HBVdb

Dataset for nucleotide sequence PreS1 of genotype all

[Download (right click)] [Alignment] [Repertoires]

10155 sequence(s)

>gnl|hbvcds|AB014370_PreS1_P-A Feature FT:CDS AB014370_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 11D11HCC). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaaactctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB064314_PreS1_P-A Feature FT:CDS AB064314_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgggtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB076678_PreS1_P-A Feature FT:CDS AB076678_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala14). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctcgcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB076679_PreS1_P-A Feature FT:CDS AB076679_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-Mala35). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagactgggacttcaaccccatcaaggaccgctggccac
aagccaaccaggtaggagtgggagcgttcggcccagggttcactcccccacacggaggtgttttggggtggaaccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaatttcacagctttccaacaagccctacaagatc
ccagagtcaggggcatatatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggttccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgcttgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116076_PreS1_P-A Feature FT:CDS AB116076_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA1911). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacaaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgcttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcttgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB116077_PreS1_P-A Feature FT:CDS AB116077_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA2126). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcatgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtgtttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB116078_PreS1_P-A Feature FT:CDS AB116078_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-USA712). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB116079_PreS1_P-A Feature FT:CDS AB116079_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR1). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB116080_PreS1_P-A Feature FT:CDS AB116080_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR2). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcggaccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB116081_PreS1_P-A Feature FT:CDS AB116081_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TR3). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB116082_PreS1_P-A Feature FT:CDS AB116082_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN1). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccagcagtacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaaactctgcaagata
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccgactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggactcctaagacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggcgaagtctgtacagcatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116083_PreS1_P-A Feature FT:CDS AB116083_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN36). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttgaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccaggactcactcccccacacggaggtgtcttggggtggagccctcag
gctcagggcatattgaccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagccctgcaagatc
ccagagtcaggggcctgtatattcctgctggtggctccagttcaggaactctcaaccctgttcccaatattgcctctcac
atatcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgagtcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116084_PreS1_P-A Feature FT:CDS AB116084_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN81). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaagaccactggccac
aagccaaccaggtaggagtgggagctttcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagccctgcaagatc
ccagagtcaggggcctgtatattcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116085_PreS1_P-A Feature FT:CDS AB116085_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-BAN83). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgnccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctgtccaccaagctctgcaagatc
ccagagtcaggggcctgtatattcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggntcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaaccttctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cttgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagttattcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116086_PreS1_P-A Feature FT:CDS AB116086_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND18). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcaattggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgaagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggagcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggcgaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116087_PreS1_P-A Feature FT:CDS AB116087_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-IND8). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggatttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcatacgggccagggttcactcccccacacggaggtgtcttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcaatggaattccacagctttccaccaaactctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116088_PreS1_P-A Feature FT:CDS AB116088_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP30). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggatcctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtgggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggatcacccgggtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaayttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccctttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
tctgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttatgtctttgggtatacatt
taa
>gnl|hbvcds|AB116089_PreS1_P-A Feature FT:CDS AB116089_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-NEP39). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtcttttggggtggagccctcag
gctcagggcatattgaccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcgaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccacgtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116091_PreS1_P-A Feature FT:CDS AB116091_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH1). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggatcactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatacagtggaattccacagcttttcgccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcntggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaa
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116092_PreS1_P-A Feature FT:CDS AB116092_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH20). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaacccgctgggattctttcccga
tcatcagttggaccctgcattcggagccaatgcaaacaatccagattgggacctcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcatttggaccagggctcactcccccacacggaggtgttttggggtggagccctcag
gctcaaggcatattggccaccgtgccaacagtgcctcctcctgcctccaccaatcggcagtcgggaaggcagcctactcc
catttctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaagggaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttggggtttcgcaaaattcctatgggagtgggcctcagtccgtttctcttgtct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttacaccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116093_PreS1_P-A Feature FT:CDS AB116093_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH25). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggatcactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccagcaggtcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttcccaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgtgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggccacccgtgtgtcntggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB116094_PreS1_P-A Feature FT:CDS AB116094_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-PH4). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggacatcaacacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttgggggggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcgccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaa
cctgcagaacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaacctacgggtggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgcttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttatacctctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB126580_PreS1_P-A Feature FT:CDS AB126580_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-RU204). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggagggtggtcatcaaaacctcgcaaaggcatggggacgaatctttctggttccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacaggcatcctcaggccaagcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaatccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB194950_PreS1_P-A Feature FT:CDS AB194950_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR983). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctgtctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatcccgattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcaaggcacattgactacagtgccagcagtacctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccataaagtggaattccccagctttccaccaagctctgcaagatc
ccagagtcaagggcctgtattttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagactgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB194951_PreS1_P-A Feature FT:CDS AB194951_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR82). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaacccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacatggaggcgttctggggtggagccctcag
gctcagggcacattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaagaagacagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaaatttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtcaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttctcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttggctttgggcatacatt
taa
>gnl|hbvcds|AB194952_PreS1_P-A Feature FT:CDS AB194952_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CMR711). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggtcggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaacccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggagttctggggtggagccctcag
gctcagggcacattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaaagttccaccaaactctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtcaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB205118_PreS1_P-A Feature FT:CDS AB205118_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-TJ1-1-2). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattctggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccctccaccaagctctgcaggaac
ccagagtcaggggtccgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
gtctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggaccaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB222707_PreS1_P-A Feature FT:CDS AB222707_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate UZTBV102). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttccgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaacaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaataattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttctcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggcatacatt
taa
>gnl|hbvcds|AB241114_PreS1_P-A Feature FT:CDS AB241114_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhHCC01). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggatcactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactccccctcacggaggtgttttggggtggagccctcag
gctcagggcatattggcaacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagaatcaggggcctgtattttcctgctggtggctccacttcaggaacagtcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB241115_PreS1_P-A Feature FT:CDS AB241115_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate PhCH09). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaaccttgctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcagagccaattcaaacaatccagattgggacctcaaccccgtcaaggacccctggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtcttttggggtggagccctcag
gctcagggcatattgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB246335_PreS1_P-A Feature FT:CDS AB246335_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggatcactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactccccctcacggaggtgttttggggtggagccctcag
gctcagggcatattggcaacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagaatcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggakcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB246336_PreS1_P-A Feature FT:CDS AB246336_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcacaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttctggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcggtggaattccacaactttccaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgcgttacaggcggggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgtctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttatgtctttgggtatacatt
taa
>gnl|hbvcds|AB246337_PreS1_P-A Feature FT:CDS AB246337_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB246338_PreS1_P-A Feature FT:CDS AB246338_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB263406_PreS1_P-A Feature FT:CDS AB263406_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MonB04-023E). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatcccgattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaactacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB300366_PreS1_P-A Feature FT:CDS AB300366_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient8). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggactccaaccccatcaaggaccactggccag
tagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB300367_PreS1_P-A Feature FT:CDS AB300367_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient9). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB362931_PreS1_P-A Feature FT:CDS AB362931_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccgctggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcaaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaa
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB453979_PreS1_P-A Feature FT:CDS AB453979_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH1). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB453980_PreS1_P-A Feature FT:CDS AB453980_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH2). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB453981_PreS1_P-A Feature FT:CDS AB453981_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH3). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB453982_PreS1_P-A Feature FT:CDS AB453982_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH4). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggactccaaccccatcaaggaccactggccag
aggccaatcaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB453983_PreS1_P-A Feature FT:CDS AB453983_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH5). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtcttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcaaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggt
attgggggcgaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB453984_PreS1_P-A Feature FT:CDS AB453984_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH6). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB453986_PreS1_P-A Feature FT:CDS AB453986_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH8). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggatttcaatcccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttccggaacactcaaccctgttccaactattgcctctcac
atatcgtcaacctcctcgaggattggggaccctgcggcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggaccacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB453987_PreS1_P-A Feature FT:CDS AB453987_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH9). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctgtctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatacagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB453988_PreS1_P-A Feature FT:CDS AB453988_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH10). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgtgttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtttggctttcagctatatggatgatgtggt
actgggggcaaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttatctttgggtatacatt
taa
>gnl|hbvcds|AB453989_PreS1_P-A Feature FT:CDS AB453989_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate JPN_CH11). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaacccgctgggattcttccccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccctgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaaactctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagagggggccaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtgctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB480036_PreS1_P-A Feature FT:CDS AB480036_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgcctttcaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB480038_PreS1_P-A Feature FT:CDS AB480038_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB480039_PreS1_P-A Feature FT:CDS AB480039_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggactccaaccccatcaaggaccactggccag
tagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB480040_PreS1_P-A Feature FT:CDS AB480040_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatyttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcktggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB480041_PreS1_P-A Feature FT:CDS AB480041_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
catgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB549213_PreS1_P-A Feature FT:CDS AB549213_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcatttgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggcatacatt
taa
>gnl|hbvcds|AB697487_PreS1_P-A Feature FT:CDS AB697487_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No1). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatttcaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697488_PreS1_P-A Feature FT:CDS AB697488_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No2). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgnctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697489_PreS1_P-A Feature FT:CDS AB697489_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No3). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697491_PreS1_P-A Feature FT:CDS AB697491_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No6). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697492_PreS1_P-A Feature FT:CDS AB697492_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No7). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcgccagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697493_PreS1_P-A Feature FT:CDS AB697493_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No8). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697495_PreS1_P-A Feature FT:CDS AB697495_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No10). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697496_PreS1_P-A Feature FT:CDS AB697496_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No11). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697497_PreS1_P-A Feature FT:CDS AB697497_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No14). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697498_PreS1_P-A Feature FT:CDS AB697498_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No15). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697499_PreS1_P-A Feature FT:CDS AB697499_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No16). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697501_PreS1_P-A Feature FT:CDS AB697501_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No19). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697503_PreS1_P-A Feature FT:CDS AB697503_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No22). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697504_PreS1_P-A Feature FT:CDS AB697504_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No23). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697505_PreS1_P-A Feature FT:CDS AB697505_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No25). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697506_PreS1_P-A Feature FT:CDS AB697506_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No28). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697507_PreS1_P-A Feature FT:CDS AB697507_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No29). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697508_PreS1_P-A Feature FT:CDS AB697508_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No31). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697509_PreS1_P-A Feature FT:CDS AB697509_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No32). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaacccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697511_PreS1_P-A Feature FT:CDS AB697511_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No36). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcaaggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaatagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttrtcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgttaccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB697512_PreS1_P-A Feature FT:CDS AB697512_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate No37). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgtctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB775198_PreS1_P-A Feature FT:CDS AB775198_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0707). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB775199_PreS1_P-A Feature FT:CDS AB775199_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB10-0708). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaarctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB775200_PreS1_P-A Feature FT:CDS AB775200_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0925). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB775201_PreS1_P-A Feature FT:CDS AB775201_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB12-0929). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB937791_PreS1_P-A Feature FT:CDS AB937791_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB05-0890). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggcaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB937792_PreS1_P-A Feature FT:CDS AB937792_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1205). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB937793_PreS1_P-A Feature FT:CDS AB937793_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0302). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB937794_PreS1_P-A Feature FT:CDS AB937794_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-0666). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB937795_PreS1_P-A Feature FT:CDS AB937795_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1191). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttccgttcccaaccctctgggattctttcccgr
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagccttcgggccagggttcactcccccacacggcggtgttctggggtggagcccgcag
gctcagggcatattggccacagtgccaacagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccaccgctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcagggacactcaaccctgttccaaatattgcctctcac
atctcatcaatctccttgaagactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctamttccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatrtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB937796_PreS1_P-A Feature FT:CDS AB937796_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1196). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggcaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AB937797_PreS1_P-A Feature FT:CDS AB937797_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB13-1204). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcmaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccytcag
gctcaggrcatawcgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagccyactcc
catctctccacctmtaagagamagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtatcttcctgctggtggctccagttcagamacagtaaaccctgctccgaatattgcctctcac
atctcgtcamtctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcagggttcctaggaccccggct
cgtgttacaggcggggttttycttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
cyaatttgtcytggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgccgctatgcctcatctt
cttattggttcttctggattatcaaggtatattgcccgtttgtcctctaattccaggatcaacakcaaacartacgggas
grtgcaaaayctgcacgaytcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatattgt
attgggggccaaatctgtacagcatcgtgagtccctttatactgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AB937798_PreS1_P-A Feature FT:CDS AB937798_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HB14-0383). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcgaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AF043560_PreS1_P-A Feature FT:CDS AF043560_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA2). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AF043580_PreS1_P-A Feature FT:CDS AF043580_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA3). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AF090838_PreS1_P-A Feature FT:CDS AF090838_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggcgatgcagtggaattccactgccttccaccaagctctgcaagacc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcagaaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AF090839_PreS1_P-A Feature FT:CDS AF090839_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggcccg
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagccctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AF090840_PreS1_P-A Feature FT:CDS AF090840_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctttccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AF090841_PreS1_P-A Feature FT:CDS AF090841_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccggggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaagccatgcagtggaattccactgccttccaccaagttctgcaagacc
ccagagtcaggggtctgtattttcctgctggtggcttcagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AF090842_PreS1_P-A Feature FT:CDS AF090842_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgtgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacagcatcttgagtccctttataccggtgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AF143298_PreS1_P-A Feature FT:CDS AF143298_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtgaagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgactattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgggttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgttgccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AF143302_PreS1_P-A Feature FT:CDS AF143302_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=1197 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttctcaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaatcaggtaggagtgggagcattcgggccagggctcacccctccacatggcggtattttggggtgaagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgcccgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcg
tcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgtt
acaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttc
taggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatt
tgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttatt
ggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccgtgca
aaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacc
tgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagttt
actagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattggg
ggccaagtctgtacagcatcgtgaggccctttataccgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF536524_PreS1_P-A Feature FT:CDS AF536524_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccctccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgggttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtattcatt
taa
>gnl|hbvcds|AF537371_PreS1_P-A Feature FT:CDS AF537371_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatacagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacggaac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcaccgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AF537372_PreS1_P-A Feature FT:CDS AF537372_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaacccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaaatcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagggacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgagaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatgccaggatcaacgacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctacgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcttgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AJ012207_PreS1_P-A Feature FT:CDS AJ012207_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctacaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AJ309369_PreS1_P-A Feature FT:CDS AJ309369_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtgggagtgggggcattcgggccagggctcacccctccacacggcggtatcttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctccgagacagtcatcctcaggccacgcagtggaattccactgccttccaccaagcactgcaggatc
ccagagtcaggggtccgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctaggctcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccggtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AJ309370_PreS1_P-A Feature FT:CDS AJ309370_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtgggagtgggagcattcgggccagggctcacccctccacacggcggtattttgggttggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctacgaaacagtcatcctcaggccatgcagtggaattccactgccttccaccaagcactgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgttggatgtgtctgcggcgttttaccatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AJ309371_PreS1_P-A Feature FT:CDS AJ309371_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient X104). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcgaagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtgggagcgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctacgagacagtcatcctcaggccacgcagtggaattccactgccttccaccaagcactgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AJ344115_PreS1_P-A Feature FT:CDS AJ344115_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBsAg negative patient X27). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccaacaattcctcctcctgcatccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctcagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaagacccctgct
cgggttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctcaaactacaagatcaacaacaaccagtacgggat
catgcaaaacctgcacgattcctgctcgcggcaaatctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaagctacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccctttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AJ627226_PreS1_P-A Feature FT:CDS AJ627226_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 20952). Non-functional genomic sequence. [Hepadnaviridae] (length=1194 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcagggatcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtca
atctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttaca
ggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctag
gggggccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgt
cctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggt
tcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaa
cctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgt
attcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcaatttact
agtgccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggtattgggggc
caagtctgtacagcatcgtgagtccctttataccgctgtaaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AJ627227_PreS1_P-A Feature FT:CDS AJ627227_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 21077). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtckgtycccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaacccagattgggacttcaatcccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggcattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccaaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcataataccgcagagtctagactcgtggtggacttctctca
gttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaycaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggwc
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagytatatggatgatgtggt
mttggggaccagatctgtacagcatcgtgaggccctttwtaccgctgttaccaattttcttttgtctctgggtatacata
taa
>gnl|hbvcds|AJ627228_PreS1_P-A Feature FT:CDS AJ627228_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 34408). Non-functional genomic sequence. [Hepadnaviridae] (length=1191 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatcccgattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccactgccrcccaccaagctctgcaggatc
ccaaagtcgatcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatc
tccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
ggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggg
gatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcct
ggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggttct
tctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgcaaaacct
gcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtatt
cccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagt
gccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattgggggccaa
gtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AM180624_PreS1_P-A Feature FT:CDS AM180624_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAE168). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaycctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttggaccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcacattgactatggtgccagcggttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaaaacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcarggtatgttgcycgtttgtcctctaattccaggatccamaaccaccagtacgggac
cctgcagaacctgcacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|AM184125_PreS1_P-A Feature FT:CDS AM184125_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate O64). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactaccttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaagaacagtaagccctgttcagaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AM184126_PreS1_P-A Feature FT:CDS AM184126_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate N35). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactaccgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatccgcaggccatgcagtggaattccacagctttccaccaagctctacaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctatacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
tga
>gnl|hbvcds|AM282986_PreS1_P-A Feature FT:CDS AM282986_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaatatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggaacaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccttcggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AM295795_PreS1_P-A Feature FT:CDS AM295795_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AM295797_PreS1_P-A Feature FT:CDS AM295797_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AM295798_PreS1_P-A Feature FT:CDS AM295798_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AM295799_PreS1_P-A Feature FT:CDS AM295799_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AM410963_PreS1_P-A Feature FT:CDS AM410963_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AM494718_PreS1_P-A Feature FT:CDS AM494718_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate CAR204). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggrgtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY034878_PreS1_P-A Feature FT:CDS AY034878_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBVKL). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
caaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatattgatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY128092_PreS1_P-A Feature FT:CDS AY128092_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY152726_PreS1_P-A Feature FT:CDS AY152726_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8.22). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcaattggaccctgcattcggagccaactcgaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccggggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctcagaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctagaacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatgccaggatcaacaacaacaagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctacgttgccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgaggccctttataccgctgttactaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY161138_PreS1_P-A Feature FT:CDS AY161138_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1206 residues).
atgggaggttggacatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctccttctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctggtgctatgcctcat
cttcttattggttcttctggattatcaaggtatgttgctcgtttgtcctctaattccaggatccacaacaaccagcacgg
gaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatgga
aattgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttg
gctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatct
ggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatac
atttaa
>gnl|hbvcds|AY161139_PreS1_P-A Feature FT:CDS AY161139_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggacatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctccttctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatctggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233274_PreS1_P-A Feature FT:CDS AY233274_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 0962). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccaacagtacctcccactgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatactgcctctcac
atctcgccaatctcctcgaggactggggaccctgcgtggaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
atttcctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233275_PreS1_P-A Feature FT:CDS AY233275_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 163). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcctcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactggaacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcttacggcccagggctcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgactacagcgccagtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacacacaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaagactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatctacaacaacgagtacgggac
cttgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccctttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233276_PreS1_P-A Feature FT:CDS AY233276_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1839). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccccctgggattctttcccga
tcatcagttggaccctgcattcagagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccaccagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcatctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccagggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233278_PreS1_P-A Feature FT:CDS AY233278_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttcaaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233279_PreS1_P-A Feature FT:CDS AY233279_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 28). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggccagcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcgtattggctacagtgccaccagttcttcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcatctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctagggcccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233280_PreS1_P-A Feature FT:CDS AY233280_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 2). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccaccgtgccagcgatgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgcgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY233281_PreS1_P-A Feature FT:CDS AY233281_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 303). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcctcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagaccgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcttacggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgactacagcgccagtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacacacaaccctgttccaaatattgcctctcac
atctcgccaatctcctcgaagactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatctacaacaacgagtacgggac
cttgcaagacctgcacgactcctgctcaaaacaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccctttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233282_PreS1_P-A Feature FT:CDS AY233282_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 306). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttaaaccccatcaaggaccactggccag
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcag
gctcagggcatattggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttgtcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatattgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233283_PreS1_P-A Feature FT:CDS AY233283_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 4038). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatactgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233284_PreS1_P-A Feature FT:CDS AY233284_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5283). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggcctc
aagccaaccaggtaggagtgggagctttcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagcgccagtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacacacaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaagactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggcacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatctacaacaacgagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233285_PreS1_P-A Feature FT:CDS AY233285_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 795). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcag
gctcagggcatattggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaatcccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaccactcaaccctgttccaaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cccgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233286_PreS1_P-A Feature FT:CDS AY233286_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 818). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgttaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaagacccctgct
cgggttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacggggc
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaacacctacggatggaaat
tgcacctgtattcccatcccatcgtcctggactttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccgctgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY233287_PreS1_P-A Feature FT:CDS AY233287_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 8225). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcaacaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcatctcac
atctcgtcaatctcctcgaggattggggaccctgcgctgaacatggagaacattacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcccgtcct
ccaatttgtcctggttatcgcgggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggtctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgcttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233288_PreS1_P-A Feature FT:CDS AY233288_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 823). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctttcac
atctcgtcaatctcctcgaggattggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggaccccttct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233289_PreS1_P-A Feature FT:CDS AY233289_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 833). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagtcctcag
gctcagggcatattggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctactgctatgcctcatctt
cttattggttcttctggattaccagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY233290_PreS1_P-A Feature FT:CDS AY233290_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 85). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttccaaaccctctgggattccttcccga
tcatcaactggaccctgcattcggagccaattcaaacaatcccgattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacattgccaacagttcctcctcctgcctcgaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggctatgcagtggaattccaccgctttccaccaagctctgcaagatc
ccagagtcaggggcctgtatttccctgctggtggctccagttcaggaatactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgacgactggggaccctgtgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagacttgtggtggacttctctca
attttccagggggcccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggtacttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccaccatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaaatctgtacaacaccttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY373428_PreS1_P-A Feature FT:CDS AY373428_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggacatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtagaaatgggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcaa
gctcagggcatattggccacagtgccaagagtgcctcattgtgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggttttacttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY373429_PreS1_P-A Feature FT:CDS AY373429_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccaatggccac
aagccaaccaggtaggagtgggagcatttgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccaccgctaagaaacagtcatcctcaggccatacagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactactgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaacatggacaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcaggtatatggatgatgtggt
attgggggccaagtctgtacaacaccttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|AY373432_PreS1_P-A Feature FT:CDS AY373432_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattctggccagggctcactcccccacacggaggtgttttggggtggagccctcac
gctcagggcatattggccacagcgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catatctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcagaatc
ccaaagacaggggtctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atatcgtcaatctcctcgaggattggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|AY707087_PreS1_P-A Feature FT:CDS AY707087_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HBV-N10). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaatatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggaacaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaaccttcggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY738139_PreS1_P-A Feature FT:CDS AY738139_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacattaggattcctaggacccctgct
cgtgttacaggcggtgtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttggccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY738140_PreS1_P-A Feature FT:CDS AY738140_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccaccgctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtcttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacattacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggaacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattctcaaagtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY738141_PreS1_P-A Feature FT:CDS AY738141_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccaccgctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtcttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacattacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggaacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattctcaaaatatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY738142_PreS1_P-A Feature FT:CDS AY738142_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccaccgctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtcttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacattacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggaacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattctcaaagtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggccttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY738143_PreS1_P-A Feature FT:CDS AY738143_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient A, 10/97). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctctggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacattaggattcctaggacccctgct
cgtgttacaggcggtgtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttggccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagttggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttactaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY862867_PreS1_P-A Feature FT:CDS AY862867_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccaccaaggaccactggccag
cagccaaccaggtaggagtgggagcatttgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggttccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY862868_PreS1_P-A Feature FT:CDS AY862868_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H4-zhus). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcatttgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY902775_PreS1_P-A Feature FT:CDS AY902775_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MTB162). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggaaccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|AY903452_PreS1_P-A Feature FT:CDS AY903452_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaaattgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934763_PreS1_P-A Feature FT:CDS AY934763_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ik3346). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
acatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
aagccaatcaggtaggagtgggagcatttggaccagggttcacccccccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctactgcctccaccaatcggcagtcaggaaggcaacctactcc
catatctccacctctaagagacagtcacccccaggcagtgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaacctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacggggc
cttgcagaagctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcatgggctttcggaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934764_PreS1_P-A Feature FT:CDS AY934764_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9210699). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaacacaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctcctcacggaggtgttctggggtggagccctcag
gctcagggcatatcgactactgtgccagcagttcctcctcctgcctgcaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaatagtaaaccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtatggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|AY934765_PreS1_P-A Feature FT:CDS AY934765_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24306). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaycaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtkcctcctcctgcctccrccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagamagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatattgcctcgcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaagatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934766_PreS1_P-A Feature FT:CDS AY934766_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 24233). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcggcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggctcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934767_PreS1_P-A Feature FT:CDS AY934767_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27178). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaatactcaaccctgttcccaatattgcctcgcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934768_PreS1_P-A Feature FT:CDS AY934768_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 25830). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagaaagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatattgcctcgcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtactggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatggttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934769_PreS1_P-A Feature FT:CDS AY934769_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 23719). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggatttcaaccccatcaaggaccgctggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaaatattgcctcgcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934770_PreS1_P-A Feature FT:CDS AY934770_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 953642). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaatactcaaccctgttccaagtattgcctcgcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934771_PreS1_P-A Feature FT:CDS AY934771_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 27439). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggatcctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctacaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacctcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattrtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934772_PreS1_P-A Feature FT:CDS AY934772_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 1908). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggcccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctgattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
tttgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934773_PreS1_P-A Feature FT:CDS AY934773_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9414346). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggacaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttrtcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaggacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|AY934774_PreS1_P-A Feature FT:CDS AY934774_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 9615549). Complete genome. [Hepadnaviridae] (length=1203 residues).
ataggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|DQ020002_PreS1_P-A Feature FT:CDS DQ020002_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 380). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaacaaggatcactggccac
aagccaaccaggtaggagtgggagccttcggcccagggttcactcctccacacggaggtattttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaggatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|DQ020003_PreS1_P-A Feature FT:CDS DQ020003_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 5780). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|DQ298161_PreS1_P-A Feature FT:CDS DQ298161_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccattgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatccccacaataccgcagagtctagactcgtggtggacttctctca
gttttctaggggaagcacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctgctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccatcatgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|DQ298162_PreS1_P-A Feature FT:CDS DQ298162_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcagggctcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctaggggaagcacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggactatcaaggtatgttgcctgtttgtcctctaattccaggatcaacaactaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccatcatgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggt
attgggggccaaatctgtgcaacatcgtgaggccctttataccgctgttatcaattttctgttgtctctgggtatacatt
taa
>gnl|hbvcds|DQ298163_PreS1_P-A Feature FT:CDS DQ298163_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggatttcaaccccatcaaggacaactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctaggggaagcacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggt
attgggggccaagtctgtacagcatcgtgagtccctttacaccgctgttacaaattttctgttgtctctgggtattcatt
taa
>gnl|hbvcds|DQ298164_PreS1_P-A Feature FT:CDS DQ298164_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaagaaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcaccccaccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgaggaacatggagaacatcacatcaggactcctaggacccctact
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctaggggaagcacccgtgtgtcttggccaaaattcgcagtccccaacctgcaatcactcaccaacctcctgtcct
ccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacgaaacctacggatggaaat
tgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttacaaattttctgttgtctctgggtattcatt
taa
>gnl|hbvcds|DQ298165_PreS1_P-A Feature FT:CDS DQ298165_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LT3.12AM). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttcagttcccaacccgctgggattctttcccga
tcatcagttgggccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcaccccaccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctact
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctaggggaagcacccgtgtgtcttggccaaaattcgcagtccccaacccgcaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggt
attgggggccaagtctgtacagcatcgtgtgtccctttacaccgctgttacaaattttctgttgtctctgggtattcatt
taa
>gnl|hbvcds|DQ315784_PreS1_P-A Feature FT:CDS DQ315784_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI03101). Non-functional genomic sequence. [Hepadnaviridae] (length=1200 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttccaaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcatttgggccagggttcactcccccacacggcggtgtgttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtgttccacagctttccaccaagctctgcaagatgtta
gaaacagggccctgaatcttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcacatc
tcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcca
atttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
attggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtact
gggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315786_PreS1_P-A Feature FT:CDS DQ315786_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate EI057). Non-functional genomic sequence. [Hepadnaviridae] (length=1200 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgtcttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcggaagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtgttccacagctttccaccaagctctgcaagatccca
gagtcaggggcctgtatcttcctgctggtggctccagttcagggactctcaaccctgttcccaatattgcctctcacata
tcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgctcgt
gttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaatt
ttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctcca
atttgtcctggttatcgctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttctt
attggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaccct
gcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgc
acctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcag
tttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtact
gggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ788725_PreS1_P-A Feature FT:CDS DQ788725_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 07/92). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaatcaggtaggagtgggagcattcgggccagggctcacccctccacatggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccacgcagtggaattccactgccgtccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgccccatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|DQ788728_PreS1_P-A Feature FT:CDS DQ788728_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate serum 05/96). Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=1197 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttctcaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaatcaggtaggagtgggagcattcgggccagggctcacccctccacatggcggtattttggggtgaagacctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatatcg
tcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgtt
acaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttc
taggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatt
tgtcctggttatcgctggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatcttcttatt
ggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccgtgca
aaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacc
tgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagttt
actagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattggg
ggccaagtctgtacagcatcgtgaggccctttataccgctgtgaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EF103278_PreS1_P-A Feature FT:CDS EF103278_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate Ran60). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggatactttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgtcttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcgacagtcaggaaggcagcctactcc
catctctccacccctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaaactctgcaagatc
ccagagtcaggggcctgtattctcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctcgcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgcagctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtctctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtcactttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|EF208113_PreS1_P-A Feature FT:CDS EF208113_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate patient B, serum 05/93). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcaccgtgagtccctttatactgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU054331_PreS1_C-A Feature FT:CDS EU054331_PreS1_C-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcaa
gctcagggcatattgactaccgtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctacaagatc
ccagagtcaggggcctgtattttcctgcggggtgctccagttcaggaacagtaagccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgcacaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcggtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|EU086721_PreS1_P-A Feature FT:CDS EU086721_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate HRO/w4601-2002). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU185786_PreS1_P-A Feature FT:CDS EU185786_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU11). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggacccggcattcggagccaactcaaacaatccagattgggacttcaatcccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccrcacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaacaatcgkcagtcaggaaggcagcctactcc
catctctccacctctragagacastcatcctcaggccatgcagtggaattccactgccttcctccaagytctsgaggrtc
cctgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgsctctcac
atctcgtcwatctccgmgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctca
attttctagggggakcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattgggtcctctggattatcaaggtattttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtasaawacctacggatgraart
tgcacctgtaywscsrtcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attskgggccaagtctgtacagcatcgtgagtmcctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU185787_PreS1_P-A Feature FT:CDS EU185787_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU4). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagatkgggacttcaaccccatcaaggtccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccmmagaatctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattgggtcttctggattatcaaggtattttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaart
tgcacctgtaywscsatcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtasagcatcgtgagtmcctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU185788_PreS1_P-A Feature FT:CDS EU185788_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU19). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggtccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagartctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattgggtcttctggattatcaaggtattttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaart
tgcacctgtaywscsatcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtmcstttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU185789_PreS1_P-A Feature FT:CDS EU185789_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate S-IDU8). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggtccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactgkggaccctgtgacgaacatggagaacatyayatcaggactcctaggacccctgct
ygtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattgggtcttctggattatcaaggtattttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaart
tgcacctgtaywscsrtcccatcgtcctgggcttkcgcaaaatacctatgggagtggggctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtmcctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU304331_PreS1_P-A Feature FT:CDS EU304331_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA84). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaacaaaagcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcatgccatacaatggaattccacagttttccaccaagctctgaaagatc
ccagagtcaggggactgtattttcctgctggtggctccagttcagaaacactcaaccctgttccmaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaaatctgtacaacatcttgagtccctttatgcckctgttacnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn
>gnl|hbvcds|EU366129_PreS1_P-A Feature FT:CDS EU366129_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BA92). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggcctc
aagccaatcaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttctggggtggagccctcag
gctcagggcatactgrccacrgygccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagccctgcaagatc
ccagagtaaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctkgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagcgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaaatctgctcaacaccttgaagccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|EU410082_PreS1_P-A Feature FT:CDS EU410082_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ph81). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccattggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catttctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|EU414132_PreS1_P-A Feature FT:CDS EU414132_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaacaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU414133_PreS1_P-A Feature FT:CDS EU414133_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaacaggtrggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594383_PreS1_P-A Feature FT:CDS EU594383_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctacaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttctgtctctgggtatacatt
taa
>gnl|hbvcds|EU594384_PreS1_P-A Feature FT:CDS EU594384_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccatctctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594385_PreS1_P-A Feature FT:CDS EU594385_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccattggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtttggctttcagctatatggatgatatggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594386_PreS1_P-A Feature FT:CDS EU594386_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggtttttctggattatcaaggtatgttgcccgtttgtcctataattccaggatcaacaacaaccagtacgggac
catgcaaaacatgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594387_PreS1_P-A Feature FT:CDS EU594387_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatacagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594388_PreS1_P-A Feature FT:CDS EU594388_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594389_PreS1_P-A Feature FT:CDS EU594389_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccagccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594390_PreS1_P-A Feature FT:CDS EU594390_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594391_PreS1_P-A Feature FT:CDS EU594391_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attctctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594392_PreS1_P-A Feature FT:CDS EU594392_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594393_PreS1_P-A Feature FT:CDS EU594393_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catatctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
caagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594394_PreS1_P-A Feature FT:CDS EU594394_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU594395_PreS1_P-A Feature FT:CDS EU594395_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU747320_PreS1_P-A Feature FT:CDS EU747320_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V51). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctatatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagattctagactcgtggtggaattctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859898_PreS1_P-A Feature FT:CDS EU859898_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P45). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859899_PreS1_P-A Feature FT:CDS EU859899_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P44). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859900_PreS1_P-A Feature FT:CDS EU859900_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P42). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgccaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaaggggatcacccgtgtgtcttgggcaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859901_PreS1_P-A Feature FT:CDS EU859901_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P37). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859902_PreS1_P-A Feature FT:CDS EU859902_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P32). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859903_PreS1_P-A Feature FT:CDS EU859903_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859904_PreS1_P-A Feature FT:CDS EU859904_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P39). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859905_PreS1_P-A Feature FT:CDS EU859905_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P38). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859906_PreS1_P-A Feature FT:CDS EU859906_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859907_PreS1_P-A Feature FT:CDS EU859907_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcagggatctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859908_PreS1_P-A Feature FT:CDS EU859908_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859909_PreS1_P-A Feature FT:CDS EU859909_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859910_PreS1_P-A Feature FT:CDS EU859910_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859911_PreS1_P-A Feature FT:CDS EU859911_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P26). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859912_PreS1_P-A Feature FT:CDS EU859912_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P23). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859913_PreS1_P-A Feature FT:CDS EU859913_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859914_PreS1_P-A Feature FT:CDS EU859914_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859915_PreS1_P-A Feature FT:CDS EU859915_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P07). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859916_PreS1_P-A Feature FT:CDS EU859916_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P03). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859917_PreS1_P-A Feature FT:CDS EU859917_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P13). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859918_PreS1_P-A Feature FT:CDS EU859918_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P17). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859919_PreS1_P-A Feature FT:CDS EU859919_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859920_PreS1_P-A Feature FT:CDS EU859920_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P21). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859921_PreS1_P-A Feature FT:CDS EU859921_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P08). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaaccttcaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859922_PreS1_P-A Feature FT:CDS EU859922_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P09). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859923_PreS1_P-A Feature FT:CDS EU859923_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P15). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgcctttcaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859924_PreS1_P-A Feature FT:CDS EU859924_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catttctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859925_PreS1_P-A Feature FT:CDS EU859925_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P22). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859926_PreS1_P-A Feature FT:CDS EU859926_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P06). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859927_PreS1_P-A Feature FT:CDS EU859927_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P25). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859928_PreS1_P-A Feature FT:CDS EU859928_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P01). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859929_PreS1_P-A Feature FT:CDS EU859929_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P43). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859930_PreS1_P-A Feature FT:CDS EU859930_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C126). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859931_PreS1_P-A Feature FT:CDS EU859931_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C96). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859932_PreS1_P-A Feature FT:CDS EU859932_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C69). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859933_PreS1_P-A Feature FT:CDS EU859933_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C67). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859934_PreS1_P-A Feature FT:CDS EU859934_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C60). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatcccgattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacactcatcctcaggccatacagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatgcaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859935_PreS1_P-A Feature FT:CDS EU859935_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C14). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859936_PreS1_P-A Feature FT:CDS EU859936_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C10). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859937_PreS1_P-A Feature FT:CDS EU859937_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C40). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctcgccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859938_PreS1_P-A Feature FT:CDS EU859938_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C133). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccacgtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859939_PreS1_P-A Feature FT:CDS EU859939_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C130). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaagccatgcagtggaattccactgccttccaccaagctctacaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgggttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccacgtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859940_PreS1_P-A Feature FT:CDS EU859940_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C122). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859941_PreS1_P-A Feature FT:CDS EU859941_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C153). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859942_PreS1_P-A Feature FT:CDS EU859942_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C110). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859943_PreS1_P-A Feature FT:CDS EU859943_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C109). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtcacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859944_PreS1_P-A Feature FT:CDS EU859944_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C105). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctacaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaac
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859945_PreS1_P-A Feature FT:CDS EU859945_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C102). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|EU859946_PreS1_P-A Feature FT:CDS EU859946_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C155). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859947_PreS1_P-A Feature FT:CDS EU859947_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C85). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859948_PreS1_P-A Feature FT:CDS EU859948_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C151). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaatcaggtaggagtgggagcattcgggccagggctcacccctccacacgggggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859949_PreS1_P-A Feature FT:CDS EU859949_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C152). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaatcaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859950_PreS1_P-A Feature FT:CDS EU859950_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C64). Non-functional genomic sequence. [Hepadnaviridae] (length=1197 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcg
tcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgctcgtgtt
acaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctaaactcgtggtggacttctctcaattttc
tagggggatcacccgtgtgtcttggccaagattcgcagtccccaacctccaatcactcaccaacctcctgtcctcgaatt
tgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttatt
ggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggaccatgca
aaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacc
tgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagttt
actagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggtattggg
ggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU859951_PreS1_P-A Feature FT:CDS EU859951_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C62). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccaa
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859952_PreS1_P-A Feature FT:CDS EU859952_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C56). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaacacctcgcataggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccaaaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttcagaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgtaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctcgactcgtggtggacttctctca
attttctagggggatcacccgcgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggtacttctggattatcaaggtatgttgcccgtttgtcctctaattccaggaaccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|EU859953_PreS1_P-A Feature FT:CDS EU859953_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C55). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cggccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
ctcattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859954_PreS1_P-A Feature FT:CDS EU859954_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C42). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859955_PreS1_P-A Feature FT:CDS EU859955_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C39). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggaggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaagctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|EU859956_PreS1_P-A Feature FT:CDS EU859956_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C35). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaagctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ349224_PreS1_P-A Feature FT:CDS FJ349224_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate H71). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ349296_PreS1_P-A Feature FT:CDS FJ349296_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggacatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtattctggggtggagccctcag
gctcagggcacattgactaccgtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctacaagatc
ccagagtcaggggcctgtattttcctgctggtgggtccagttcaggaacagtcagccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
tttgggggccaagtctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692554_PreS1_P-A Feature FT:CDS FJ692554_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_24063). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaaaacctcgcaatggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaagcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcacattgactacagtgccagcagttcctcctcctgtctccgccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaaactctacaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgctccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcaaaagctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatatggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggcatacatt
taa
>gnl|hbvcds|FJ692557_PreS1_P-A Feature FT:CDS FJ692557_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48004). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692558_PreS1_P-A Feature FT:CDS FJ692558_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48008). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggggccaattcaaacaatccagattgggacttcaacccmgtcaargaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctctaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccctgmagtggaattccacagctttacacmaaactcagcaagatc
ccagagtcaggggcctrtatttccctgctggtggctccagttcaggaacactcaaccctgttccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggtgtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccctttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
tctgggggccaagtctgtacaacatcttgagtccctttataccgctgttascaattttcttttrtctttgggtatacatt
taa
>gnl|hbvcds|FJ692559_PreS1_P-A Feature FT:CDS FJ692559_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48032). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcaattggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catttctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692561_PreS1_P-A Feature FT:CDS FJ692561_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48040). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaycctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtrggagtgggagcattcgggccagggttcactcccccacacggaggtgtkttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggccacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692562_PreS1_P-A Feature FT:CDS FJ692562_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48044). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatacagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaaaaatactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcactgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggycacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctkgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgaatccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692563_PreS1_P-A Feature FT:CDS FJ692563_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48049). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttctkttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692564_PreS1_P-A Feature FT:CDS FJ692564_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48074). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccac
aggccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacaatgccagcagttcmtcctcctgcctccaccaatcggcagtcaggaagacagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692565_PreS1_P-A Feature FT:CDS FJ692565_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48077). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccac
aggccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacartgccagcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcc
catctctccacctctaagagacagtcatcctcaggccatrcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggwccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatwcatt
taa
>gnl|hbvcds|FJ692566_PreS1_P-A Feature FT:CDS FJ692566_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48090). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattccttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactccaccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacggtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccacatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692567_PreS1_P-A Feature FT:CDS FJ692567_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_48113). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttctgttcccaaycctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaayccagattgggacttcaacccagtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacractttccaycaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaaccaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtgtggctttcagctatatggatgatgtggt
actgggggccaartctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692571_PreS1_P-A Feature FT:CDS FJ692571_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50011). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692572_PreS1_P-A Feature FT:CDS FJ692572_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50013). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatryttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692574_PreS1_P-A Feature FT:CDS FJ692574_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50015). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692575_PreS1_P-A Feature FT:CDS FJ692575_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50020). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatrttgrccacagtgccagcagttcctcctcctgcctccwccaatcggcagtcaggvaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccrtgcagtggaattccacagctttccaccaagctctgcaagatc
ccaaagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggawcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattrtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccaytgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacaycttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692576_PreS1_P-A Feature FT:CDS FJ692576_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50022). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaacacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaaytccacagctttccaccaarctctgcaagatc
ccagartcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaatatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaaaactgtacaacatcttgagtccctttatactgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692577_PreS1_P-A Feature FT:CDS FJ692577_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50024). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccattggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagactgwacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692578_PreS1_P-A Feature FT:CDS FJ692578_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50083). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaagtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692579_PreS1_P-A Feature FT:CDS FJ692579_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50084). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaagtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692580_PreS1_P-A Feature FT:CDS FJ692580_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50085). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaagtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692581_PreS1_P-A Feature FT:CDS FJ692581_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50086). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaagtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692582_PreS1_P-A Feature FT:CDS FJ692582_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50088). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaagtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692583_PreS1_P-A Feature FT:CDS FJ692583_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50089). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaagtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692584_PreS1_P-A Feature FT:CDS FJ692584_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50090). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaagtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692585_PreS1_P-A Feature FT:CDS FJ692585_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50091). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaagtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccggtagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692588_PreS1_P-A Feature FT:CDS FJ692588_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50119). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
aactcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692590_PreS1_P-A Feature FT:CDS FJ692590_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50152). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaacccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692591_PreS1_P-A Feature FT:CDS FJ692591_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50167). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggwcatcaaaacctcgcaaaggcatggggacgaayctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaaytcaaacaacccagattgggacttcaaccccrtcaaggaccactggccac
aagccaaycaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacarctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacatgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692592_PreS1_P-A Feature FT:CDS FJ692592_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A1_50175). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagactgggacttcaaycccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcatttggcccagggttcactcccccacacggaggtgttttggggtggagcccgcag
gctcagggcatagtggctacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaggatc
caaaagtcagggccctgtattttcctgctggtggctccagttcaggaacgctcaaccctgttccmaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaawttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattaccagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccwcgtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FJ692593_PreS1_P-A Feature FT:CDS FJ692593_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48054). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcagcacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaagaaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaaratc
ccaaagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcgc
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgcw
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggcttttccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgccgtaaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692595_PreS1_P-A Feature FT:CDS FJ692595_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48093). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaycctctgggattcyttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatcccgattgggacttcaaccacagcaaggaccactggccac
aagccaatcaggtrggagtgggagcatttgggccagggttcacccctccacacggaggtgtcctggggtggagccctcag
gctcagggcatattgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccyactcc
catctctccacctctaagagacagtcatcctcaggccatrcagtggaattccacagctttccaccamgctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacttgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692596_PreS1_P-A Feature FT:CDS FJ692596_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48103). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcagrccatgcagtggaattccacwgctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcagggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692597_PreS1_P-A Feature FT:CDS FJ692597_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_48125). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaagcaggtaggagtgggagcattygggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacwcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagckttccaccaagctytgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacattacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692598_PreS1_P-A Feature FT:CDS FJ692598_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50018). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtgggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacctcagagtctagacttgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccrayttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaycarggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctrttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692599_PreS1_P-A Feature FT:CDS FJ692599_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50033). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggatcctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtaggagtgggcgcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttccccctcctgcctccaccaatcggcagtcaggaaggcagcctacgcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagcgctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcacagaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccmtttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgaatccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692600_PreS1_P-A Feature FT:CDS FJ692600_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50034). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttckgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacwcc
catctctccaccyctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatyacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcagggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgyaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692601_PreS1_P-A Feature FT:CDS FJ692601_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50035). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaagraccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctgggatggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692602_PreS1_P-A Feature FT:CDS FJ692602_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50041). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaagaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcayattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacwcc
catctctccacctctaagagacagtcatcctcaggccatgcaatggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692603_PreS1_P-A Feature FT:CDS FJ692603_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50050). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggtcggayatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggacccygcattcggrgccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttccgcctcctgcctccaccaatcggcagtcrggaaggcagcctacrcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaarctctgcaagatc
ccagagtcaggarcctgtgtcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcmtcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggttgacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcactactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692604_PreS1_P-A Feature FT:CDS FJ692604_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50052). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagcyctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtraaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692605_PreS1_P-A Feature FT:CDS FJ692605_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50059). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggtyggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaarctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atcttgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttckaggggratctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagwctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692606_PreS1_P-A Feature FT:CDS FJ692606_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50061). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaactcctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaagaccactggccac
aagccaatcaggtaggagtgggagcatttggcccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagccatcctcaggccatgcaatggaattccccagttttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattccyargacccccgct
cgtgttacaggcggggtctttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccamcagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692607_PreS1_P-A Feature FT:CDS FJ692607_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50068). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtgggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctcagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcacagaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttytatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692608_PreS1_P-A Feature FT:CDS FJ692608_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50075). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaactcctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaagaccactggccac
aagccaatcaggtaggagtgggagcatttggcccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagccatcctcaggccatgcaatggaattccacagctttccaccaagctctgcaagatc
ccagggtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
acctcgtcaatctcctcgaggactggggaccctgtaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692609_PreS1_P-A Feature FT:CDS FJ692609_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50098). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggtcggatatcaacaccccgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccattggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcttgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggatccctaggacccctgct
cgtgttacaggcggggtttttcttgtggacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctatggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692610_PreS1_P-A Feature FT:CDS FJ692610_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50104). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggtcggatatcaacaccccgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccattggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcttgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaycaarmtctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggatccctaggacccctgct
cgtgttacaggcggggtttttcttgtggacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctatggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692611_PreS1_P-A Feature FT:CDS FJ692611_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50127). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggtcggmtatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggacccctggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttccccctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggcaayacagtggaattccacagctttccaccaagctctgcaagatc
ccacagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgataagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FJ692612_PreS1_P-A Feature FT:CDS FJ692612_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50132). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagcgctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcacagaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggyatacatt
taa
>gnl|hbvcds|FJ692613_PreS1_P-A Feature FT:CDS FJ692613_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate A5_50156). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaacacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggacccggcattcggagccaactcaaacaatccagattgggacttcaaccacatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaagacagcctacacc
catctctccacctctaagggacagtcatcctcaggccatgcagtggaattccacagctttccaccaarccctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatattaccctcatgttgctgtaccaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcgtgaggccctttatgccgctgttaccaattttcttttgtctctgggcatacatt
taa
>gnl|hbvcds|FM199974_PreS1_P-A Feature FT:CDS FM199974_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaatcaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgtcttggggtggagccctcag
gctcagggcaaattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccamagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atatcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccagggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggt
attgggggccaaatctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FM199976_PreS1_P-A Feature FT:CDS FM199976_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgtcttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccrtgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagacttgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FM199977_PreS1_P-A Feature FT:CDS FM199977_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggrcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcaattggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccarggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatwcatt
taa
>gnl|hbvcds|FM199978_PreS1_P-A Feature FT:CDS FM199978_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccmattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FM199979_PreS1_P-A Feature FT:CDS FM199979_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaacaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FM199980_PreS1_P-A Feature FT:CDS FM199980_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcamctctatgtttccctcatgttgctgtacaaaacytacggctggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FM199981_PreS1_P-A Feature FT:CDS FM199981_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcaattggaccctgcattcggagccaattcaaacaatccagactgggacctcaaccccaccaaggaccactggccac
aatccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atatcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatrttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FN545825_PreS1_P-A Feature FT:CDS FN545825_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggacccggcattcggagccaactcaaacaagccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatacagtggaattccacaactttccaccaagctctgcaagatc
ccagagtaaggggcctgtatcttcctgctggtggctccagttcaggaacagtaacccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaaraatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtctgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|FN545826_PreS1_P-A Feature FT:CDS FN545826_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggacatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccag
cagccaatcaggtaggagtgggagcatttgggccagggytcacccctccacacggaggtattctggggtggagccctcag
gctcagggcatattgactacagtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaagacccctgct
cgggttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgccttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
caaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacgaccagtacaggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgytgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
tttgggggccaagtctgtacaacatcttgagtccctttttaccgctgtwaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|FN545828_PreS1_P-A Feature FT:CDS FN545828_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctgtctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccaggrttcacccctccacacggcggtgttctggggtggagccctcag
gctcagggcatactgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctacaagatc
ccagggtcaggggcctgtatttccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggrtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttctgctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcytggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcttgactccctttttaccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|FN545829_PreS1_P-A Feature FT:CDS FN545829_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccaacaaggaccactggtcac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcag
gctcagggcatattgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcttcctcaggccatacagtggaattccacaactttccaccaagctctgcaggatc
ccaaggtcaggggcctgtatttccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctccgcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttctgctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgttcccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|FN545830_PreS1_P-A Feature FT:CDS FN545830_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttcgttgccaaaacctcgcaaaggcatggggacgaatctttctgttccaaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccaccaaggaccactggtcac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcag
gctcagggcatattgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccayccagtggmattccacaactttccaccaagctctgcaagatc
ccagggtcaggggcctgtatttacctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggaytcctaggacmcctgct
cgtgttacaggcgggatttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcatggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttctgctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacgaccaccagyacgggac
cctgccgaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccctcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaaatctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|FN545831_PreS1_P-A Feature FT:CDS FN545831_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggcatacatt
taa
>gnl|hbvcds|FN545832_PreS1_P-A Feature FT:CDS FN545832_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccaycaaggaccactggccac
aggccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcag
gctcagggcatattgacaacagtgccagcagttcctcctcctgcctccaccaatcggaggtcaggaaggcagcctactcc
catttctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagggtcaggggcctgtatttccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgcc
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggawcacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttctgctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtataaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|FN545833_PreS1_P-A Feature FT:CDS FN545833_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttcgttaccaaaacctcgcaaaggcatggggacgaatctttctgtgcccaaccctctgggattttttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacgtcaaccccttcaaggatcactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcacattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacactcatcctcaggccattcagtggaattccacaactttccaccaagctctgcaagatc
ccagggtcaggggcctgtatctccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctrct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccrcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttctgctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcrtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcaccttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|FN545834_PreS1_P-A Feature FT:CDS FN545834_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggtycgttaymaaaacctcgcaaaggcatggggacgaatctttctgtgcccaaccctctgggattttttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacgtcaaccccttcaaggatcactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatactgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacgcc
catctctccacctctaagagacactcatcctcaggccattcagtggaattccacaactttccaccaagctctgcaagatc
ccagggtcaggggcctgtatctccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctrct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttrttggttctgctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaratwcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcaycttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|FN545835_PreS1_P-A Feature FT:CDS FN545835_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcag
gctcagggyatactgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcartggaattccacaactttccaccaagctctacaagatc
ccagggtcaggggcctgtatttccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttctgctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|FN545836_PreS1_P-A Feature FT:CDS FN545836_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggatagcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactacagtgccagcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctacacc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctacaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttcwggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaactaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|FN545837_PreS1_P-A Feature FT:CDS FN545837_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=1194 residues).
atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggatccagcattcggagccaactcaaacmatccagattgggacttcaaccccatcaaggaccactggccaa
aagccaaycaggtaggagtgggagcatttggrccmgggytcacccctccacacggmggtgttctggggtggagccctcag
gctcagggcatattgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatccagtggagttccacaacttcccaccaagctctgcaagatc
ccagggtcaggggccctgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtca
atctcctcgargactggggaccctgcaccgaccatggagaacaycacatcaggattcctaggacccctgctcgtgttaca
ggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctag
ggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgt
cctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggt
tcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggamcctgcaaaa
cctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgt
attcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttact
agtgccatttgttcagtggtycgtagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggc
caagtctgtacaacatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FN545838_PreS1_P-A Feature FT:CDS FN545838_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggactacaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcattcgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatatcgactaccgtgccagcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcc
catctctccacctctaagagacagtcatccgcaggccatgcagtggaattccacagmtttccaccaagctctgrmagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaagccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttctgctggattgtcaaggtatgttgcccgtttgtcctccaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
tttgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggyatacatt
taa
>gnl|hbvcds|FN545840_PreS1_P-A Feature FT:CDS FN545840_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=1191 residues).
atgggaggttggttgccaaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaatcccaccaaggaccactggtcac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggcggtgttctggggtggagccctcag
gctcagggcatattgacaacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaacaagctctgcaagatc
ccagggtcaggggtgctggtggctccaattcaggaacagtaaaccctgttccgaatactgcctctcacatctcgtcaatc
tcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggc
ggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggg
gcccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcct
ggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttattggtgct
gctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggaccctgcagaacct
gcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtatt
cccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagc
gccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaa
gtctgtacagcaccttgaatccctttttactgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ161813_PreS1_P-A Feature FT:CDS GQ161813_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate GU1021). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaacacaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcatattgactactgtgccagcagttcctcctcctgctgccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|GQ184323_PreS1_P-A Feature FT:CDS GQ184323_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1121). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattacactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggactttcttcc
attgtctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ184324_PreS1_P-A Feature FT:CDS GQ184324_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ZADGM1122). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctccgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccacgcagtggaattacactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
ctttttggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgacttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ331046_PreS1_P-A Feature FT:CDS GQ331046_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-188). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaactcctcgcaaaggcatggggacaaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
aagccaaccaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggtctattgaccacgctgccaaaggttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtgggagtccacaaccttccaccaagctctgcaagatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttcagaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctcgactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatctgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggtacttctggattatcaaggtatgttgcccgtttgtcctctaattccaggaaccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|GQ331047_PreS1_P-A Feature FT:CDS GQ331047_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-56). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaacacctcgcataggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgccaaaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaaccttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttcagaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgtaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctcgactcgtggtggacttctctca
attttctagggggatcacccgcgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggtacttctggattatcaaggtatgttgcccgtttgtcctctaattccaggaaccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|GQ414522_PreS1_P-A Feature FT:CDS GQ414522_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477461_PreS1_P-A Feature FT:CDS GQ477461_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P3). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477462_PreS1_P-A Feature FT:CDS GQ477462_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P4). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggcattttggggtggagccctcag
gctcagggcatattgacaacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgcttgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
tttgggggccaagtctgtacaacatcgtgaagccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477463_PreS1_P-A Feature FT:CDS GQ477463_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccaggactcacccctccacacggcggtatattggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggcaatgcagtggaactccactgccttccaccaagctctgcaagatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaagcacccgtgtgtcttggccaaaattcgcagtccccaacctgcaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatatccctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactggtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttacatggatgatgtggt
attgggggccaagtctgtacaacatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477464_PreS1_P-A Feature FT:CDS GQ477464_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P8). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatcaagattgggacttcaaccccatcaaggatcactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggaggtcttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catttctccacctctaagagacactcatcctcaggccatgcagtggaattccactgctttccaccaagctctgcaaaatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
caaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|GQ477465_PreS1_P-A Feature FT:CDS GQ477465_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P10). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggcattcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477466_PreS1_P-A Feature FT:CDS GQ477466_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P12). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccccccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477467_PreS1_P-A Feature FT:CDS GQ477467_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P14). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctacgagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477468_PreS1_P-A Feature FT:CDS GQ477468_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P16). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcagaacctgcacgactcctgctcaaagcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
tga
>gnl|hbvcds|GQ477469_PreS1_P-A Feature FT:CDS GQ477469_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P19). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccccccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggcaatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggaatacccgtgtgtcatggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
caaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaaatctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477470_PreS1_P-A Feature FT:CDS GQ477470_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P20). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggatttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttagggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatacagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttcgaggggaagcacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgtaaccaattttcttttgtctctgggtatacaty
taa
>gnl|hbvcds|GQ477472_PreS1_P-A Feature FT:CDS GQ477472_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P24). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagatctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttaacaagaatcctcacaataccgaagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477473_PreS1_P-A Feature FT:CDS GQ477473_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P27). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggacccggcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggaggcattttggggtggagccctcag
gctcagggcatattaaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagccctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcgggatttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctaggggtaccacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccacgtctgtgcagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477474_PreS1_P-A Feature FT:CDS GQ477474_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P28). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcacattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcaacctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattacgctgccttccaccgggctctgcaggatc
ccaaagtcaagggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacacggagaacatcacatcaggattcctaggacccctgca
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccgatttgtcctggttatcgctggatgtgtcagcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcatgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggccttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcttgattccctttataccgctgtgaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477475_PreS1_P-A Feature FT:CDS GQ477475_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P29). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttccgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccaggactcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaagccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggt
attgggggccaagtctgtgcaacatcgtgaagccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477476_PreS1_P-A Feature FT:CDS GQ477476_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P30). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtcttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctacaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctaggggggtcaaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcagggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgtctcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagttcactagtgccatttgttcagtggttcgtagagctttcccccactgtttggcttttagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgtaaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477477_PreS1_P-A Feature FT:CDS GQ477477_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P31). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatcccgattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccacgcagtggaattccactgccgtccaccaagatccgcaggacc
ccaaagtcaggggtctgtgttttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcac
atctcgtcaatctccgcgaggactggggaccctgtgaagaacagggagaacatcacatcaggattcctaggacccctgca
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
caaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgccatgcctcatctt
cttattggttcttctggattatcaaggtatattgcccgtttgtcctctaattccaggagcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477478_PreS1_P-A Feature FT:CDS GQ477478_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P34). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaatcccatcaaggaccactggccag
cagccaaccaggtaggagcgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgaaggata
ccagagtcaggggtctgtattctcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgattcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477479_PreS1_P-A Feature FT:CDS GQ477479_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P40). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaaactctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477480_PreS1_P-A Feature FT:CDS GQ477480_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P41). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaacccaatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggcattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcagaatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477482_PreS1_P-A Feature FT:CDS GQ477482_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P46). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctacaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctcaaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477484_PreS1_P-A Feature FT:CDS GQ477484_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P54). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaagaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcaccagtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477486_PreS1_P-A Feature FT:CDS GQ477486_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P57). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcttccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477487_PreS1_P-A Feature FT:CDS GQ477487_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P60). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaaaccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaagccatgcagtggaattccactgccttccaccaaactctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaagccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477488_PreS1_P-A Feature FT:CDS GQ477488_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P64). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaagttcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477490_PreS1_P-A Feature FT:CDS GQ477490_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P74). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatccggagtcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaaatctgtacagcaccgtgagtccctttttaccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477491_PreS1_P-A Feature FT:CDS GQ477491_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P75). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccccccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaaatctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477493_PreS1_P-A Feature FT:CDS GQ477493_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P79). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaacccgctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccctcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacacctccacacggcggtattttggggtggagccctcag
gctcarggcatatggaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggagttccactgctttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggaaaacatcacatcaggattcctagaacccccgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaatcccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcttgagtctctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477494_PreS1_P-A Feature FT:CDS GQ477494_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P80). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaatcccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacggggc
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatattgt
attgggggccaagtctgtacaacatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtattcatt
taa
>gnl|hbvcds|GQ477495_PreS1_P-A Feature FT:CDS GQ477495_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P89). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggatcctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaaatcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaaactctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtctcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaaacagctctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477496_PreS1_P-A Feature FT:CDS GQ477496_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P94). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477497_PreS1_P-A Feature FT:CDS GQ477497_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P98). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacgcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
caaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477498_PreS1_P-A Feature FT:CDS GQ477498_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P100). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gcccagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggaccccagct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477499_PreS1_P-A Feature FT:CDS GQ477499_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P105). Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccaggactcacccctccacacggcggtatcttggggtggagccctcaa
gctcagggcatattgaccacagtatcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaagccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccattgcttggctttcagctatatggatgatgtggt
attgggggccaagtctgtagagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477500_PreS1_P-A Feature FT:CDS GQ477500_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P107). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatattgcgcgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagttcactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatc
taa
>gnl|hbvcds|GQ477501_PreS1_P-A Feature FT:CDS GQ477501_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P116). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttcggttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
ccgccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagaatctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccattgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477502_PreS1_P-A Feature FT:CDS GQ477502_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P123). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaatcctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtatcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtattacaggcggggtttttcttgttgacaagaatcctcacaataccgcagaatctagactcgtggtggacttctctca
gttttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaac
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggt
attgggggccacatctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477503_PreS1_P-A Feature FT:CDS GQ477503_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P130). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaacctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GQ477504_PreS1_P-A Feature FT:CDS GQ477504_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P131). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggcattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtccactaattccaggatcaacaacaaccagtacaggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggcttttagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggcactttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563545_PreS1_P-A Feature FT:CDS GU563545_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-5). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|GU563546_PreS1_P-A Feature FT:CDS GU563546_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-66). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563547_PreS1_P-A Feature FT:CDS GU563547_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-23). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattcttccccga
tcatcagttggaccccgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttgggatggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaaactctgcaagatt
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|GU563548_PreS1_P-A Feature FT:CDS GU563548_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-108). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctatctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccaccaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctactttgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagaaagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcttcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|GU563550_PreS1_P-A Feature FT:CDS GU563550_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-204). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563551_PreS1_P-A Feature FT:CDS GU563551_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-124). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggacccagcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacgcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccactgccttccaccaagctctacaggatc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgcagggctttcccccattgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563553_PreS1_P-A Feature FT:CDS GU563553_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-10). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaacctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563554_PreS1_P-A Feature FT:CDS GU563554_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-25). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563555_PreS1_P-A Feature FT:CDS GU563555_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-35). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcagaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcattcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563557_PreS1_P-A Feature FT:CDS GU563557_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-78). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563558_PreS1_P-A Feature FT:CDS GU563558_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-90). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|GU563562_PreS1_P-A Feature FT:CDS GU563562_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate BV-189). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggaatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|HE576988_PreS1_P-A Feature FT:CDS HE576988_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P5.9). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttcaagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggaaggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|HE576989_PreS1_P-A Feature FT:CDS HE576989_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate P2.2.11). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaatcccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcagggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggaaggaaat
tgcacctgtattcccatcccattgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|HM011485_PreS1_P-A Feature FT:CDS HM011485_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaacccgctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaagaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggctcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgaccacggtgccagcagttcctcctcctgcctccaccaatcggcaggcaggaaggcagcctactcc
