HBVdb

Dataset for nucleotide sequence Genomes of genotype RF

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
           *                    *                      *  * ***  *              
cTCCACaACcTTCCACCAAaCTCTgCaAGAtCCCAGaGTgAGgGGCCTgTAtTTtCCTGCTGGTGGCTCCAGTTCaGGAA
t  t gcgaa  t tt  gg ct tttg  c  g ag  c aa ct  aa cc c              a c   c cgg
   a  t  t              a        a     a        t                               
         g                                      c                               

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       ** *  **  *     *           *       **     *    ** **  *  *     *  ***   
CAGTAAACCCTGTTCCGAcTACTGcCTCtCcCaTaTCGTCAATCTTCTCGAgGAcTGGGGACCCTGCaCcGAACATGGAG
t acg g     c  aa actt  ta  aga tcc ta    c  caat  a  t         tgat   t      
  c c                       g                  g   c                ga          
                                                                    t           

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *    **   **  **    *****     *  *    *****    *  ** *    **    ***** *  *  *
AaCAtcACATCAGGATTCCTAGGACCCCTgCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAgAATCCTCACAATACC
  cag    c      cac      t    ca          ta       c        a               
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *    **    *  **  ****  ** ** **  * **          ***** ** **  * ** ****  **
gCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAaCacCCgtGTGTCtTGGCCAAAATTCGCAGTCCC
aa                              g           aggata aac     c           t        
                                              ttc    g     g                    
                                                g    a                          

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** * ***  * **  * **  *  ***   *     **   *** * **    **  *    ****   * * * ** 
CAACCTCCAATCACTCACCAACCTCcTGTCCTCCAAcTTGTCCTGGtTATCGcTGGATGTGTCTGCGGCGTTTTATCATa
a  t                  gt       ag tc        c     t       a                  c
                                              a                                 
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **    * **  *      *****   ** *** *  *  * * **** *     ****   *  * *  ** * *  
TTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGAcTAtCAAGGTATGTTGCCCGTTTGTCCTCT
       g                           a         g    t gc gg              g        
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    *         * *  *        **  * **       ****       **           * *     ** **
AaTTCCAGGAtCaTCaACcACCAGCACgGGACCaTGCAgaACCTGCACGAcTcCTGCTCAAGGAACCTCTATGTtTCCCT
gc        a ta g  t  a ctgta  ga c   cag       ta taa   ta g aac a        a     
            c     a        c   t t                 c                            
            g                                                                   

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  * *   * ** *  **         **** ************** *  *   **** *  * **    ** *
CcTGTTGCTGTACaAAACCTTCGGAcGGAAAcTGCACcTGTATTCCCATCCCATCATCcTGGGCTTTCGcAAaATTCCTA
 t  c  t    tc      at   t     t     t                 g  t          g  g  a    
 a                                                        a          t          
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****    ** ** ** ********  *  * ** **   *    ** * *   *  ***   *  ** * ***** *  
TGGGAGTGGGCCTCAGcCCGTTTCTCcTGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCAC
             t  t         t          c     c                    cc             t
                          a                                                     
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  ***  **  * **  * **  *  * *    ****               ** *  **      **       *  
TGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCTGTACAaCATCTTGAGTCCCTTTtTACCgCTgT
   c        c   g t      c    tc       g  aa     tcg  c   ag      a g  t  
                           a                                            t       
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *   ***       * * ****    *   * *   *     * **        ****  *          ** *   
TACCAATTTTCTTTTGTCTTTGGGTATACATTTaAACCCtaAcAAAACcAAaaGaTGGGGtTAcTCccTtaAcTTcATGG
     c      gg     c    c      c g  ta ccct  g  a  gc t      t  tt ac t  t    
                                       a        t     g            g          
                                                g                    c          

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **    ** *         *       ** *     **          **             **    *   * ** 
GaTATgTaATTGGaaGTTggGGtaCtTTaCCaCAaGAaCAtATtgTACaaAAAaTCAAacAaTGTTTTaGaAAAcTgCCT
 c  cagc     gt c at  atgac g  g  gact  c  cagcttc  gc t gggtc  c  cc g   t t  c
 t     g     t        g  c     t   t c       agg g   t g   a g        c     c   
 g           c        c              g           t           t              a   

