HBVdb

Dataset for nucleotide sequence Genomes of genotype RF

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                       *  * ***  *              
cTCCACaACcTTCCACCAAaCTCTgCaAGAtCCCAGaGTgAGgGgCCTgTAttTcCCTGCTGGTGGCTCCAGTTCaGGAA
t  t-gcg-a--t--t---g----ttt---c-----g--c--a-ct--a--cc-t              a c   c cgg
     ---at  - t-   -    a--g  -  a a-  a a- --  t  -- -                         
      t  -              -              -        -                               
         g                                                                      

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       ** *   *  *     *           *        *          ** **  *  *     *  ***   
CAGTaAaCCCTGtTCcGAcTACTGcCTCtccCaTaTCGTCAATCTTcTCGAgGAtTGGGGACCCTGcgCcGAACATGGAG
t acg g     c  aa ac t  ta  aga tcc ta    c  cagt  a  c         taat   t      
  c c                       gt                 a   c                ga          
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *    **       **    *****     *       ** **       ** *    *     * *** *  *  *
AaCAtcaCATCAGGAtTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAgAATCCTCACAATACC
  cag    c   c    ca       t    ca          ta       c        a               
      t                                                                         
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            *    *  **  ****  *  ** **     *          *** * ** **  * ** ****  **
gCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAaCaaCCgtGTGTCtTGGCCAAAATTCGCAGTCCC
aa                              g           aggttc  ac     c         t        
                                              tac    g     g                    
                                                g    a                          
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * * **   * **  * **  *  * *   *     **   *** * **    *   *    ** *   * * * *  
cAAcCTCCAATCACTCACCAACCTCcTGTCCTCCAAcTTGTCCTGGtTATCGCTGGATGTGTCTGCGGCGTTTTATCATa
 t     g           tt gt       ag tc        c     t       a                  c
                                              a                                 
                                                                                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **    *  *  *      *****   ** *** *  *  *    *** *     * **      * *  ** * *  
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTAtCAAGGTATGTTGCCCGTTTGTCCTCT
       g                           a         g    t gc  g              g        
                                                                                