catctctccacctctaagagaaagtcatcctcaggccatgcagtggaattccacagcgttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttcccaatactgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
catgcaaaacctgcacgacttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgcttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgaatccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|HM363612_PreS1_P-A Feature FT:CDS HM363612_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate C3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggatatcaaaacctcgcaaaggcatggggacgaatctgtctgttcccaaccctctgggattctttcccga
tcatcagttggaccccgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggcgtgggtgcatttgggccagggttcacccctccacacggaggtgttctggggtggagccctcag
gctcagggcacattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctatattttcctgctggtggctccagttcaggaacagtaaaccctgctcagaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|HM363613_PreS1_P-A Feature FT:CDS HM363613_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate V103). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggtcggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tctcaatttggaccctgcattcggagccaactcaaacaagccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttggaccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagagccttctccttatagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacaactttccaccaagctctgcaagatc
ccagagtaaggggcctgtattttcctgctggtggctccagttcaggaacagtaacccctgttccgaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattgtcaaggtatgttgcccgtctgtcctctaattccaggatccacaaccaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggcatacatt
taa
>gnl|hbvcds|HM535200_PreS1_P-A Feature FT:CDS HM535200_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 947 Harare). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgttgaacatggagaacatcacatcgagattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|HM535205_PreS1_P-A Feature FT:CDS HM535205_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 72 Mutare). Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcagccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgc
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagttcctcccactgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagccaggggcctgtattttccggctggtggctccagttcaggaacactcaaccctgttccaaatactgcctctcac
atctcggcaatctcctcgaggactggggaccctgcgttgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcctgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtgtacatt
taa
>gnl|hbvcds|JF439720_PreS1_P-A Feature FT:CDS JF439720_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL437). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
aggggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccaccaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacctctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgccct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgtcgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439721_PreS1_P-A Feature FT:CDS JF439721_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL444). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcactcctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaagatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439722_PreS1_P-A Feature FT:CDS JF439722_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL445). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccaccaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439724_PreS1_P-A Feature FT:CDS JF439724_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL450). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcactcctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgccct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439725_PreS1_P-A Feature FT:CDS JF439725_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL451). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcactcctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtgcaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctagct
cagtctactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439726_PreS1_P-A Feature FT:CDS JF439726_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL452). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcactcctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtagctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggccttagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439727_PreS1_P-A Feature FT:CDS JF439727_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL453). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtagacttccacagcttttcaccaaactctgcaagatc
ccagagtcgggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagaaactagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctagct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439728_PreS1_P-A Feature FT:CDS JF439728_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL454). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcactcctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtgcaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctagct
cagtctactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439729_PreS1_P-A Feature FT:CDS JF439729_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL455). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439730_PreS1_P-A Feature FT:CDS JF439730_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL456). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctccccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439731_PreS1_P-A Feature FT:CDS JF439731_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL458). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
aggggaggttggttacccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aggccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggccttagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439734_PreS1_P-A Feature FT:CDS JF439734_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL461). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
aggggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctggcattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccaccaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgccgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggccttagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439735_PreS1_P-A Feature FT:CDS JF439735_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL462). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439736_PreS1_P-A Feature FT:CDS JF439736_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL463). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcactcctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439737_PreS1_P-A Feature FT:CDS JF439737_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL465). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439738_PreS1_P-A Feature FT:CDS JF439738_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL466). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439739_PreS1_P-A Feature FT:CDS JF439739_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL467). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcgaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439740_PreS1_P-A Feature FT:CDS JF439740_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL468). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaagcaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctagct
cagtctactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439741_PreS1_P-A Feature FT:CDS JF439741_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL469). Partial genome (Contains: HBe, HBc, HBx, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggctaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacccctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgccccatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctagct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439742_PreS1_P-A Feature FT:CDS JF439742_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL471). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
aggggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagtcaattcaaacaatccagattgggacttcaaccccaccaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgccct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439743_PreS1_P-A Feature FT:CDS JF439743_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL472). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaaccgcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaagaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcaccctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttctcttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439744_PreS1_P-A Feature FT:CDS JF439744_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL473). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
aggggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctggcattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccaccaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagttcccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggccttagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439746_PreS1_P-A Feature FT:CDS JF439746_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL485). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccgaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439747_PreS1_P-A Feature FT:CDS JF439747_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL489). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcactcctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccggttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439748_PreS1_P-A Feature FT:CDS JF439748_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL490). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggacttccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgccct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcggaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439752_PreS1_P-A Feature FT:CDS JF439752_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439753_PreS1_P-A Feature FT:CDS JF439753_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatttt
tttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439754_PreS1_P-A Feature FT:CDS JF439754_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439755_PreS1_P-A Feature FT:CDS JF439755_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A4). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439756_PreS1_P-A Feature FT:CDS JF439756_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439757_PreS1_P-A Feature FT:CDS JF439757_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439758_PreS1_P-A Feature FT:CDS JF439758_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439759_PreS1_P-A Feature FT:CDS JF439759_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439760_PreS1_P-A Feature FT:CDS JF439760_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A11). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439761_PreS1_P-A Feature FT:CDS JF439761_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95A12). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439762_PreS1_P-A Feature FT:CDS JF439762_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B1). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttttccga
tcatcagttggaccctgcattcggagccaactcaaacaatacagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatttt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439763_PreS1_P-A Feature FT:CDS JF439763_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B3). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439764_PreS1_P-A Feature FT:CDS JF439764_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B5). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439765_PreS1_P-A Feature FT:CDS JF439765_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B6). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439766_PreS1_P-A Feature FT:CDS JF439766_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU95B7). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439767_PreS1_P-A Feature FT:CDS JF439767_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaagacc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439768_PreS1_P-A Feature FT:CDS JF439768_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B9). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggcaag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttcccccaagctctgcaagacc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439769_PreS1_P-A Feature FT:CDS JF439769_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05B10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggcaag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttcccccaagctctgcaagacc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439774_PreS1_P-A Feature FT:CDS JF439774_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C8). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttacaccaagctctgcaagacc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439777_PreS1_P-A Feature FT:CDS JF439777_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05D2). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaagacc
ccaaagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439819_PreS1_P-A Feature FT:CDS JF439819_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97A1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggcccacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagaacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatagatgatgtggt
attgggggccaagtctgtacagcaccgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439820_PreS1_P-A Feature FT:CDS JF439820_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97B1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggatttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggga
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439821_PreS1_P-A Feature FT:CDS JF439821_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97B2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggacatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gttcagggcatattgaccacagtgtcaacaattcctcgtcctgcatccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatacagtggaattacactaccttccgccaagctatgcaggatc
ccagagtcaggggaatgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggacccagtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgcggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccaccgtccggggctttcgcaaaatacctatgggagtgggcctcagtccgtttctattggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439822_PreS1_P-A Feature FT:CDS JF439822_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97C1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccctccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439823_PreS1_P-A Feature FT:CDS JF439823_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97C2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagaacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaagt
tgcacctgtatccccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatagatgatgtggt
attgggggccaagtctgtacagcaccgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439824_PreS1_P-A Feature FT:CDS JF439824_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97D1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaagacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgtcgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439825_PreS1_P-A Feature FT:CDS JF439825_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97D2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcgaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439826_PreS1_P-A Feature FT:CDS JF439826_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97E1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatactcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatagatgatgtggt
attgggggccaagtctgtacagcaccgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439827_PreS1_P-A Feature FT:CDS JF439827_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97E2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagaacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatagatgatgtggt
attgggggccaagtctgtacagcaccgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439828_PreS1_P-A Feature FT:CDS JF439828_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97F1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgccgtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439829_PreS1_P-A Feature FT:CDS JF439829_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97F2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcaccctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439830_PreS1_P-A Feature FT:CDS JF439830_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97G2). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatagatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439831_PreS1_P-A Feature FT:CDS JF439831_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97H1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattggccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439832_PreS1_P-A Feature FT:CDS JF439832_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ97H2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgcggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcggcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439833_PreS1_P-A Feature FT:CDS JF439833_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99H4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtcccttcataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439834_PreS1_P-A Feature FT:CDS JF439834_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99A4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcggcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcgtcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439835_PreS1_P-A Feature FT:CDS JF439835_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99B3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcgatattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagcctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439836_PreS1_P-A Feature FT:CDS JF439836_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99B4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacccctaagagacagtcatcctcaggtcatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
aatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439837_PreS1_P-A Feature FT:CDS JF439837_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99C3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcgatattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagcctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439838_PreS1_P-A Feature FT:CDS JF439838_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99C4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgcattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439839_PreS1_P-A Feature FT:CDS JF439839_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99D3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaagaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggactctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439840_PreS1_P-A Feature FT:CDS JF439840_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99D4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
aatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439841_PreS1_P-A Feature FT:CDS JF439841_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99E4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgtttccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatattgcctcccac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcacaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439842_PreS1_P-A Feature FT:CDS JF439842_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99F3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctctgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctagggcccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggaa
catgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccatttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439843_PreS1_P-A Feature FT:CDS JF439843_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99F4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcttcccac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtgctggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgccctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcccgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439844_PreS1_P-A Feature FT:CDS JF439844_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ99H3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439845_PreS1_P-A Feature FT:CDS JF439845_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00H6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaagacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccgcacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439846_PreS1_P-A Feature FT:CDS JF439846_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00A5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttccaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatatttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctctcgcaaagtacctatgggagtgggcctcagtccgcttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439847_PreS1_P-A Feature FT:CDS JF439847_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00A6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcggggcatattgaccacagtgccaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcgggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccccttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439848_PreS1_P-A Feature FT:CDS JF439848_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00B5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccgcacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439849_PreS1_P-A Feature FT:CDS JF439849_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00B6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
cgtctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctctgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcgaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attggggaccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439850_PreS1_P-A Feature FT:CDS JF439850_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00C5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctctgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtatcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
aatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439851_PreS1_P-A Feature FT:CDS JF439851_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00C6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttccaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcgggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439852_PreS1_P-A Feature FT:CDS JF439852_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00D5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcgaagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgtctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagacccgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttaccatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttttggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439853_PreS1_P-A Feature FT:CDS JF439853_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00D6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttccaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtctcggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439854_PreS1_P-A Feature FT:CDS JF439854_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00E5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccgcacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcagggttcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccgtcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439855_PreS1_P-A Feature FT:CDS JF439855_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00E6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcgggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacaccacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
aatgcaaaacctgcacgactactgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagcccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439856_PreS1_P-A Feature FT:CDS JF439856_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00F5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccgcacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcagggttcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccgtcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439857_PreS1_P-A Feature FT:CDS JF439857_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00F6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggagattggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcgggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgccctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439858_PreS1_P-A Feature FT:CDS JF439858_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00G5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcttcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcgggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgcattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439859_PreS1_P-A Feature FT:CDS JF439859_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00G6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccccccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcgggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggaccggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439860_PreS1_P-A Feature FT:CDS JF439860_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ00H5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcttcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcgggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgcattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439861_PreS1_P-A Feature FT:CDS JF439861_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05H8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaacctcatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctctgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcgaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439862_PreS1_P-A Feature FT:CDS JF439862_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05B7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
acgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctctgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaattcgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatcccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439864_PreS1_P-A Feature FT:CDS JF439864_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05D7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattctactgccttccatcaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctctgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagggtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcgaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439865_PreS1_P-A Feature FT:CDS JF439865_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05D8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccggattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatattgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439866_PreS1_P-A Feature FT:CDS JF439866_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05F7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcagggtc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctctgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctcgatgtgtctgcggcgttttatcatattcctctccatcctgctgctatgcctcatctt
cttattggttcttctggattatcgaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439867_PreS1_P-A Feature FT:CDS JF439867_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05G8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccgtccaccaagctctacaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggcgaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439868_PreS1_P-A Feature FT:CDS JF439868_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ABJ05H7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgctctgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctcgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcgaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
caatttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatattgt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgtcaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439869_PreS1_P-A Feature FT:CDS JF439869_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggagttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggaggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439870_PreS1_P-A Feature FT:CDS JF439870_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatattgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaactacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439871_PreS1_P-A Feature FT:CDS JF439871_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439872_PreS1_P-A Feature FT:CDS JF439872_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagtcagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctaaacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaaactacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctattggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439873_PreS1_P-A Feature FT:CDS JF439873_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439874_PreS1_P-A Feature FT:CDS JF439874_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439875_PreS1_P-A Feature FT:CDS JF439875_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcacgggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439876_PreS1_P-A Feature FT:CDS JF439876_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggagttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggaggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439877_PreS1_P-A Feature FT:CDS JF439877_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgatgccctcatgttgctgtacaaaaactacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439878_PreS1_P-A Feature FT:CDS JF439878_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01C12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgatgccctcatgttgctgtacaaaaactacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439879_PreS1_P-A Feature FT:CDS JF439879_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439880_PreS1_P-A Feature FT:CDS JF439880_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgacgcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439881_PreS1_P-A Feature FT:CDS JF439881_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaggctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439882_PreS1_P-A Feature FT:CDS JF439882_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439883_PreS1_P-A Feature FT:CDS JF439883_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate ANG01E7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattttttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgctagacc
cccgagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcacctctatgattccctcatgttgctgtacaaaacctacggctgcaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagcccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttatgtctctgggtatacatt
taa
>gnl|hbvcds|JF439896_PreS1_P-A Feature FT:CDS JF439896_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtgcaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439897_PreS1_P-A Feature FT:CDS JF439897_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtgcaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439898_PreS1_P-A Feature FT:CDS JF439898_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01A10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439899_PreS1_P-A Feature FT:CDS JF439899_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439900_PreS1_P-A Feature FT:CDS JF439900_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttaccatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439901_PreS1_P-A Feature FT:CDS JF439901_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcattcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439902_PreS1_P-A Feature FT:CDS JF439902_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtgcaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439903_PreS1_P-A Feature FT:CDS JF439903_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439904_PreS1_P-A Feature FT:CDS JF439904_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01G12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcctttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtgcaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439905_PreS1_P-A Feature FT:CDS JF439905_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgcacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439906_PreS1_P-A Feature FT:CDS JF439906_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccacgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcacaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439907_PreS1_P-A Feature FT:CDS JF439907_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtgcaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JF439908_PreS1_P-A Feature FT:CDS JF439908_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcgtggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439909_PreS1_P-A Feature FT:CDS JF439909_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtgcaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439910_PreS1_P-A Feature FT:CDS JF439910_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate FOL01H6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttttggggtggagccctcag
gctcagggcacattgaccacagtgccagcaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacagtaaaccctgttccgaatactgcctctcac
atctcgtcaatctcctcgacgactggggaccctgcaccaaccatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagttcccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcagaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgttgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagcgccatttgttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatc
taa
>gnl|hbvcds|JF439911_PreS1_P-A Feature FT:CDS JF439911_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaagggccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439912_PreS1_P-A Feature FT:CDS JF439912_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcacctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttacaccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439913_PreS1_P-A Feature FT:CDS JF439913_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaagccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439914_PreS1_P-A Feature FT:CDS JF439914_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggcattttggggtggagccctcag
gctcagggcacattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcctatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439915_PreS1_P-A Feature FT:CDS JF439915_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccctcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
ctctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439916_PreS1_P-A Feature FT:CDS JF439916_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagagtcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439917_PreS1_P-A Feature FT:CDS JF439917_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgcccaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccccttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439918_PreS1_P-A Feature FT:CDS JF439918_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgccaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439919_PreS1_P-A Feature FT:CDS JF439919_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggggtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatccttacaataccgcagagtctagactcgtggtgggcttctctca
attttctagggggagcacccgtgtgccttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacggggc
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439920_PreS1_P-A Feature FT:CDS JF439920_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcatccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagagcatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcct
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439921_PreS1_P-A Feature FT:CDS JF439921_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccttctgggattctttcccga
tcatcagttggaccccgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcgcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttactggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439922_PreS1_P-A Feature FT:CDS JF439922_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00A12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439923_PreS1_P-A Feature FT:CDS JF439923_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgttcggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439924_PreS1_P-A Feature FT:CDS JF439924_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatatcgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacagtaccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439925_PreS1_P-A Feature FT:CDS JF439925_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtctctcttggct
cagtttactagtgccattcgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439926_PreS1_P-A Feature FT:CDS JF439926_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B4). Partial genome (Contains: HBc, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
acgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttgact
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439927_PreS1_P-A Feature FT:CDS JF439927_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB00B6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gcccagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439928_PreS1_P-A Feature FT:CDS JF439928_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaacattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439929_PreS1_P-A Feature FT:CDS JF439929_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctattcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaacattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttatacccctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439930_PreS1_P-A Feature FT:CDS JF439930_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B9). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggaattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
tatctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgcgacgaacatggagaacatcacatcgggattcctaggacccccgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439931_PreS1_P-A Feature FT:CDS JF439931_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcac
atctcgtcaatctccgcgaggactggggaccctgcgacgaacatggagaacatcacatcaggagtcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattgattcttctggattatcaaggtatgtcgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439932_PreS1_P-A Feature FT:CDS JF439932_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B11). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctcagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaacattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtatggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439933_PreS1_P-A Feature FT:CDS JF439933_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05B12). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggaattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggagggcagcccactcc
tatccctccacccctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcgggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttccagggggagcacccgaatgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439934_PreS1_P-A Feature FT:CDS JF439934_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C1). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaacattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439935_PreS1_P-A Feature FT:CDS JF439935_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C2). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcatctcac
atctcgtcaatctccgcgaggactggggaccctgcgacgaacatggagaacatcacatcaggagtcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgccatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439936_PreS1_P-A Feature FT:CDS JF439936_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C3). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaacattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacctctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggggcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgccctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439937_PreS1_P-A Feature FT:CDS JF439937_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C4). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaacctcatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggaattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
tatctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcccctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcgggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccgtcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439938_PreS1_P-A Feature FT:CDS JF439938_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C5). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggaattttggggtggagccctcag
gctcagggcatattggccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
tatctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcgggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctatattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439939_PreS1_P-A Feature FT:CDS JF439939_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggaattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
tatctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcgggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgttcgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439940_PreS1_P-A Feature FT:CDS JF439940_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C7). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctggggttctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
catctctccacctctgagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaacattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439941_PreS1_P-A Feature FT:CDS JF439941_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C8). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacctcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggaattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
tatctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcccctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcgggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439942_PreS1_P-A Feature FT:CDS JF439942_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate LAMB05C10). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccaggactcacccctccacacggcggaattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcaatcaggaaggcagcccactcc
tatctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcgggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgagtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatatccctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaagtacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439943_PreS1_P-A Feature FT:CDS JF439943_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaagggccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctccccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttttaccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439944_PreS1_P-A Feature FT:CDS JF439944_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacgcggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcgggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaatcttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439945_PreS1_P-A Feature FT:CDS JF439945_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaatcttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439946_PreS1_P-A Feature FT:CDS JF439946_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gcccagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439947_PreS1_P-A Feature FT:CDS JF439947_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccaaggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatggtgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439948_PreS1_P-A Feature FT:CDS JF439948_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439949_PreS1_P-A Feature FT:CDS JF439949_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggactccaaccccatcaaggaccactggccag
cagccaaccaggtaggagcgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactgggggccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggacgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttatatcgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439950_PreS1_P-A Feature FT:CDS JF439950_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gcccagggcatattgaccacagtgtcgacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctcccac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439951_PreS1_P-A Feature FT:CDS JF439951_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a11). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggtcggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtgcgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgcacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439952_PreS1_P-A Feature FT:CDS JF439952_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99a12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcaccctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatgttcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctgcggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgcggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439953_PreS1_P-A Feature FT:CDS JF439953_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcggggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcgcccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttctcccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439954_PreS1_P-A Feature FT:CDS JF439954_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcgacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439955_PreS1_P-A Feature FT:CDS JF439955_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccaccaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctccccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439956_PreS1_P-A Feature FT:CDS JF439956_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcgtctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439957_PreS1_P-A Feature FT:CDS JF439957_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagccaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgtctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439958_PreS1_P-A Feature FT:CDS JF439958_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagagcatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtgggcttctctca
attttctagggggaccacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgtcgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439959_PreS1_P-A Feature FT:CDS JF439959_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctatattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggctcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439960_PreS1_P-A Feature FT:CDS JF439960_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc99b10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcagggtc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacggacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaatcttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439961_PreS1_P-A Feature FT:CDS JF439961_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccccgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcccgggctttcacaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatttggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439962_PreS1_P-A Feature FT:CDS JF439962_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcaccctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439963_PreS1_P-A Feature FT:CDS JF439963_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcaggggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439964_PreS1_P-A Feature FT:CDS JF439964_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
atcttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439965_PreS1_P-A Feature FT:CDS JF439965_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagcgccaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgtaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtacacatt
taa
>gnl|hbvcds|JF439966_PreS1_P-A Feature FT:CDS JF439966_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c8). Partial genome (Contains: HBe, HBc, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgtgaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccacgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccgacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgctaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439967_PreS1_P-A Feature FT:CDS JF439967_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439968_PreS1_P-A Feature FT:CDS JF439968_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01c12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacgcggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctctataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439969_PreS1_P-A Feature FT:CDS JF439969_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcaaggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439970_PreS1_P-A Feature FT:CDS JF439970_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccgggctctgcaggatc
ccagagtctggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcagggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgaagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439971_PreS1_P-A Feature FT:CDS JF439971_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctggactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgttgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439972_PreS1_P-A Feature FT:CDS JF439972_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctagttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaaatttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439973_PreS1_P-A Feature FT:CDS JF439973_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggagcagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtgggcttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439974_PreS1_P-A Feature FT:CDS JF439974_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439975_PreS1_P-A Feature FT:CDS JF439975_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcacggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacagtaccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcctctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatttggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439976_PreS1_P-A Feature FT:CDS JF439976_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccccgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgagcatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaaggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttaccatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439977_PreS1_P-A Feature FT:CDS JF439977_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcactcctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtccgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439978_PreS1_P-A Feature FT:CDS JF439978_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc01d10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggacccagcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagcctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgtccagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439979_PreS1_P-A Feature FT:CDS JF439979_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccgacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctccaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacgggtggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439980_PreS1_P-A Feature FT:CDS JF439980_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439981_PreS1_P-A Feature FT:CDS JF439981_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccctcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaagacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagagggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaagcctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439982_PreS1_P-A Feature FT:CDS JF439982_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagtccaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439983_PreS1_P-A Feature FT:CDS JF439983_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccgctggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatatcgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtagaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439984_PreS1_P-A Feature FT:CDS JF439984_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtgggggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439985_PreS1_P-A Feature FT:CDS JF439985_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e10). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439986_PreS1_P-A Feature FT:CDS JF439986_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05e12). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaatatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439987_PreS1_P-A Feature FT:CDS JF439987_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaagacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439988_PreS1_P-A Feature FT:CDS JF439988_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtatttcggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactca
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439989_PreS1_P-A Feature FT:CDS JF439989_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggcttccccccaccgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439990_PreS1_P-A Feature FT:CDS JF439990_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacggtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcccaggacccctgct
cgtgttacaggcggggtttctcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctcgaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggattgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatttggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439991_PreS1_P-A Feature FT:CDS JF439991_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggcggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatctgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtctgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439992_PreS1_P-A Feature FT:CDS JF439992_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattcttccccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggcggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggctcttctggattatcaaggtatgttgcccgtttgtcccctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF439993_PreS1_P-A Feature FT:CDS JF439993_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate roc05f8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagggtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatttggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JF440020_PreS1_P-A Feature FT:CDS JF440020_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate MAU05C4). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccccagtgtcaacaattcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaaaacc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgtctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggactgggcctcagtccgtttctcatggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN182318_PreS1_P-A Feature FT:CDS JN182318_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggggccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
cctatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182319_PreS1_P-A Feature FT:CDS JN182319_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggtggtgttttggggtggagccctcag
gctcagggcatattggctacagtgctagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatccttaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatctcgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182320_PreS1_P-A Feature FT:CDS JN182320_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttagggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catttctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaaccctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182321_PreS1_P-A Feature FT:CDS JN182321_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacttccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182322_PreS1_P-A Feature FT:CDS JN182322_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182323_PreS1_P-A Feature FT:CDS JN182323_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaagggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccggggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccactgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182324_PreS1_P-A Feature FT:CDS JN182324_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaacgctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttgccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182325_PreS1_P-A Feature FT:CDS JN182325_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182326_PreS1_P-A Feature FT:CDS JN182326_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagggacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182327_PreS1_P-A Feature FT:CDS JN182327_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcaccagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccccacggaggtgttttggggtggggccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182328_PreS1_P-A Feature FT:CDS JN182328_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtactttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtaagttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182329_PreS1_P-A Feature FT:CDS JN182329_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182330_PreS1_P-A Feature FT:CDS JN182330_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacggctcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182331_PreS1_P-A Feature FT:CDS JN182331_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtccc
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtataaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182332_PreS1_P-A Feature FT:CDS JN182332_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaagcaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctgggttaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
atcgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182333_PreS1_P-A Feature FT:CDS JN182333_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Complete genome. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaatattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttccctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
atcgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN182334_PreS1_P-A Feature FT:CDS JN182334_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A. Non-functional genomic sequence. [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagccatcctcaggcaatgcagtggaattccacagcttttcaccaggctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacattcaaccctgttccaaacattgcctctcac
atctcgtcaacctcctcgaggactggggaccctgcgtcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggttttccttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcctctggattaccaaggtaagttgcccgtttgtcctctaattccaggatccacaaccaccagcacgggac
cctgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacttgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatc
taa
>gnl|hbvcds|JN604128_PreS1_P-A Feature FT:CDS JN604128_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-4481-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcacattggccaccgtgccagcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccgtacagtggaattccacagcttttcaccaagctctgcaagatc
ccagagtcaggggcctgtatctccctgctggtggctccagttcaggaacactcaaccctgttcccaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaacatggagaacatmacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcatggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccctttgttcagtggttcgyagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagactgtgcaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604136_PreS1_P-A Feature FT:CDS JN604136_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-5824-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaycctctgggattcyttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattgrccactgtgccaacagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcactgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggaa
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604145_PreS1_P-A Feature FT:CDS JN604145_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-2097-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagcccaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgtgttggggtggagccctcag
gctcagggcatattgaccacagtgccaacagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagccgactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604150_PreS1_P-A Feature FT:CDS JN604150_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-5814-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccaccgtgccagcagttcctcctcctgcctccgccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggcaatgcagtggaattccacagcttttcaccaagctctgmaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcaccgaacatggagaacatcacatcaggattcctaggacccctgct
cgkgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttccaggggtarcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaycarggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgttwccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatwcctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtattcatt
taa
>gnl|hbvcds|JN604155_PreS1_P-A Feature FT:CDS JN604155_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 480-0815-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaycckctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccgtmaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgtyttggggtggagccctcag
gctcarggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcaatggaattccacaactttccaccaagctctrcaagatc
ccagggtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
rttttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggrc
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
mttgggggccaagactgctcaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604156_PreS1_P-A Feature FT:CDS JN604156_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-5439-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccaccgtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atctcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcagggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacaycttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604157_PreS1_P-A Feature FT:CDS JN604157_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-8460-1). Partial genome (Contains: HBe, HBc, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggttaccaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcaattggaccctgcattcggagccaactcaaacaatccagactgggacttcaaccccatcaaggaccgctggccac
aagccaaccaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagttcctyctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaagggcctgtatttccctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgttgaacacggagaacatcacatcaggattcctaaaacccctgct
cgtgttacaggrggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattaccaaagtatgttgcccgtttgtcctctacttccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcggagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgtaaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604158_PreS1_P-A Feature FT:CDS JN604158_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-9282-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604160_PreS1_P-A Feature FT:CDS JN604160_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-1175-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604162_PreS1_P-A Feature FT:CDS JN604162_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-3509-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcgggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604163_PreS1_P-A Feature FT:CDS JN604163_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-4838-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggcggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcgggaaggcagcctactcc
catatctccacctctgagagacagtcatcctcaggccgtgcagtggaattccacagcttttcaccaaactctgcaagatc
ccagagccaggggcctgtgtcctcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggggtctcccgtgtgttttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctattaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604164_PreS1_P-A Feature FT:CDS JN604164_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-7898-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catttctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaacctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604165_PreS1_P-A Feature FT:CDS JN604165_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-8501-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaaytcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtgggagtgggagcattcgggcccgggttcacccctccacacggcggygttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctccygcctccaccaatcggcagtcgggrmggcagcctactcc
catctctccacctctaagagacagycatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttmttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggsccamccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaayttgtcctggttatcgctkgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttrttggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcagcaacaaccagyacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggayggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttyagttatatggatgatgtggt
attgggggccaartctgtgcarcatcgtgagtccstttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604167_PreS1_P-A Feature FT:CDS JN604167_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-9638-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaatcccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatgttgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaaattgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604169_PreS1_P-A Feature FT:CDS JN604169_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-9866-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcttcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagactgggacttcaaccccatcaaggaccactggccac
aagccaatcaggtaggagtgggagcattcggcccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggctacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcagggacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcggcgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggctcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattaccaaggtatgttgcccgtttgtcctctaattccaggatccacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604171_PreS1_P-A Feature FT:CDS JN604171_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-0079-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagccctcag
gctcagggcatattggccacagtgccagcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atatcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604172_PreS1_P-A Feature FT:CDS JN604172_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-0232-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggratcacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttyagctatatggatgatgtggt
attgggggccaagactgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604173_PreS1_P-A Feature FT:CDS JN604173_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-0370-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcatttgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604176_PreS1_P-A Feature FT:CDS JN604176_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-2959-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccccgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacygaagagtctagactcgtggtggacttctctca
attttctaggggggwcacccgagtgtcrtggcctaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggktatcgctkgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagytatatggatgatgtggt
wttgggggccaartctgtrcarcayctysagtcccttwmyacmgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604178_PreS1_P-A Feature FT:CDS JN604178_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-5662-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatccaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604179_PreS1_P-A Feature FT:CDS JN604179_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-6727-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggggtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcaaggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagggacagtcatcctcaggccatgcagtggaactccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaagacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggt
attgggggccaagtctgttcagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604180_PreS1_P-A Feature FT:CDS JN604180_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-6919-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctatattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604181_PreS1_P-A Feature FT:CDS JN604181_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-7570-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atatcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaatgccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctacgttaccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604183_PreS1_P-A Feature FT:CDS JN604183_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-7954-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggacccggcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccacgcagtggamytycaatgcctttcwccaagatctgcaagatc
ccagagtcaggggtytgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttctcgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
gttttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgaggccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604184_PreS1_P-A Feature FT:CDS JN604184_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-8107-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604185_PreS1_P-A Feature FT:CDS JN604185_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-9112-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctgattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604186_PreS1_P-A Feature FT:CDS JN604186_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-0588-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcgaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccctatcaaggacccctggccac
aagccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttttggggtggagycctcag
gctcagggcatattggccacagtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgctgtggaattccacagctttccaccaagctctgcaagatc
ccaragtcaggggcctgtactttcctgctggtggctccagttcaggaacactcaaccctgttccaaatattgcctctcac
atctcgtcaatctcctcgaggactggggaccctgcgaagaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
rttttctagggggatcacacgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttgttggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatccaaaacaamcagtacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaat
tgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
actgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604188_PreS1_P-A Feature FT:CDS JN604188_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-2496-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
akgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgtgttgggatggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaactccactgcctttcaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctargacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggakcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtgrttcgcagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagkccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604190_PreS1_P-A Feature FT:CDS JN604190_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-3516-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgtccccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgtgttggggtggaaccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctaggggagtcactcgtgtgtcttggccaaaattcgcagttcccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgcttgatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctatggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaggtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604191_PreS1_P-A Feature FT:CDS JN604191_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-4278-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604193_PreS1_P-A Feature FT:CDS JN604193_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-8520-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaaccccatcaaggaccactggccac
argccaaccaggtaggagtgggagcattcgggccagggttcactcccccacacggaggtgttctggggtggagccctcag
gctcagggcatattggccacagtaccagcagtgcctcctcctgcttccaccaatcggcagtcaggaaggcagcctactcc
catttctccacctctaagagacagtcatcctcaggccatgcaatggaattccacagctttccaccaagctctgcaagatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacactcaaccctgttccaactattgcctctcac
atatcgtcaatctcctcgaggattggggaccctgcgccgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaatgccacagagtctagactcgtggtggacttctctca
attttctaggggaatcacccgtgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattgggtcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcacgggac
cctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatttggt
actgggggccaggtctgcaccacatcttgagtccctgtacaccgctgttaccaattttcttttgtctttgggtatacatt
taa
>gnl|hbvcds|JN604194_PreS1_P-A Feature FT:CDS JN604194_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 479-9228-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggatcactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctyctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggactcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604197_PreS1_P-A Feature FT:CDS JN604197_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-9048-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggtcagtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggagcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctacttccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtatcgcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604200_PreS1_P-A Feature FT:CDS JN604200_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-8111-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaacctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604204_PreS1_P-A Feature FT:CDS JN604204_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 478-9847-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccaa
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604209_PreS1_P-A Feature FT:CDS JN604209_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 476-6354-8). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggttcacccctccacacggcggtgttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacgattcctcctcctgcctccaccamtcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgccttccaccaagctctgcaggatc
ccagagtcaggggcctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaatctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca
attttctagggggatcacccgartgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaargcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagttyactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagkccctttataccgctgtaaccaattttcttttgtctctgggtatacatt
taa
>gnl|hbvcds|JN604214_PreS1_P-A Feature FT:CDS JN604214_PreS1_P-A of [Viruses] Hepatitis B Virus genotype A (isolate 477-0581-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=1203 residues).
atgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccga
tcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggaccactggccag
cagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaattccactgcctttcaccaagctctgcaggatc
ccagagtcaggggtctgtattttcctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcac
atctcgtcaacctccgcgaggactggggaccctgtgacgaacatggagaacatcacatcaggattcctaggacccctgct
cgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcyagactcgtggtggacttctctca
attttctagggggatcacccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctgtcct
ccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatctt
cttattggttcttctggattatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagtacgggac
catgcaaaacctgcacgactcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaat
tgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggct
cagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatatggatgatgtggt
attgggggccaagtctgtacagcatcgtgagtccctttataccgctgttaccaattttcttttgtctctgggtatacatt
taa
>