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       * *   * *  ***    *  * *     **    *   *    ** ** *     ** ** ** *  ** **
GTaAAtAGgCCTATTGATTGGAAAGTaTGTCAaaGaATTGTGGGTCTttTGGGcTTTGCtGCcCCtTTtACaCAATGTGG
a tc cc a  cg c        g   c  gc t  ctca  c  cc a  t  c tc  t  a  c  g  g     
  c        a                     g        g  g     g        a  c     t        
                                   c        a  a     a                 c        

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  ** **  *    **  * *   *  *  *             ** **     * **       **           
tTATCCTGCcTTaATGCCtTTaTATGCATGTATaCAAtCtAAgCAGGCTTTcACTTTcTCGCCAACTTACAAGGCCTTTC
c  c  a  tc gca    g         t  gg c ga  a     t  a  t   ttc ta  t  aatt  ct
a                          c  c  a              g                         
g                                 t  g              c                         

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*       *  **       **       *        ** *         * *     **  *    *   *  * * *
TgTGTAAACAATAtcTGAACCTTTACCCCGTTGCcCGGCAACGGtCaGGTCTcTGCCAAGTGTTTGCTGAcGCAACCCCC
 aaacc    g  cac cc               ta        c t   g g                 t         
 cc           t                             g c     t                           
                                              g     a                           

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *** *          *         *     * **     *      **         **** *       *  
ACTGGcTGGGGCTTGGccATaGGCCATCagCGCATGCGTGGAACCTTTgtGGCTCCTCTGCCGATCCATACTGCGGAACT
     a          ttg g     c gc   c    g         ca t    gt a           c        
     t           at t                 c         tc      a                       
                    c                           a                               

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *    **    *       * **   **           *  *  * ** **        *             *
CCTAGCaGCTTGTTTTGCTCGCAGCcGGTCTGGaGCaAAacTtaTCGGgACtGAcAAcTCTGTtGTcCTcTCtCGgAAAT
gt g  c  c     c         a   t   g  gccca cc   c  t  t  c  c  t  tg c  c  g 
t  t  t                             t  gg g      g        a  g  g     g  t    
      g                                   a      a                    a  a    

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  * *  ** ***  *   **  *     *    ***    *  *  *  * **          ** *  *     
AcACcTCcTTTCCATGGCTGCTaGGcTGTGCTGCCAACTGGATCCTgCGCGGGACGTCCTTTGTcTACGTCCCGTCGGCG
 t   g ac           c    a             tt    a        t        c  a  a
       a              g                  a                                  
       t                                                                      

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * * ** ** *  *  *  *   *    *                 *   *             *  *          
CTGAATCCcGCGGACGACCCgTCTCGGGGcCGcTTGGGacTCTacCGTCCcCTTCTtcgtCTGCCGTTCCGgCCGACCAC
        t        t  t  c  c  t  tc    gact ct  c  t  ca ctact atta at aa  ac tt 
        a           c  g              t  g g      g  g  g t           tc   t    
        g           a                 c    t              c            t        

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***                *  *  ** **    *  **       *  ***         *  **     * ***    
GGGGCGCACCTCTCTTTACGCGGtCTCCCCGTCTGTGCCTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGC
      a                       g   t    t  g        t  a                       
                              t                    g                          
                                                     c                          

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       ****   ** ** ***                                 *    *         *        
ACGTCGCATGGAgACCACCGTGAACGCCCACcaggTcTTGCCCAAGGTCTTaCATAAGAGGACTCTTGGACTCTCaGCaA
    ta     ca   g  a     a  tgtataaagc    a g aag  gt     c             tcttatgc
                             c  gttca         c a                       gg gt t 
                                 cc t                                    a c    

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *   *            *     *          *      *         *   **    *   * *           
TGTCAACGACCGACCTTGAGGCATACTTCAAAGACTGTtTGTTTAAaGACTGGGAGGAGTTGGGGGAGGAGAtTAGgTTA
       a    gtg g   cag        g      g a  cgcga g     a  acca  ca t   gcc  ac  
             g      a t                 t     t              t         tgg      
                      c                                                c        

