF779326_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4424). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779328_C_P-A Feature FT:CDS KF779328_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4532). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779329_C_P-A Feature FT:CDS KF779329_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4540). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcccagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779330_C_P-A Feature FT:CDS KF779330_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4541). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779331_C_P-A Feature FT:CDS KF779331_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4543). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779332_C_P-A Feature FT:CDS KF779332_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4549). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgggatctactagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctgggtggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagattaggcaactattgtggtttcacatttcttg
ccttacttttggaagagagactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779333_C_P-A Feature FT:CDS KF779333_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4661). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
cacccaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779334_C_P-A Feature FT:CDS KF779334_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4673). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagctccctatcgccgagtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779335_C_P-A Feature FT:CDS KF779335_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4687). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779336_C_P-A Feature FT:CDS KF779336_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4730). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcmagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779337_C_P-A Feature FT:CDS KF779337_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4733). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779338_C_P-A Feature FT:CDS KF779338_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4756). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779339_C_P-A Feature FT:CDS KF779339_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4804). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779342_C_P-A Feature FT:CDS KF779342_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4865). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggattgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779344_C_P-A Feature FT:CDS KF779344_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4928). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779345_C_P-A Feature FT:CDS KF779345_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4936). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779346_C_P-A Feature FT:CDS KF779346_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4938). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779347_C_P-A Feature FT:CDS KF779347_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4950). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctatatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779348_C_P-A Feature FT:CDS KF779348_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4951). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779349_C_P-A Feature FT:CDS KF779349_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF4999). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779350_C_P-A Feature FT:CDS KF779350_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5005). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779351_C_P-A Feature FT:CDS KF779351_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5017). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggacgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779352_C_P-A Feature FT:CDS KF779352_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5034). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779354_C_P-A Feature FT:CDS KF779354_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5084). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779355_C_P-A Feature FT:CDS KF779355_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5121). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779356_C_P-A Feature FT:CDS KF779356_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5185). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779358_C_P-A Feature FT:CDS KF779358_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5263). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779359_C_P-A Feature FT:CDS KF779359_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5268). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggttccatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779360_C_P-A Feature FT:CDS KF779360_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5279). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgctcctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779361_C_P-A Feature FT:CDS KF779361_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5291). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttcgaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactatcgcggttccatatatcttg
ccttactttcggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779362_C_P-A Feature FT:CDS KF779362_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5296). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779363_C_P-A Feature FT:CDS KF779363_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5350). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779364_C_P-A Feature FT:CDS KF779364_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5374). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779365_C_P-A Feature FT:CDS KF779365_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5380). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatcttctagacaccgcctcagctctgtatcgagaagctttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggatgatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779366_C_P-A Feature FT:CDS KF779366_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5383). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779367_C_P-A Feature FT:CDS KF779367_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5403). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779368_C_P-A Feature FT:CDS KF779368_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5421). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779369_C_P-A Feature FT:CDS KF779369_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5521). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779370_C_P-A Feature FT:CDS KF779370_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5594). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcccccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779371_C_P-A Feature FT:CDS KF779371_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5608). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgcggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactccaccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779372_C_P-A Feature FT:CDS KF779372_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5654). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactccgccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779373_C_P-A Feature FT:CDS KF779373_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5680). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779374_C_P-A Feature FT:CDS KF779374_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5743). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779375_C_P-A Feature FT:CDS KF779375_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PNF5760). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tcaagggatctagtagtcaattatgttaatactaacatgggtttaaaaattaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779378_C_P-A Feature FT:CDS KF779378_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PRC6064). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779379_C_P-A Feature FT:CDS KF779379_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PRC6136). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctcttttggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779381_C_P-A Feature FT:CDS KF779381_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PRC6268). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggtaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779383_C_P-A Feature FT:CDS KF779383_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PRC6296). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779384_C_P-A Feature FT:CDS KF779384_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SFN0061). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
cagagatctcctagatacagcctcagctctataccgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcttaaagatcaggcaattattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779385_C_P-A Feature FT:CDS KF779385_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SFN0098). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagacaccgcctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatttagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttactttcggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF779386_C_P-A Feature FT:CDS KF779386_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate SFN0138). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgt
ccgagatctcctagacaccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatachg
cactcaggcaagccattctctgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttg
ccttacttttggaagagagactgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798265_C_P-A Feature FT:CDS KF798265_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-07). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagacacagcctcagctctatttcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattactgtggtttcatatttcttg
ccttacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaattgctgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798266_C_P-A Feature FT:CDS KF798266_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-08). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcttcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatctagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
cattacttttggaagagaaactgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttag
>gnl|hbvcds|KF798267_C_P-A Feature FT:CDS KF798267_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-09). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcatcatacag
cactcaggcaagccattctctgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagca
tccagggatcaagtagtcaattatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttg
ccttacttttggaagagaaactgttcttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagac
caccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaaga
agaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttag
>gnl|hbvcds|KF798271_C_P-A Feature FT:CDS KF798271_C_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EICIB-13). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=558 residues).
atggacattgacccttataaagaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgt
ccgggatctactagatacagcctcagctctatatcgggaagccttagagtctcctgagcattgcacaccgcaccatacag
cactcaggcaagccattctctgctgggg