HBVdb

Dataset for nucleotide sequence PreS1 of genotype all

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
atggg---a-------ggttggtcttccaaacctcga------aaaggcATGGG---Ga---------------------
-----   -       ---------------------      c-----        actttcttggacggtccctctcg
                 cacctctac a cga aa c      -gg                                  
                      a c           g                                           
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                   *                                            
------------cgA---ATCTTTCtgtcccCAAtCCtCTGGGATTCTTtCCCGAtCAcCAGTTGGAcCCtGCaTTCagA
aatg   ggggaaa     c ac  cactaga  c  c        tc c  a gc  t   c    t  actg   gag
                      g  g  g        a                                g  c      
                            a                                            t      
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
GCcAActCaaacAATCCAGATTGGGACtTCAAcCCcaaCAAGGAccacTGGCCaG-acGCcAAcaAGGTaGGA---GtgG
  a  ta cgca g   c  c     tca   taagcta  a  tact   a gc cgt ac tc    g       ct 
          g                        a          ga      a ta                    a 
                                                         t                      
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
GAGCATTCGGGCcaGGgTTCACcCCaCCaCAcGGcGG------------tcTtTTGGGGTGGAGCCCTCAGGCTCAGGGC
  tgc at  t tg  ac  gtt  t  c  t  aaa            ca gc    a     t  g  at a  a  t
    t     a  t  t     a  c  g     g              ag                a            
          c  c           g  t     t               t                             
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
aTatTgacaACagTGcCAgcAgctCCtCCTCCTGCCTCcACCAATCGgCAGTCAGGAA---GgCAG--CCTACtCCcaTc
ccgc acactatt at  at aaa  g        t  t        c g atc  gc    aa a    a  c  gt a
g ta cg t  c          tg  a        a           t   g                  c     ac g
     t     g                                                                tg t
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TCTCCACCTcTaAG------agACAcTCATCCT------CAGGCCATG---CAGTGGAAcTCCACaaCaTTCCACCAAgC
a       at g        ga   ga     a        a  agca   a a     t  a gcgac  t  t  ga 
                          g                                   t  tc t           
                          c                                         g           
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
TCTgCaa---GAtCCCAGAGTgAGgGgcCTgTAttTtCCTGCTGGTGGCTCCAGTTCaGGAACAGTaAaCCCTGtTCcGA
c  tttg   a c  g ag  c aa ct  a  cc c              a     c aggt cag g     c  aa 
   a           a     a        t                                  cc             
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
cTAcTGcCTCtccCATaTCGTCAATCTtctCGAgGAcTGGGGACCCTGcaccGAACATGGAGAaCAtcaCATCAGGAtTC
ac t  t   aga tcc ta    c  cagt  a  t     g  t  tgat  ct     a g  cag        c  
          gtt                    c               tt          c      t           
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAgAATCCTCACAATACCaCAGAGTCTAGACTCGTG
  c        t    c           t  g  c  c        a               ga                
                                                                                
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
GTGGACTTCTCTCAATTTTCTAGGGGGAaCacCCgtGTGTCtTGGCCAAAATTCGCAGTCCCcAAcCTCCAaTCACTCAC
              g           aggtta  ac     c           t        a  t     g     t  
                           ct c    g     g                                      
                            c g    a                                            
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                 *    *         
CAACCTctTGTCCTCCAAtTTGTCCTGGtTATCGCTGGATGTGTCTGCGGCGTTTTATCATcTTCCTCTtCATCCTGC--
t  tt gc        g cc        c     t       a                  a     t g          
                            a                                                   
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
-TGCTATGCCTCATCTTCTTgTTGGTTCTTCTGGAcTAtCAAGGTATGTTGCCCGTTTGTCCTCTAaTTCCA------G-
                    a         g    t gc  g              c        gc             
                                                        g        c              
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
-----GAt---Ca------t------------CAACa---------ACCAGcACgGGACCaTGCAaaACCTGCACgAcTC
       a    t      a          ca g  c           a  tgtc  ga c   cgg       tagtaa
            c      -                t                                        g  
            -                       g                                           
            g                                                                   

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CTGCTCAAGGaAcCTCTATGTtTCCCTCaTGTTGCTGTACaAAACCTtCGGAcGGAAAcTGCACcTGTATTCCCATCCCA
t  t      c a     c  a      t  c  t   ttc     ca    ta    t     t               
                            c                                                   
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                            **                                                  
TCaTCcTGGGCTTTCGcAAaATtCCTATGGGAGTGGGCCTCAGtCCGTTTCTCcTGGCTCAGTTTACTAGTGCCATTTGT
  g  t        a g  g  a                    c         t                c  a      
     a          t                                    a                          
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *                                                                              
TCAGTGGTTCGTAGGGCTTTCCCCCACTGTtTGGCTTTCAGtTATATGGATGATGTGGTaTTGGGGGCCAAGTCTGTACA
        g  cc             t   c       t  c   g t      c    tc       g  aa    g c
                                                      a                         
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340  
....:....|....:....|....:....|....:....|....:....|....:....|..
                                                              
aCATCtTGAGTCCCTTTaTaCCgCTgTTACCAATTTTCTTTTGTCTtTGGGTATACATTTaA
g  c g   ag      t g  t  a     c       gc a   c    c  c   c g 
                                        g     g               
                                                              
                                                              
© 1998-2020Legal notice