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                   * **     * *                     *          **               
AaGgTCTTTGTAcTAGGAGGCTGTAGGCATAAATTGGTCTGttCACCAGCACCATGCAACTTTTTCAC---------CTC
 t act      t g                       g  cgt     t      t        g agagcatgag   
 w t g                                                                          
   r                                                                            

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *                *   * * *   *  *        *    * * * *   **** *  * * **        
TGCCTAATCATCTCaTGTTCATGTCCTACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTgGGGCATG--------
 c gg g------tt- gg gaa   c                                      a    gatagaac
             --   a                                                           
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                            * * * **     *  ** *  * **              *  *      * 
----------------------------GACATtGACCCtTATAAAGAATTTGGAGCTtCtGTGGAGTTACTCTCtTTTT
aactttgccatatggcctttttggctta     c  taag                 aa ctc          g    
                                       a                 g  a              a    
                                       c                                        

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **       ** *  *               *  * *  ** *     **  *     *  *     *  *       
TGCCTTCTGAcTTCTTTCCtTCtaTtCGaGATCTcCTcGAcACCGCCtCaGCTCTgTATCGGGAgGCCTTAGAGTCTCCg
     gac  t  t ac  gg ag aa g  c   a  t  t  tg t  ct a tca  tt tc    a  ct t
     a             a  c  c  t      t     a  aa c   c        a  g            
     c                g     c                    g                 a            

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *      *       ** ** **  *  *              * **     *  *           *    **** 
GAaCATTGtTCACCTCACCATACaGCACTCAGGCAAGCtATTCTgTGtTGGGGtGAgtTgATGAaTcTgGCcACCTGGGT
  g  c  ca tg    t  c  t  ca  a    aag ct t  c     g  ac a   tcct a  t  t     
           g           g            c  ag c        a            t           
                       c                    a                                 

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      *  *  *           *  *  *              ****  *              * **       *
GGGaagTAATTTGGAAGAtCCAGCATCcAGgGAatTAGTAGTCAGtTATGTCAAtgtTAATATGGGCCTAAAaaTcAGaC
   tgta     ac c  c atatc  tc  ccaga g  agac      cac c cg    tt g  gt t  g 
   c c               g  t        t c   t  t                              c      
     a                                                                          

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *     **** *     *            * *           *        *   *  *    *     * * **
AAcTatTGTGGTTTCACATTTCcTGTCTtACTTTTGGAAGAGAAACtGTtcTtGAgTATTTGGTgTCTTTtGGAGTGTGG
  t cc a        tgc   t  c  c tg     g   c t  g  ca a  a  c     a  c  c         
  a g            c    a     g  c           g  c  at g           c  a            
                               a           c  a  gg                             

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *   *  *        *    **    ** **** * ** ****     ***   *   *    *      *     
ATTCGCACTCCTcCcGCtTAcAGACCACCAAATGCCCCTATCtTATCAACACTTCCGGAaACTACTGTTGTTAGAC----
  c        caaac a  t      tat            c                g   tg a  a     t    
             tt  c                                                              
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                             **     *            **  * **   *  *          ***  *
--GA------c------GAG------GCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTCGCAGACGAAGgTCTCAATCGC
  a cgggaca        t           a     c     c          a           cc a        a 
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * *        * **    **       *    ** *    * ** *** * ** *  ** **       **  *   
CGCGTCGCAGAAGATCTCAATCTCGGGAATCtCAATGTTAGTATcCCTTGGACTCATAAGGTGGGaAAcTTTACtGGgCT
        c        ac    aca gtc c        a   t  c     a  c        g  t  c   t  
                           c                a  g     g                     a  
                                                                             c  

      2570      2580      2590      2600      2610      2620      2630      2640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * *           **       *   *     **       *    ** **     * *            *  *  
TTATTCTTCTACTGTACCTGTCTTTAAtCCTgAgTGGcAAACtCCcTCtTTTCCTaAcATtCATTTaCAggAgGAcATTA
 c  cg ct gacc   tgt  c  ct  c t   a   ta  ta c     cc t  a  c  gagcc aa  cg
    a     a  t   a           a a        c  a        ag a           t         c
            c                    c        g              g           a          