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *         * *  *        **  * **       ***        **             *      * **
AaTTCCAGGAtCaTCaACcACCAGCACgGGACCaTGCAgaACCTGCACgAcTcCTGCTCAAGGAACCTCTATGTaTCCCT
gc        a ta g  t  a  tgtc  ga c   cag       ta taa   t  g a c a        t     
c           c     a        a     t                 ct                           
            g     g                                                             
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  * *   * ** *  **         **** ******* ****** *      ***  *  * **     * *
CcTGTTGCTGTACaAAACCTtCGGAcGGAAAtTGCACcTGTATTCCCATCCCATCATCcTGGGCTTTCGcAAaATtCCTA
 a  c  t    tc      at   t     c     t                 g  t          g  g  a    
 t                                                        a          t          
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *     ** *  ** ********     * **  *   *    ** * *   *  *     *  ** * *****    
TGGGAGTGGGCCTCAGcCCGTTTCTCcTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCAC
             t  t         t          c     c                                 t
                          a                                                     
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  ***  **    **  * **  *  * *    ***                ** *  **      **          
TGTtTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAaCATCTTGAGTCCCTTTtTaCCgCTgT
   c       t  c   g t      c    tc       g  aa    g cg  c   ag      a g  t  a 
                           a                                                    
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   ***       * * ****    *   * *   *       **         ***  *          *  *   
TACCAATTTTCTTTTGTCTTTGGGTATACATTTaAACCCTaAcAAAACcAAaaGaTGGGGtTAcTCcCTtaAcTTcATGG
     c      gg     c           c g  ta cc t  g  a  gc t      t  tt ac t  t    
                                       a        t     g            g          
                                                g                    c          
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **    ** *         *       ** *     **          **             **        * ** 
GaTATgTaATTGGaaGTTggGGtaCtTTaCCaCAaGAaCAtATtgTACaaAAAaTCAAacAaTGTTTTaGaAAAcTtCCT
 c  ca c     gt c at  atgac g  g  gtct  c  cagcttc  gc t gggtc  c  cc g   t g  c
 t     g     tg       g  c     c   a c       ag  g     g   a g        c     c   
 g           c        c              g           t           t              a   
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       * *   * *  ***       * *      *    *        *  ** *     ** **    *  ** **
GTaAAtAGgCCTaTTGATTGGAAAGTaTGTCAaaGaATTGTGGGTCTTtTGGGcTTTGCtGCcCCtTTtACaCAATGTGG
a tc cc a  cg c        g  g  c  gc t  ctca  c  cc a  t  c  c  t  a  c  g        
  c        a              c        g        a  g     g        a  c     t        
                                   c        g        a                 c        
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ** **  *    **  * *   *     *             ** **     * *        **           
aTATCCTGCtTTaATGCCtTTaTATGCATGTATaCAAtCtAAgCAGGCTTTcACtTTCTCGCCAACTTACAAGGCCTTTC
t  c  a  cc gca    g     c     t  gg cc a  a     t  a  t   t   t   t  aatt  ct
c                                 c  a              g                         
g                                 t  g              c                         
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *  **       **       *        ** *         * *     **  *    *   *  * * *
TgtGTAAACAaTAtcTGAACCTTTACCCCGTTGCcCGGCAACGGcCaGGTCTgTGCCAAGTGTTTGCTGAcGCAACCCCC
 aaacc c  g  cac cc               ta        t t     c                 t         
 cc           t                             g c     t                           
                                                    a                           
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *** *                              *     *      **         **** *         
ACTGGcTGGGGCTTGGccATaGG-CCATCagCGCATGCGTGGAACCTTTgtGgCTCCTCTGCCGATCCATACTGCGGAAC
     a          ttg g      c gc   c    g         ca t    gt a           c       
     t           at t                  c         tc      a                      
                    c                            a                              
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *    **    *       *  *   **           *  *  * ** **        *             
TCCTAGCaGCTTGTTTTGCTCGCAGCcGGTCTGGaGCaAAacTtaTCGGgACtGAcAAcTCTGTtGTcCTcTCtCGgAAa
 g  g  c  c     c         ac  t   g  g cca cc   c  t  t  c  c  t  tg c  c  g
 t  t  t                             t  gg g      g        a  g  g     g  a   
       g                                          a                    a  t   
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *  * *  ** * *  *   **        *    ***    *  *       *            * *       
TAcACcTCcTTTCCATGGCTGCTaGGcTGTGCTGCCAACTGGATCCTgCGCGGGACGTCCTTTGTcTACGTCCCGTCGGC
  t   g ac           c  g   a             t   a  a  a        t        c  at 
        a                 t                                                   
        t                 a                                                     
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     * ** ** *  *  *  *   *                      *   *             *  *         
GCTGAATCCcGCGGACGACCCgTCTCGGGGcCGcTTGGGacTCTacCGTCCcCTTCTtcgtCTGCCGTTCCGgCCGACCA
a        t           t  c  c  t  tc    gact ct  c  t  c  ctac  atta at aa  ac  t
         a           c  g              t  g g      g     g t           tc   t   
                     a                 c    t              c            t       
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *                *  *  ** *     *  **           **         *   *     * ***   
CGGGGCGCACCTCTCTTTACGCGGtCTCCCCGTCTGTGCCTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTG
       a                       t        t  g  c     t                         
                               g                    g                         
                                                      c                         
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         **    ** **   *                                 *              *       
CACGTCGCATGGAgACCACCGTGAACGCCCaCCaggtctTGCCCAAGGTcTTacATAAGAGGACTCTTGGACTcTCaGCa
     ta     ca   g  a     a  tgtataaagc    t g cag  gt     c     a       tcttatg
                              c  gttca     a   a a                       gg g gt
                                  ccgt                                    a c   
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   *            *     *                 *              *    *                
ATGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTgTgTTTAAaGACTGGGAGGAGTTGGGGGAGGAGAtTAGgTT
        a    gga g   aag        g      t a  cgcga g     a  acca  ca t   tccc ac 
              tg     c t                 t     t              t         ggg     
                       c                                                c       
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                    * *      * *                     *           *              
AAaGgTCTTTGTAcTAGGAGGCTGTAGGCATAAATTGGTCTGttCACCAGCACCATGCAACTTTTTCAC---------CT
  t act a    t g                       g  cgt                     g agagcatgag  
    t g                                                                         
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                       *       *               *              ** * *    * **    
CTGCCTAATCATCT---CaTGTTCATGTCCtACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTgGGGCATG----
  c gggg------   tt- gg gaa t c                                     a aa    gata
                 --   a                                             r           
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                * *   **     *  *  *    *               *       
--------------------------------GACATTGACCCgTATAAAGAATTTGGAGCTtCTGTGGAGTTACTCTCt
gaacaactttgccatatggcctttttggctta     c  taat                 aa ctc      g     g
                                           a                 g  aa             a
                                           c                                    
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *       *  *  *               *       **       *   *     *  *     *  *   
TTTTTGCCTTCTGAcTTcTTTCCtTCtaTtCGaGATCTcCTcGAcACCGCCtCtGCTCTgTATCGGGAgGCCTTAGAGTC
         gac  t  t ac  ga ag aa g  c  t  a  t  t  tg a  ct a tca  tt tc    ag 
         a             a  c  c  t     a  t     a  aa c  g  c        a  g        
         c                g     c                    g                 a        
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *              ** ** **  *                 * **     *  *                *
TCCgGAaCATTGtTCACCTCACCATACaGCACTCAGGCAAGCtATTCTgTGtTGGGGtGAgtTgATGAaTcTgGCcACCT
ct t  g  c  ca gg    t     t  ca a        ag ct t  c     g  ac a    cct a  t  t 
      t        t           g            c  ag c        a            t       
                           c                    a                             
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***  *      *     *           *  *  *              ** *  *              *  *    
GGGTGGGaagTAATTTGGAAGAtCCAGCATCcAGgGAatTAGTAGTCAGcTATGTCAAtgtTAATATGGGCCTAAAaaTc
       tgta     ac c  c atatc  tc  cccga g  agat      cac c cg    tt  gt t
       c c               g  t        tga   t  t                              c  
         a                                                                      
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *     **** *     *              *                    *   *  *    *     * 
AGaCAAcTatTGTGGTTTCACATTTCcTGTCTtACTTTTGGaAGAGAAACtGTtcTtGAgTATTTGGTGTCTTTtGGAGT
  g   t cc a        tgc   t  c  c tg     g a c t tc  ca a  a  c     a  c  c     
      a g            c    a        c           c  g  at g           c           
                                   a           g  a  gg                         
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   ** *   *  *             **     * **   * ** ****     ***   *   *    *      * 
GTGGATTCGCACTCCTcCcGCtTAcAGACCACCAAATGCCCCTATCtTATCAACACTTCCGGAaACTACTGTTGTTAGAC
      c        caaac a  t      tat            c                g   tg    a     t
                 tt  c                                                          
                                                                                