      2650      2660      2670      2680      2690      2700      2710      2720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        **       *  **  * **           * **     *     *     *  * *****  *  * ** 
TtaAtAgaTGTcAACAaTtTGTgGGcCCtCTtACAGTtAATGAaAAaAGgAGatTaaAATTaATtATGCCTGCTAGGTTc
 cgca ag  cg g  g    g  at c  ta c  c  g  gc ac gc gc cc gg c       a  t
 ac c      a             t  g  g     a        c           g     a           
                            c        g                                          

      2730      2740      2750      2760      2770      2780      2790      2800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  **          *  **     *    ** ** **  * **     * *  **           **   * *** **
TATCCtAAccTTACcAAATATTTgCCcTTgGAcAAaGGcATtAAACCtTATTATCCtGAacAtgcAGTTAATCATTACTT
 tc  a ctggc  t  g  cc a  ac a  t  g   c     g  c     a  gt cct            t  
     c  gtc   a        t  t            a     a        g  ta ga                
        aaa                                  c        c                       

      2810      2820      2830      2840      2850      2860      2870      2880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *    *  *** *  * *   *  ** *        *  * **       *      *           *    *
CcAAACtAGgCAtTATTTACAtACTCTgTGGAAGGCtGGcATtcTATATAAGAGAGAAaCtACACgcAGCGCCTCATTTT
ta gg cc a  c      c  ct   c a  g  tg at       a  g tgt at c at  t  t     c 
      g                           a  g                  c  t  a     a       
                                    c                                           

      2890      2900      2910      2920      2930      2940      2950      2960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **  *    **    ** ** *       **                                               
GTGGGTCACCATATTCTTGGGAACAAGAgCTACA---------------GCATGGga-------ggttggtcttccaaac
ac        t   a c        ca ta   g               t   ----ctttctt----------------
                                                                  acc a c  a c  
                                                                        a       

      2970      2980      2990      3000      3010      3020      3030      3040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                  *           * 
ctcgaca----------aGGC---------------------------------AtggggacgAATCTTTCtgttccCAA
-------          -t -   tttcttggacggtccctctcgaatggggga--------a  c ag  caccaga  
   tga           g                                         a a            a     
    cg                                                                          

      3050      3060      3070      3080      3090      3100      3110      3120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *     *   *  *       ** **    *  *      *    *  **  *       *  ** ****     *   
TCCTCTGGGATTCTTTCCCGAtCAcCAGTTGGAcCCtGCgTTCgGAGCcAACtCaaacAATCCAGATTGGGACTTCAAcC
c  c  a     tc c    gc  t        t  a  c   aa   a  ta cgca  c  c         c    t 
                     a              g  a              t g   a                   
                                       t                                        

      3130      3140      3150      3160      3170      3180      3190      3200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
              * *               *   *    **        *    *     *  **    *   *    
CCAACAAGGAtcacTGGCCAGAgGCaAAtcAGGTAGGAGcgGGAGCATTCGGGCcaGGgTTCACcCCaCCaCACGGcGGt
 gcta  a  cact     gccc  cc ca    g  g tt   t c at  a tg  tc    t  t  g  t  aaac
             a      a a                       t     t     a        c  c     g  a
                                              g                    g  t         

      3210      3220      3230      3240      3250      3260      3270      3280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  * **          *     *   *                                              *  **
CTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATAtTgacAA---------------------CagTGCCAGcAgctCCtCC
g gc      c   t  g  a  c  a   ccgc acacg                     act     at aaa  g  
                 a            g  a c   c                      t          tg  a  
                                                              g                 

      3290      3300      3310      3320      3330      3340      3350      3360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                 *                 * ** **          **  *          ** ** *      
TCCTGCcTCcACCAATCGgCAGTCAGGAAGaCAGCCTACtCCcaTcTCTCCACCTcTaAGAgACAgTCATCCTCAGGCCA
      tg tg       c   a g  gc g  a  c  c  gc ga a     at gc gac  cc  c     a   g
      a  a        t                 a     at a              t   g             
                                    g        t                                  

      3370
....:....|
      *** 
TGCAGTGGAA
ca       c
          
          
© 1998-2020Legal notice