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                 **     *            *   *         *            
------GA------c------GAG------GCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGgTCTCAA
      a  g g ca       gtg     -    a     c     c          a              a      
                                                                                
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*   *            *       **       *    **      *  *       *  *  *  **        *  
TCGCCGCGTCGCAGAAGATCTCAATCTCGGGAATCtCAATGTTAGTATcCCTTGGACtCATAAGGTGGGAAAcTTTACtG
  a         c        gc     ca ctc c        a    c     a  c        g  t  c  
                     a         g                 g     g                    
                                                                                
                                                                                

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      * *           **       *   *     *        *    ** **     *              * 
GGCTTTATTCTTCTACtGTACCTgTCTTTAAtCCTgAgTGGcAAACtCCcTCtTTTCCTcAcATtCATTTaCAggAgGAc
 t  g  c  cg ct gacc   tg   c  ct gc t   a   ta  ta c     aa t  a  c  gagcc aa t
 a        a        t   a           a a        c  a        cg a           t      
 c                                   c        g              g           a      
                                                                                

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *          **       *  **  * **           * **     *     *     *  * *****  *  *
ATTaTtaAtAgaTGTcAACAaTaTGTgGGcCCtCTtACAGTtAATGAaAAaAGgAGatTaaAATTaATTATGCCTGCTAG
  cg cgca ag  cg g  g tc   g  at c  ta c  c  g ccc ac gc gc cc gg c       
   c ac c      a             t  c  g     a        g           g     a         
                             a  g        g                                      
                                                                                

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** *  **          *  **     *     *  * **  * **     * *  **           **   * **
GTTcTATCCtAAccTTACcAAATATTTgCCcTTgGAcAAaGGcATtAAACCtTATTATCCtGAacATgcAGTTAATCATT
a  t tc  a ctgcc  t  g  c  a  ac a   g   c     g  c     a  gt cct           
         c  gtg   a           t                  a        c  ta ga            
            aaa                                  c        g                   
                                                                                

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **     *    *  *** *  *        ** *        *  * **       *      *           * 
ACTTCcAaACtAGgCAtTATTTACAtACTCTgTGGAAgGCtGGcATtcTATATAAGAGAGAAaCtACACgcAGCGCCTCA
    ta gg cc a  c      c  ct a   c at g  tg at       a  g tgt at c at  t  t   
          g                    t        a  g                  c  t  a     a   
                                                                                
                                                                                

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  **        *     * ** *       **                                           
TTTTGTGGGTCACCATATTCTTGGGAACAAGAgCTACA---------------GCATGGga-------ggttggtcttcc
  c ac        t   a           a ta   g               t   ----       ------------
                                                                       ccta a  a
                                                                            c   
                                                                            g   

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                        *  *    
aaacctcgacaaGGC---------------------------------AtggggacgAATCTTTCtgttccCAATCCtCT
------------      tttcttggacggtccctctcgaatggggga -------a  c ag  caccaga  c  c  
        ga                                           a a      c     a           
        c                                                                       
                                                                                

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   *  *       ** **    *  *      *    *  *   *       *  ** ****     *         
GGGATTCTTTCCCGAtCAcCAGTTGGAcCCtGCgTTCggAGCcAACtCaaacAATCCAGATTGGGACtTCAAcCCcaACA
      tc c    gc  t        t  a  c  taa   a  ta cgca  c  c        tc    t  gcta 
                              g  a                g   a                    a    
                                 t                                              
                                                                                

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * *               *   *    **        *             **    *         *  * 
AGGAtcacTGGCCaGAgGCaAAtcAGGTaGGAGcgGGAGCATTCGGGCcaGGgTTCACcCCaCCaCAcGGcGGtCTtTTG
 a  cact     gccc  cc ca    g  g tt   t c at  a tg  tc    t  t  g  t  aaacg gc  
      ga      a a                 a     g           a        c  c     g  a      
                t                                            g  t               
                                                                                

      3210      3220      3230      3240      3250      3260      3270      3280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**          *     *                                                      *      
GGGTGGAGCCCTCAGGCTCAGGGCATAtTgacAA---------------------CagTGCCAGcAgctCCtCCTCCTGC
           g  at c  a   ccgc acacg                     att a   at aaa  g        
           a               a c   t                      c          tg  a        
                                                        g                       
                                                                                

      3290      3300      3310      3320      3330      3340      3350      3360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *                 * ** **          **  *             ** *            
CTCcACCAATCGgCAGTCAGGAAGaCAGCCTACtCCcaTcTCTCCACCTcTaAGAgACAgTCATCCTCAGGCCATGCAGT
ag tg       c   atg  gc ga a  c  c  gc ga a  t  at gc gac  cc        a   gca    
t  a        t   g             a     at a                  g                   
                              g        t                                        
                                                                                

    
....
* * 
GGAA
   c
    
    
    
© 1998-2022Legal notice