HBVdb

Dataset for nucleotide sequence Genomes of genotype RF

[Download (right click)] [Alignment] [Repertoires]

1191 sequence(s)

>gnl|hbvnuc|EU939668_FT00000_P-RF-CB Feature FT:source EU939668_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C182). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagcacgggaccttgcaagacatgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaaatctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgtttccgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgcctatttacaaggcctttc
tatgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactgtaccgtccccttcttcgtctgccgtaccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacctgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagccattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaactagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcctgcttatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggtattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactatgcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagcgggatcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctcaccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562314_FT00000_P-RF-CB Feature FT:source FJ562314_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I206). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtggggcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttctgctgccgttccagccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctaccgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgagcatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ205379_FT00000_P-RF-DE Feature FT:source GQ205379_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1234). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cggtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccagcttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaagacgaaaagatggggttattctctacacttcatgg
ggtatgtcattggttgttggggatcattaccacaggagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaaacaggcttttactttctcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcctgggtctctgtcgtcctctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacatcttgcccaagctcttacataagaggactcttggactctccacaa
tgtcaacgaccgagcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcttaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgtacgagatctgctagacaccg
ccgcagctctatatcgggatgcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttgggagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagaagacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactcatacggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaacttttcctaatatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaacgctaccaaatatttacccttagataagggtattaaaccttactatccagaacagctagtt
aatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagactatcatcctcaggccatgcagtggac
>gnl|hbvnuc|AP011105_FT00000_P-RF-CB Feature FT:source AP011105_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttctgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaagcgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccgcaagatcatattgtagaaaagatcaagcattgttttcgaaaacttcct
gttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttgggctttgctgccccttttactcagtgtgg
gtatccagccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttt
taagcaaacaatatctgaacctttaccccgttgcccggcaacggcctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagttgtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggggtgtggattcgcacccctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcctgacatacatttgcg
ggaggacattattaacaaatgtcaacaatatgtaggccctcttacagtcaatgagaaaagaagattatccttaattatgc
cggctaggttttatcctaatataaccaaatatttgcccttagataaaggcattaaaccttattatcctaaccatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagagactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgaacatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcgttcgggc
cagggttcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcatattgacaccagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF440004_FT00000_P-RF-DE Feature FT:source JF440004_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN52). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgagcatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
catgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccctgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaatcgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcgcctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgaagagcatgagctc
tccggaagggcgaatcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagctacttgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatccta
tcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatcttgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccacttacagtgaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774489_FT00000_P-RF-DC Feature FT:source KC774489_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1079). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtacttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgaatactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaactagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattttatataagagagaaactacacgaag
cgcctcattttgtgggtcaccctattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctacgagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB194949_FT00000_P-RF-AE Feature FT:source AB194949_FT00000_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate CMR151). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgcttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggtcattacctcaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtacgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcccggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcaccatacggcactcaggcaagccactcta
tgctggggggagttaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgagtatttggtctcttttggagtgtggattcgcactcccccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttcctaagattca
tttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaacagcaccaaatatttgccactagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttcgtcaccaaaacctcgc
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggactacaaccccatcaaagaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacggtgcca
gcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacctctaagagacagtca
tccgcaggccgtgcagtggaa
>gnl|hbvnuc|AF297620_FT00000_P-RF-DA Feature FT:source AF297620_FT00000_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate 57). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttcttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcatgactactgctcaaggaacctctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcctgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttagccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcatttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgttagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttgcaagatccggcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcattcgcaaaggcatggggcagaatctt
tccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacaacaaatccagattg
ggacttcaatcccaacaaggaccactggccagaagccaacaaggtaggagttggagcatttcgggctggtttcaccccac
cgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctcc
accaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH685719_FT00000_P-RF-DE Feature FT:source MH685719_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate E0-055). Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaacctttggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaagagatggggttattctcttcatttcatgg
gttatgtcattggatgttggggatcattgccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttgatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaccatactcgggactgacaactctgtcgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactttatcgtccccttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttccgacttctttccttccgtacgggatctcctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagccattctt
tgctggggggacctaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaaaacattatcgaaaaatgtgaacagtttgtaggccccctcacagtcaatgagaaaagaaggttaaaattgattatgc
ccgctaggttttatcccaattttacaaaatatttgcccttggacaagggtattaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctctggaaggcgggcatcttatataaaagagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccagcaatcctctgggattttttcccgaccaccagttggatccagccttcagagcaaacaccag
aaatccagattgggacctcaatcccaacaaggacacctggccagacgccaacaaggaaggaactggagcattcgggccgg
ggttcaccccacctcacggaggccttttggggtggagcccgcaggctcagggcataatacaaaccttgccagcaaatccg
cctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|EU939629_FT00000_P-RF-BC Feature FT:source EU939629_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C95). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaccatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcatttccatggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccccaggaacctgcccaaggtcttgcataagaggactcttggactgtcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaactaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcaggcaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtattccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcc
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ787480_FT00000_P-RF-CB Feature FT:source FJ787480_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S425-16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggctttcactatttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacgtgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagctttcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ904417_FT00000_P-RF-DE Feature FT:source FJ904417_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A66b). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcactttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgg
gttatgtcattggctgttggggatcattgccgcaagatcatatcctacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcccattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatacagcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggactgacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgttctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgtctctagctacctgggtgggagcaaatttagaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcactttcggaagagata
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatctta
tcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctagcagacgaag
gtstcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
tcaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaaccaatgagaaaagaaggttgcaattgattatgc
ctgctaggttttatcctaagcataccaaatatctgcccttggacaagggtatcaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggatttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagcgggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttcaaccaatcgccagtccgga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|AB933279_FT00000_P-RF-AG Feature FT:source AB933279_FT00000_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2008). Complete genome. [Hepadnaviridae] (length=3248 residues).
ttccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagagaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatattcatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700538_FT00000_P-RF-DE Feature FT:source HQ700538_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D_KI215p_2004). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccct
gttcataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcacaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
ccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagacctaatgactctagctacctgggtgggtactaatttagaagatccagcatctagggacctagtagtcag
ttatgtcaacactmatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcctaatatacatttaca
ccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggttgaaattgatcatgc
ctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
cgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MZ097724_FT00000_P-RF-DE Feature FT:source MZ097724_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FR_HBV_116). Complete genome. [Riboviria] (length=3182 residues).
ctccacaacctttcatcaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattgggggccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcctcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaattttatgg
gttatgtcattggaagttatgggtcattgccacaagaacacatcatacaaaaaatcaaagacttgtttcggaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgctgcaccttttacccaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctacagtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgaacactgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggcgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcgggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttctgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ377626_FT00000_P-RF-CB Feature FT:source GQ377626_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J225). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcagtgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactctgttgtgctctcccgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctatcgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagrtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaatgactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtgtgttcactagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttctatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttacaaacctcgaaaaggc
atgggatcaaatctttctgtcccaaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcatttgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggaagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598675_FT00000_P-RF-CB Feature FT:source KJ598675_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SHB3B2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtattgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
atatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgtcttacttttggaagagcaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggacctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgtccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KM606751_FT00000_P-RF-DE Feature FT:source KM606751_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Cuba64). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggtctttatttccctgctgggtgctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactgacaaaacaaagagatggggttattccttacattttatgg
gttatgtcattggatgttggggatcattgccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccctgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtccccttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattacatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctctgccctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtacaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcaaacgaag
gtctcaatcgccacgtcgcagagaatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaaa
cccagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaaggttaaaattgattatgc
ctgctaggttttatcctaattttaccaaatatttacccttggacaagggcattaaaccgtattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctcaaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX357634_FT00000_P-RF-DE Feature FT:source KX357634_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate AA33ETH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcaggaa
cagtaagccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacaccaacaaaaccaagagatggggttattctctacatttcatgg
gttatgtcataggatgttggggatcattgccacaagatcatatcagactcaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacatcctcgggactgacaactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggttcgagctcttctagataccg
cctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaggacattctcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgaaaaaagaaggttgaaattgattatgc
ctgctaggttttatccaaattttaccaaatatttgcccttggacaagggtattaaaccgtattatccagaacagctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatccaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctgagagacactcatcctcaggcctggaagtggaa
>gnl|hbvnuc|MN650075_FT00000_P-RF-DC Feature FT:source MN650075_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate KRN4457). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttagaaaactaccg
gttaataggcctattgattggaaagtctgtcaacgaattgtgggtcttttaggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tctacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaactttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtccaaacctcgacaaggc
atggggacgaatctctctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683619_FT00000_P-RF-DC Feature FT:source MN683619_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ196). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgaggccgtttgggtctctaccgtcctcttcttcatctgccgttccggccacccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccctctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EF103282_FT00000_P-RF-AD Feature FT:source EF103282_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran103). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtcagaggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccgaccattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctttcaattttctagggggatccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactccctaaattttatgg
gttatgtaattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttccg
gtcaatcgacctatagattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
gtaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagccatcctt
tgctggggggagctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagatcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaga
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtgaaa
>gnl|hbvnuc|FJ692536_FT00000_P-RF-DE Feature FT:source FJ692536_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate D4_50077). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaaatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaggatcacattatacacaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtctgctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacatactcgggactgacaactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagrtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtaagagatcttctagataccg
cctcagctctgtatcgggatgccttagartctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttrgaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccggaatctcaatgttagtatcccttggacccataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatctaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccgcttacagtcaatgaaaaaagaaggttgaaattgattatgc
ctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cgacagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707470_FT00000_P-RF-GA Feature FT:source JQ707470_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C34). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattccgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagtt
atataagaggactcttggactgtttggtatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagt
gggaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctgtat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcaaatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN683661_FT00000_P-RF-DC Feature FT:source MN683661_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ63). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacacaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683685_FT00000_P-RF-DC Feature FT:source MN683685_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ114). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683725_FT00000_P-RF-DC Feature FT:source MN683725_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZDP5). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gatatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtaggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggatcctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaccattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccaccatccagggaattagtagttgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
caggtttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattgaccacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470846_FT00000_P-RF-DC Feature FT:source KY470846_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-118). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttcctccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaacacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaaacacctctatgtatccct
cctgttgctgtacaaaaccttcggtcggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatagaattggaagttggggtactttaccacaggaccatattgtacacaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctgttggttggaaagtatgtcaaagaattgtgggtcttttgggctttgttgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcacctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctattcgcgatctcctcgacaccg
ccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagatattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaactagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtaggccctcttactgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttggacaagggcattaaaccgtattatcctgaacatgccgtt
aatcattacttccaaactaggccttatttacatactctgtggaaggctggcattctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagtgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtcgagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctca
ggccgtacagtggaa
>gnl|hbvnuc|MG893555_FT00000_P-RF-CB Feature FT:source MG893555_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SD14022). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaaaagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcactggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacactgttcgcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaactttaccaagtatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggattactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagcgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN650087_FT00000_P-RF-DC Feature FT:source MN650087_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate KRN7805). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaagactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcagacaaaaaatcaaagattgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaccaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatggaccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagctggtctggagcaaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgcactgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactctggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaacaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY817513_FT00000_P-RF-DC Feature FT:source AY817513_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-L66). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagttcc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaacctttggacagaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaactaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatcgacctgttgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtacacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcacagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctatgtactatgaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatacgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcgtctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacatcagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG893554_FT00000_P-RF-CB Feature FT:source MG893554_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SD14021). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaaaagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcactggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcgcctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacaacatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagagacaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagcgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534637_FT00000_P-RF-BC Feature FT:source MK534637_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D459). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagagctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatataattggaggttggggcgccttaccccagaagcatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
taaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccgtaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaccctgcccaaggtcttacataagaggactattggactttcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaaccccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctgtctgtccccaatcctctgggatttcttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatattcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939620_FT00000_P-RF-CB Feature FT:source EU939620_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate B140). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacagtcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatatgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccattatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatag
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcagcgaattgtgggtctgttaggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtattcaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaggtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggaccctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtttcggggccgtttgggtctctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctatccttctgttcgagatcttctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgtacacctcatcatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaagcagtagtcag
ctatgtcaacgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaca
cggttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatataggccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtcagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggcaggacgccaacaaggtgggagtgggagcattcgggc
tagggttaacccctccccatgggggactgttggggtggagccctcaggctcagggcctacttacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatacggtggaa
>gnl|hbvnuc|KC774414_FT00000_P-RF-BC Feature FT:source KC774414_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate bxa2061). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggaacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccatctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcccactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaaaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaattcgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggacaccatattcttgggaacaagatctacagcatgggaggttggtcctccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacatgggggactgttggggtggagccctcaggctctgggcctactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF192838_FT00000_P-RF-DE Feature FT:source KF192838_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP43). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaacctgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatcttctagataccg
ctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttgcccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtgttttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ377595_FT00000_P-RF-BC Feature FT:source GQ377595_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J155). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccacttttcttttgtctttgggtatacatttaaatcctcataaaacaaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggcaccttgccacaagaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcmtttc
tgtgyaaacartatctgaacctttaccccgttgcycggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccgaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccctagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagggagtcaacacgtag
cgcctcattctgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctgagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963863_FT00000_P-RF-CB Feature FT:source KU963863_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683691_FT00000_P-RF-DC Feature FT:source MN683691_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ105). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggctactctctaaatttcatgg
gctatgtcattgggtgttatgggaccttaccacaatcacacatcatacaaaaaatcaagcattgttttcgaaaactccct
gttaacagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtatacaatccaagcaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaagcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctcctcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774435_FT00000_P-RF-DC Feature FT:source KC774435_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1006). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtgaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaccatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagccaagcaggctttcactttctcgctaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggcccgcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964305_FT00000_P-RF-CB Feature FT:source KU964305_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683706_FT00000_P-RF-DC Feature FT:source MN683706_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ318). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggagtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgccggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtagacatttaaaccctaataaaactaagcgatggggttattctctaaatttcatga
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttagaaaactccct
gttaataggcctattgattggacagtccgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcccctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaattctgttgttctcgcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttggtagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttcttctgtacctgtctttaatcctcagtggcaaactccttcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacctttggacaaaggcattaaaccgtattatcctgaacaagcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB583679_FT00000_P-RF-DE Feature FT:source AB583679_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Pkst8134). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactccctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgcaccctttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccctgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttaaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactgtcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaacatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacacccacttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattgcaattgattatgc
ctgctaggttctatcccaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642141_FT00000_P-RF-DE Feature FT:source JN642141_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Leb31). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
attaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccgtttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcacttcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttccagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttaaaa
gaaatttggagcttctgtggagttactctcgtttttgcctgttgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagaatctcctgaacattgttcagctcaccatactgctctcaggcaagcaattctg
tgctggggggacttaataactctatctacatgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacaccaatatgggcttaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggctgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcaggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY363263_FT00000_P-RF-CB Feature FT:source KY363263_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate geno6.3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagatcccagagtgcggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcatgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggactctatcgtcccctgcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacttgggtgggaagtaatttggaagaccaggcatcccgggatttagtagtcgg
ctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttcgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcatacggac
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JQ707456_FT00000_P-RF-GA Feature FT:source JQ707456_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C1). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcctctgccaaggcagtt
atataagaggactcttggactgtttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagt
gggaagaattaggcaatgagtccaggttaatgatctatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctgtat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcaaatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcccactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU695742_FT00000_P-RF-CB Feature FT:source KU695742_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5072). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtaaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataagaccaaacgatggggttattcccttaacttcatgg
gatatgtcattggaagttggggtactttaccacaggaccatattgtacaaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtctgttgggatttgctgccccttttacacaatgtgg
gtatcccgctttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaggtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggacatgagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaacattatcgggaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctccgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctatacgagatctcctcgacaccg
cctcagccctgtatagggaagccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaagaccccgcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccatcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttgaa
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattacaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggataaaggcattaaaccttattatcctgcacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtattttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MW601264_FT00000_P-RF-DE Feature FT:source MW601264_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Riboviria] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgagcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtactaaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagtatctagagacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttactatccagaacatctagtt
gatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggcccgacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccaacaaatccgcctcctgcatccaccaatcgccagtcaaga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|JF828934_FT00000_P-RF-CB Feature FT:source JF828934_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggttttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgaaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacacccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JQ707465_FT00000_P-RF-GA Feature FT:source JQ707465_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C20). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtatgggaccctgcaaaacctgcacgac
ttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagtt
atataagaggactcttggactgtttggtatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttactgagt
gggaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccctctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctgtat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcaaatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcaatggaa
>gnl|hbvnuc|MN650069_FT00000_P-RF-DC Feature FT:source MN650069_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate KRN916). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttcgaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcaacgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggtgggcattctatataagagagagactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatgggaggttggtcttccaaacctcgacaaggc
gtggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcacgtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgcccgcagca
cctcctcctgcctccacaaatcggaagccaggaagacagcctactcccatctctccacctctaatagacaatcatcctca
ggccatgctgtggaa
>gnl|hbvnuc|JQ040142_FT00000_P-RF-CB Feature FT:source JQ040142_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 262). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatccaaaagtgagaggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcactggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattatacaaaaaattaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggcagtaacttggaagacccagcatccagggaattagtagtcag
ctatgttaatattaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttactcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaaccccgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ707467_FT00000_P-RF-GA Feature FT:source JQ707467_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C27). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgac
ttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagtt
atataagaggactcttggactgtttggtatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagt
gggaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctgtat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcaaatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MG826144_FT00000_P-RF-CB Feature FT:source MG826144_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM21). Complete genome. [Hepadnaviridae] (length=3215 residues).
caccacaacattccaccaggctctactagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaagaacatattgtacttaaaatcaagcaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgcattattgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggtctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacgatccgctctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcggcgcatgcgtggaacctttgtggctccactgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactccgttgtcttgtctcggaaat
acacctcctatccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgactac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccggacttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctttgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacacag
cctccgctctgtatcgggaggccttagagtcaccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaacatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctgacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaacaaggagattaaaattaattatgc
ctgctagattctatcccaaccttaccaaatatctgcccttagataaaggcattaaaccgtattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatcccgattgggacttcaaccccaacaaggatcgctggccggaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF828936_FT00000_P-RF-CB Feature FT:source JF828936_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgaaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcgttacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KP995112_FT00000_P-RF-DE Feature FT:source KP995112_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 1925-HCC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgctccgaccactgcctctctcatatcgtcaatcttctcgaagattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcacagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactgacaaaacaaagagatggggttattccttacattttatgg
gttatgtcattggatgttggggatcattgccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtcttcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccctgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctagcagccggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaat
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttggggatctatcgtccccttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctctgccctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtacaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaaa
cccagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaaggttaaaattgattatgc
ctgctaggttttatcctaattttaccaaatatttacccttggacaagggcattaaaccgtattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctcaaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU519422_FT00000_P-RF-DC Feature FT:source KU519422_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetLinzhi-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacacaaaatcaagcattgttttcgaaaattgcct
gtaaatagacctattgattggaaaatatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgcgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
catagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctttctctgccgttccggccgcccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcatggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM750146_FT00000_P-RF-DC Feature FT:source HM750146_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-26). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaaaatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
ttccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaaacacacatcatacaaaaaatcaaagattgttttcgtaaactccct
gttaacaggcctattgattggaaggtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcaccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactctgttgtactcgcccgcaaat
atacatcctttccatggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgacctc
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatattttcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173349_FT00000_P-RF-CB Feature FT:source KJ173349_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX017C(e226)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaacttcatgg
gatatgttattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaatgactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactaytgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtctacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679952_FT00000_P-RF-CB Feature FT:source KU679952_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 114_TI_Ngu). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacagcagcgcaccaagcccttcctgctggtggctccagttccggaacagtaaaccctgttccgaatactgtctctc
acatmtcatcaatcttcacgacgactggggaccctgcaacgaacatggagaacacaacatcaggattcctaggacccctg
ctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcggagtctagactcgtggtggacttctct
cagttttctaggggragctcccgcgtgtcytggccaaaattcgcagtcccaaacctccaatcactcaccaacctcttgtc
ctccaacctgtcctggctatcgttggatgtrtctgcggcattttatcatattcctcttcatcctgctgctatgcctcatc
ttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggatcaacgaccaccagcacggg
accttgcagaacctgcacgattactgctcaaggaacctctatgtttccctcatgttgctgtacaaaaccttcggacggaa
attgcacctgtattcccatcccatcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcctgg
ctcagtttactagcgccatttgttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatctg
gtattgggggccaagtctgttcaacatcttgagtcccttttttccgctattaccacttttcttttgtctttgggtataca
tttaaatccccacaaaacgaaaagatggggttattccctcaacttcatgggatatgtgattggcagctggggaagcttac
cacaagatcatattgtacaaaaaatcaaacactgttttagaaaactccctgttaataggcctattgattggaaagtgtgc
caacgaattgtgggtctattgggctttgctgccccttttacacaatgtgggtatcctgccttaatgcctttgtatgcatg
tattcaggctaagcaagctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccg
ttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaacccccactggctggggcttggccrtaggccatgag
cgcctgcggggaacctttgtggctcctctgccgatccatactgcggaactcctggcagcttgttttgctcgcagcaggtc
tggagcaaacctyatcggcaccgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctcggttgtg
ctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtcycgcggc
cgcttggggatttaccgtccccttcttcgcctgccgttccggccgaccacggggcgcacctctctttacgcggtctcccc
gtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgccca
catgatcttgcccaaggtcttgcataagaggactcttggactatcagcaatgtcaacgaccgaccttgaggcatacttca
aagactgtgtgtttaaagactgggaggagttgggggaggagactaggttaaaggtctttgtactaggaggctgtaggcat
aaattggtctgttcaccagcaccatgcaactttttcacctctgcctartcatctcrtgttcatgtcctactgttcaagcc
tccaagctgtgccttgggtggctttagggcatggacatygacccttataaagaatttggagcttytgcggagttactctc
ttttttgccttytgacttttttccgtctattcgagatcttctcgacactgcatccgctctatatcgggaggccttagagt
ctccggaacattgctcayatcaccatacagcactcaggcaagcyattctgtgttgggttgagttaatgaatcttgctacc
tgggtgggaggwaatttggatgatccagcwtccagggaattagtagtcagttatgtcaatgttaatatgggcctaaaaat
tagacaamtattrtggtttcacatttcctgtcttacttttggaagagataccgttcttgagtatttggtgtcttttggag
tgtggattcgcactcctcaggcttacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttrttaga
caacgaggcaggwccyctaraagaagaactccctcgcctcgcaracgaaggtctcaatcgccgcgtcgcaraagatctca
atctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaactttacggggctttattcttctactgtacct
gtctttaatcctgagtggcaaactccytcttttcctgatattcatttacatgaagatattatcaataggtgtsaacaata
tgtgggccctcttacagttaatgaaaaaaggagattaaaattrattatgcccgctaggttctatcctaacattaccaaat
atttgcccttagataaaggcattaaaccttattatcctgaacatgcrgttaatcattactttaaaactagacattattta
catactctgtggaaggcgggtattctatataagagagaaactacacrtagcgcctcattttgtgggtcaccatattcttg
ggaacaagagatacagcakgggaggttggtcttccaaacctcggaaaggcatggggacgaatctttckgttcccaatcct
ctgggattctttcccgatcaccagttggaccctgcgttcggagccaattcaaacaatccagattgggacttcaaccccaa
caaggatcactggccaragkccaatcaggtaggagcgggagcattcgggccagggttcactccaccacacggaggtcttt
tggggtggagcccacaggctcagggcatatcaacartgccamcagctcctcctcctgcttccaccaatcgkcagtcagga
agacagcctactcccmtttctccaccaataagagacactcatcctcaggccacmcagyggac
>gnl|hbvnuc|KJ173300_FT00000_P-RF-CB Feature FT:source KJ173300_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HS005M(e23)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttgccacaagaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggag
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgactac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcctcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcgtttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattactttaaaaccaggcattatttacataccctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK052976_FT00000_P-RF-BD Feature FT:source MK052976_FT00000_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctgtgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtatcgggggccaaatctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcattggatgttatggttcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcagcgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttgaagcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacgatacatgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccggcggacgacccgtctcggggccgcttgggtctctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagattgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggcactaatttggaagatccagcatctagggacctaatagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaaccc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534618_FT00000_P-RF-BC Feature FT:source MK534618_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D424). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcacgtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgtcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaagctactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377556_FT00000_P-RF-CB Feature FT:source GQ377556_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J87). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaagcgatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtttgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaakctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggaaccgacaactctgttgtgctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgctgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggaggctctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggagcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacggtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccycacaaggacaactggccggacgccaacawggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactattggggyggagccctcaggctcagggcatatccacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH481862_FT00000_P-RF-DE Feature FT:source MH481862_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ZADGM6964C6). Complete genome. [Hepadnaviridae] (length=3185 residues).
ntccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggga
tagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
ccacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatagggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacattatacacaaaatcaaagaatgttttagaaaactccct
gttcacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccgggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgtggtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagttcttacataaaaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagatta
aaggtctttgaactaggaggctgtagccataaattggtctgcgcaccagcaccatccaactttttcacctctgcctaatc
atctacgttgcttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacagtgaccctta
taaagaatttggagctactatggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagata
ccgccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatt
ctttgctggggagaattaatgactctagctacctgggtgggtactaatttagaagatccagcatctagggacctagtagt
cagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagag
aaacggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatc
ctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacg
aagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggga
aattttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacgccctcttttcctaatatacattt
acaccaggatattagcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggttgaaattgatca
tgcctgctaggttttatcctaagtttaccaaatatttgcccttggataagggtattaaaccttattatccagaacatcta
gttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtatcaacaca
tagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcct
ctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaa
caaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttt
tggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtca
ggacggcagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN683669_FT00000_P-RF-DC Feature FT:source MN683669_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ72). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctacggacttctttcctactgttcgagatctcatcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttgcaagacccagcatccagggaagcagtagtcag
ctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacgtttggaagagaca
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX357636_FT00000_P-RF-DE Feature FT:source KX357636_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MK74ETH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaacaaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaagagatggggttattctttacatttcatgg
gttatgtcattggatgttggggatcattgccacaagatcatatcagacacaaaatcaaagactgtttcagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaagcgttctcgggactgacaactcagttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactttctcgtccccttctctgcctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacttgggtgggtgtaaacttagaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcatgtttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttatccaaattttaccaaatatttgcccttggacaagggtattaaaccgtattatcccgaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctactccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK534690_FT00000_P-RF-BC Feature FT:source MK534690_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D705). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcaccttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcacgtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccgactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaacgcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN650078_FT00000_P-RF-DC Feature FT:source MN650078_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate KRN6462). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaaggttgttttagaaaactacct
gttaataggcctattgattggaaagtctgtcaacgaattgtgggtcttttaggttttgctgcaccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaagccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatacgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaacattctcgggactgacaactctgttgttctcgcacgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctggcggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tctacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaactttaccaaatatttgcctttggacaaaggcattaaaccgtattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaaga
aaggcgacgaatctctctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB300369_FT00000_P-RF-CB Feature FT:source AB300369_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaacaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccacat
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggttattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
catagcggcttgttttgctcgcagccggtctggagcgaaacttattgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggacttccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaagaccaagcatccagggaagcagtagtcaa
tcatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaacttacaaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcaatt
aatcattacttcaaaactaggcattatttacatactctgtgggaggctggcattctatataagagagaaactacacacag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtgggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KC774234_FT00000_P-RF-CB Feature FT:source KC774234_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cur1038). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaacccgaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtcctgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaagcctttc
tgtgtaaacaatatatgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctttcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgataccg
cttcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttggacaaaggcattaaaccgtattatccggaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK321265_FT00000_P-RF-CB Feature FT:source MK321265_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1331). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagancccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgntgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctnttggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacactg
cctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
tgaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcnggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ205378_FT00000_P-RF-DE Feature FT:source GQ205378_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate T1181). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaa
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcaactgtggagttactctcatttttgccttccgatttctttccgtctgtccgagatcttctagataccg
ccgcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactttcgctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtggacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaagcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|MG826141_FT00000_P-RF-CB Feature FT:source MG826141_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM57). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagctctgctaggtcccaaagtgaggggcctagaccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgtacagggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgactcctgctcagggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaatcctcataaaaccaagcgatggggctactcccttaactttatgg
gctatgtaattggaagttggggtactttaccacaagatcatattgtagaaaaaatcaaacaatgtttcagaaaacttcct
gttaagagacctattgattggaaggtatgtcaacgcattgtcggtcttttaggctttgctgccccttttacacaatgtgg
gtatccagccttaatgcctttgtatgcttgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgccggtccgtgtgcacttcgcttcacctttgc
acgtcgcatggagaccaccgtgaacgcccaacaggtcttgcccaaggtcttgcataagaggactcttggactctcggcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtcttcggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggcagtaatttggaagatgcggcatccagggaattagttgtcag
ttatgtcaatgttaatatgggcctgaaacttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggagtgtggattcgcacccctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatttgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaagccaggcattatttacatactctgtggaaggcgggtattttatataggagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG826148_FT00000_P-RF-CB Feature FT:source MG826148_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM50). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacctttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaaccaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacattacctcaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtacatagacctattgattggaaagtatgtcaaagaattgtggggcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtatgcatgtatacaagctaagcaggcttttaccttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcaaaccttatcggaactgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgggccttctcatctgccggaccgtgtccatttcgcttcacctttgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactccggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttgca
ggaagacattattaagagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF440011_FT00000_P-RF-DE Feature FT:source JF440011_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN78). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
catgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcatgagtcccgttgtaccgctgt
taccaattttcttttgtgtttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaatcgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttgatgtctttcggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatccta
tcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtccttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccacttacagtgaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774291_FT00000_P-RF-CB Feature FT:source KC774291_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa1194). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccacttttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcggaaacttcct
gtaaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgccattgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacacactttgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccacctcacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774423_FT00000_P-RF-DC Feature FT:source KC774423_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2018). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacacaaaatcaagcactgtttccgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcgataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaacctcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377590_FT00000_P-RF-CB Feature FT:source GQ377590_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J147). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccactttccaccaaactcttcaagatcccagagtgagggscctrtactttcctgctggtggctccagttccggaa
cagtrarccctgytcmgamtactgyctcwsccatatcgtcaatcttctcgargactggggaccctgyaccgaacatggag
aacaymrcatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggcgattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtggggaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacagaagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattactttcagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgaagtggaa
>gnl|hbvnuc|KC774317_FT00000_P-RF-CB Feature FT:source KC774317_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2042). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactacct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggatcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774487_FT00000_P-RF-DC Feature FT:source KC774487_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1066). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcacggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttaggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacataaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaaatggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattaacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU833891_FT00000_P-RF-GC Feature FT:source EU833891_FT00000_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H4536/07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggggaccttgcaccgaacatggag
aacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttattcattgaatttcatgg
gatatgtaattggaagttggggcaccttgccacaagatcatattgtacagaaaatcagaaaatgttttagaaaactccct
gttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctgggctttgctgctccctttacacaatgtgg
ttaccccgcattaatgcctttgtatgcatgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgcagctccactgccgatccatactgcggaact
gctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctttcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcatgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccccttctccgtctgccgtaccggccgtccac
ggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtattgcccaaggtattgcataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctctccgtctgttcgagatctactcgacaccg
cctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacagcacttaggcaagctgtcctg
tgttggggtgagttgatgactctagctacctgggtgggaagtaatttggacgaccctggatccagggatttagtagtcac
ctatgtcaatgttaatatgggcctaaagtttagacaactattgtggtttcacatttcatgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttgca
tgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatcctgaacacgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcggaaaggc
atggggacgaatctttctgtacccaatcctctgggattttttggcgatcatcagttggaccctgcgttcagagccaactc
aaacaatccagattgggacttaaaccccaacaaggacccttggccacaagcccatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF440015_FT00000_P-RF-DE Feature FT:source JF440015_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN94). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
catgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaatcgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcagacgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgaagagcatgagctc
tccggaagggcgaatcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatccta
tcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccacttacagtgaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH746813_FT00000_P-RF-BC Feature FT:source MH746813_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagctctacaagatcccagaatcaggggcctgtactttcctgctggtggctccggttcaggaa
cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatatttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaactctaacaaaactaagagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacaaaaaatcaaacaatgttttagaaaactccct
gttaacaggcccattgattggaaagtatgtcaaagaatttcaggactcttgggctttgctgctccatttacacaatgtgg
ttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctggctgcctgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccacctgatcttgcccaaggtattgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggaccttctcgacaccg
catcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacagcactcaggcaagcagttttg
tgttggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaaaaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaattccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacggttaatgaaaaaagaagattaaacttaatcatgc
ctgctaggttctatcctaaccttactaagtatttgcccttagataaaggcattaaaccttattatccggagcaggcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaacaacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
acacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagtgggagcattcgggt
cagggttcacccctcctcacggaggtcttttggggtggagccctcaggctcagggcatgttaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagacagtcatcctca
agccatgcagtggaa
>gnl|hbvnuc|JQ707463_FT00000_P-RF-GA Feature FT:source JQ707463_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C19). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtatgggaccctgcaaaacctgcacgac
ttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcctctgccaaggcagtt
atataagaggactcttggactgtttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagt
gggaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagctgcccaatgttagtattccttggactcacaaggtgggaaactttacggggctgtat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaagatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcaattggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774307_FT00000_P-RF-CB Feature FT:source KC774307_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2016). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacactctaaacaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaagtctttgccaagtgttcgctgacgcaaccccc
cctggatggggcttggccataggcccccagagcatgcgtggaacctttgtggctcctcagccgatccatactgcggaact
cctagcagcttgttttgctagcagcaggtctggagcgaaacttattggtacggacaactccgttgtcctcttttggaaat
acacctcctttccatggctgcttgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggtctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcta
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacatacatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacacactttgtggaaggcgggcattctatataagagagaaactacacgaag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ097826_FT00000_P-RF-DE Feature FT:source MZ097826_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_242). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaccactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgygttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaycttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgyagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaaawctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgtyatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
cggctgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctwtccgtcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcaagagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaactaatgaatctagctacctgggtgggtagtaatttggaagaccaaccatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaca
cagttgcagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagatgtcgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaattccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgacagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU185780_FT00000_P-RF-AD Feature FT:source EU185780_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate H-IDU7 (Rec.Arg-1)). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctkctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaacaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtywwcgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgwgtgcacttsacttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggacccttggactctctacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagcatctagagacctagtagtcgg
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcgttcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcatccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ377544_FT00000_P-RF-CB Feature FT:source GQ377544_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J69). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggct
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctgcttctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagataaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF925386_FT00000_P-RF-AC Feature FT:source MF925386_FT00000_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate BD-HBV30). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccacgaggactggggaccctgtggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgcttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
ayacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgtcccctgcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtcggagatctcctagacaccg
cctcagctttgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagagg
ttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgagtcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaagaggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtgggagtgggagcat
tcgggccagggctcacccctccacacggcggtattctggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB188243_FT00000_P-RF-DE Feature FT:source AB188243_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate KAMCHATKA27). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacatgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcctgcgtggaacctttcgggctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactcggttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacgtcttgcccaaggtcttgcataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagctcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
tgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttccaaatatacatttaca
ccaagacattatcaaaaaatgtgagcagtttgtaggtccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattatttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggccgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgcaaacaaatccgcctcctgcctctaccaatcgcaagttggga
aggcagcctaccccgctgtctccaccattgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700557_FT00000_P-RF-CB Feature FT:source HQ700557_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_Tonga_BB6189_2002). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattcctaggacccctgctcgtattacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataagactaaaagatggggctattcacttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattatactaaaaatcaaacactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtctgttgggctttgctgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagcgaaacaagctttcactttttcgtcaacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtrcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcra
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttyaaagactgggaggagttgggggaggagattagatya
aaggtcwttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttcttcccatcgattcgagatctcctcgacaccg
cctcagctctgtaccgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggcagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctaccgcgtacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774456_FT00000_P-RF-DC Feature FT:source KC774456_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1102). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggattatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctttaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctttactgcccttgtatgcatgtattcaatccaaacaggctttcacattctcaccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttctcgcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774230_FT00000_P-RF-CB Feature FT:source KC774230_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cur1027). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcaccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccaccgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatctaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatactgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF967563_FT00000_P-RF-DE Feature FT:source MF967563_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatmatyctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccatttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcgtgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctggctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MG826146_FT00000_P-RF-CB Feature FT:source MG826146_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM40H). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgaggggcctatactatcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtacgaaaaatcaaacaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtatgcaagtatacaagctaagcaggcttttactttctcgccaacttacaaggtctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactcggccataagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggactggagcaaaccttatcggaacggacaactctgtggtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgattgggggtctaccgtccccttctgtgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggactttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtaggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ349212_FT00000_P-RF-DE Feature FT:source FJ349212_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate H36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
tgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtccgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttatataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
cagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggcgcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagcatctagagacctagtagtcgg
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctctcttttggaagagaaa
ccgttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatccta
tcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtgttccttggactcataaggtggggagc
tttactgggctctattcttctactgtacctgtcttcaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagtaaatgaaaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggtctcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagccgaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT991427_FT00000_P-RF-DC Feature FT:source KT991427_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I113-2-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactattgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccacgtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttgaaccctaacaaaactaagagatggggttattctttgaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaaacacacatcatacaaaaaatcaaagattgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttcttgcccgtaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagttag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagaggaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacaatgcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaattatgc
ccgctaggttctatcctaaccttactaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacgagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgttgacaacagtgccagcagca
catcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534646_FT00000_P-RF-BC Feature FT:source MK534646_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D477). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggccccagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgtcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagacaaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562302_FT00000_P-RF-CB Feature FT:source FJ562302_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I186). Complete genome. [Hepadnaviridae] (length=3185 residues).
ctccacaacattccaccaagctctgcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcac
ccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagaacacaacatcaggattcctaggacccctg
ctcgtgttacaggcggggcttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctct
caattttctagggggagcacccacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcgtgtc
ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatc
ttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagtacggg
accatgcaagacctgcacaattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaa
actgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctgg
ctcagttcactagtgccatttgttcagtggctcgtagggctttcccccactgtttggctttcagttatatcgatgatgtg
gtattgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtataca
tttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttac
cgcaagaacatattgtacaaaaaatcaaacaatgttttagaaaacttcctataaatagacctatcgattggaaagtatgt
caaagaattgtgggtcttttgggttttgccgctccctttacacaatgtggctatcctgccttaatgcctttatatgcatg
tatacaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccg
ttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcac
cgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtc
tggagcaaaacttatcggaaccgacaacgctgttgtcctctctcgaaaagacacctcgtttccatggctgctcggatgtg
ctgccaactggatcctgcgctggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgatccctgtcggggc
ggtttgggactctaccgtccccttgttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctcccc
gtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtgaacgccca
ccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgaccttgaggcatacttca
aagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaaagatctttgtactaggaggctgtaggcat
aaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcc
tccaagctgtgccttgggtggctttggggcatggacattgacacctataaagaatttggagcttctgtggagttactctc
ttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagt
ctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacc
tgggtgggaagtaatttggaagacccagcatccagggaattagtagtcggctatgttaatgttaatatgggcctaaaact
cagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggag
tgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttaga
cgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctca
atctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctactgtacct
gtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaggacattattaatagatgtcaacaatt
tgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatcctaaccttaccaaat
atttgcccttggacaaaggcattaaaccatattatcctgaacatgcagttaatcattacttcaaaactaggcattattta
catactctgtggaaggctggcattctatataagagagaaactacacgcagcgcctcattctgtgggtcaccatattcttg
ggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgttcccaatcct
ctgggattctttcccgatcatcagttggaccctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaa
caaggatcactggccagaggccaatcaggtaggagcgggagcattcgggccagggttcaccccaccacacggcggtcttt
tggggtggagccctcaggctcagggcatactgacaacagtgccagtagcacctcctcctgcctccaccaatcggcagtca
ggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774448_FT00000_P-RF-DC Feature FT:source KC774448_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1058). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggccggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctttctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccgtggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
caggtttcactccaccgcacggcggtcttttggggtggagccctctggctcagggcatattgacaccagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG826151_FT00000_P-RF-BC Feature FT:source MG826151_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM26H). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaaaatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaagggaactctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggaagttggggcaccttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggatttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttacgttctcgccaacctacaaggcctttc
tgcgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcctcttcttcatctgccataccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatcgta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcccctggcagaggaag
gtttcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcccttattcttctactgtacctgtctttaatcctgactggcaaactcccttttttcctcacattcatttgaa
agaggacattatccccagatgccaacaatttgtgggccctcttccagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaagccaggcattatttacatactctgtggaaggcgggtattttatataggagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgcgcagtggaa
>gnl|hbvnuc|AB205152_FT00000_P-RF-CB Feature FT:source AB205152_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HB-JFH7-99). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctcgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacgsaaactgcacttgtattcccatcccatcrtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaatyggaagttggggtactttaccacaggaacatattgtattaaaaattaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctttgtatgcatgtatacaatctaagcaggccttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgctcagctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774486_FT00000_P-RF-DC Feature FT:source KC774486_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1064). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtaaacaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgccctgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaaccttcgtggctcctctgccgatccatagtgcggaact
cctagcagcttgttttgcttgcagccggtctggagcaacactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctgcatttgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctagtc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctggtcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtgatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacgtttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaatgccctcctttcctcacatacatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacagcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF925371_FT00000_P-RF-DC Feature FT:source MF925371_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate BD-HBV15). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgaaagacctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggtccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttactggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccctgcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctgatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacgataatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataacacaaaccttgccaacaaatccgcctcctgcatctaccaatcgccggtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HM750143_FT00000_P-RF-DC Feature FT:source HM750143_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate tibet-116). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgatgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgcctcaatcacacatcatgcaaaaaatcaaagattgttttcgaaaactccct
gttaaccggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttactgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470843_FT00000_P-RF-DC Feature FT:source KY470843_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-10-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttcctccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaacacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaaacacctctatgtatccct
cctgttgctgtacaaaaccttcggtcggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatagaattggaagttggggtactttaccacaggaccatattgtacacaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctgttggttggaaagtatgtcaaagaattgtgggtcttttgggctttgttgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcacctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctattcgcgatctcctcgacaccg
ccgctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagatattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaactagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtaggccctcttactgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttggacaagggcattaaaccgtattatcctgaacatgccgtt
aatcattacttccaaactaggccttatttacatactctgtggaaggctggcattctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagtgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtcgagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctca
ggccgtacagtggaa
>gnl|hbvnuc|MN683626_FT00000_P-RF-DC Feature FT:source MN683626_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ223). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcaggacctgcacaactcctgctcaaaacaactctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctatggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ349221_FT00000_P-RF-DE Feature FT:source FJ349221_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate H149). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccgcatcgtcaatcttctcgaggattggggaccctgtgctgagcatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggccctaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccgaacctgcatgacaactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtaccgcaccttgagtccctttttactgctgt
ttccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaggttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaagctaagagggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccgggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgagcgcccacctaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttgctctcgtttttgccttctgacttctttccttcgataagcgatcttctagccaccg
ccacagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaactaatgtctctagccacctgggtgggtgtaaatttggatgatccagcatctagagaacaagtagtcgg
ttatgtcaactctcatatgggcctcaagttcagacaactcttgtggtttcacgtttcttgtctcatgtttggacgagatt
tagttttagagtatttggtgtctttcggagtgtggattcgcactcctccggcctatagaccttcaaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaagtctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
actcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataaaagagaatcaactcatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcccactccgctgtctccgcctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX898699_FT00000_P-RF-DE Feature FT:source JX898699_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P27). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaacatcatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactccttcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgcatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcattcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN683630_FT00000_P-RF-DC Feature FT:source MN683630_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ246). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964009_FT00000_P-RF-CB Feature FT:source KU964009_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaaccttcgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683647_FT00000_P-RF-DC Feature FT:source MN683647_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ39). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcaggacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaaatcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
gtgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccccccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggttttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683652_FT00000_P-RF-DC Feature FT:source MN683652_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ46). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gctataaaattggatgttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctcacggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacccccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttacaaaatatttgcccttggacaagggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcacattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF440014_FT00000_P-RF-DE Feature FT:source JF440014_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN86). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
catgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaatcgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgaagagcatgagctc
tccggaagggcgaatcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatccta
tcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccacttacagtgaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU519423_FT00000_P-RF-DC Feature FT:source KU519423_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetLinzhi-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcttgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccgtaggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctatccgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaaccaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU736916_FT00000_P-RF-DE Feature FT:source KU736916_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Sudan_11). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctctcatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaagctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtataaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtatggggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaagagatggggttattcgctacatttcatgg
gttatgtcattggatgttggggatctttgccacaagaccatatcatacacaaaatcaaagaatgtttcagaaaactcccc
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagctaaactactcgggactgacaactctgtcgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtccccttctctgcctgccgttccagccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgggatcttctagataccg
cctcagctctttatcgggatgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagccattctt
tgctggggggacttaatgtctttagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccggcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcgaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaaggttgaaattaatcatgc
ctgctaggttttatcctaattttaccaaatatttgcccttggacaaaggtattaaaccttattatccagataatgtagtt
aatcattacttccagaccagacactatttacataccctttggaaggcgggcatcttatataaaagagagactacacgtag
cgcatcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggacctcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgg
ggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaacattgccagcaaatccg
cctcctgcctctaccaatcgccagtcaggaagacagcctaccccgctgtctccacctctgagagacactcaccctcaggc
catgcagtggaa
>gnl|hbvnuc|EU871984_FT00000_P-RF-CB Feature FT:source EU871984_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-00-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggcatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ904437_FT00000_P-RF-DE Feature FT:source FJ904437_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B30a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccgggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgg
gttatgtcattggctgttggggatcattgccgcaagatcatatcagacacaaaatcaaagactgtttcagaaaactccct
gttaacaggcccattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcattaatgcccttgtatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgtggttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctccgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgyacacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggagcaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacaattccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacgacacatag
cggctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttgcaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagctggagcattcggggtggggttcaccccactgcacggaggccttttgg
ggtggagccctcaagctcagggcatattaacaaccttgccagcaaatccgcctcctgcctccaccaattgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacacccatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY470844_FT00000_P-RF-DC Feature FT:source KY470844_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-109). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttcctccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatctcctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaacacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaaacacctctatgtatccct
cctgttgctgtacaaaaccttcggccggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggcccagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcaccttgagtccctttttaccgctgt
taccaattttctattgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatagaattggaagttggggtactttaccacaggaccatattgtgcacaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
agtgtaaacaatatctggacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcggcacatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggtaccgacaactctgttgtcctctctcggaaat
acacatcctttccatagctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttccttggagttactctcttttttgccttctgacttctttccttctattcgcgatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagatattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaactagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcagcaatatgtaggccctcttactgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccataccaaatatttgcccttggacaagggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagtgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtcgagccctcaggctcagggcatattgacaacagtgccagcagcg
ccccctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccaccctca
ggccgtacagtggaa
>gnl|hbvnuc|JQ707462_FT00000_P-RF-GA Feature FT:source JQ707462_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C17). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagtt
atataagaggactcttggactgtttggtatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagt
gggaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctgtat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatttt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcaaatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724239_FT00000_P-RF-DE Feature FT:source MH724239_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BR30). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtccgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtgcctgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaactgcct
attaacaggcctattgattggaaagtatgtcagcgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttaccctgctttaatgcccttgtacgcatgtattcaagctaagcaggctttcactttctcgccaacttataaggcttttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgaccattgtacacctcaccatactgcactcaggcaagcaattatt
tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagaggta
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctaattggaaaacaccatctttccctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctactt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagccaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggggcgggagcattcgggccgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagccaaccccgctgtctccaccattgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK534632_FT00000_P-RF-CB Feature FT:source MK534632_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate D452). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgtggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgtcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgcgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactaaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgaatatttggtgtctttcggggtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctatctttaatcctgagtggcaaactccctcttttcctgatatacatttgca
ggaagacattattaatagatgtcaacaatttgtgggccctcttaatgtcaatgaaaaaaggagattaaagttaattatgc
ctgctagattttttcccaaccttaccaaatatttgcccttagagaaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattctgcaaaacctcgcaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaccaatccggattgggacttcaaccccaacaaggacccttggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB270538_FT00000_P-RF-DE Feature FT:source AB270538_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MGL231F). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggcccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacagaaaatcaaagattgctttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgccccttttacacaatgtgg
atatcctgctctaatgcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaacattctcgggactgacaattcagttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtccatgtcctactgttcaagccaccaagctgtgccttgagtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctatttcgggatgccttagagtctyctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagctacctgggtgggtactaatttggaagatcaggcatctagggatcaagtagtcag
ttatgtcaacactactgcgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcactttcggaagagaaa
cagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtgggcccactaacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggaattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagccgaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU881995_FT00000_P-RF-CB Feature FT:source EU881995_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccaaagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttctcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccagggacgtcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaagctgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgtaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtcctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggcgcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcccgagtggcaaattccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgaaaaggc
atggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX898687_FT00000_P-RF-DE Feature FT:source JX898687_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate P9). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagacgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcagctcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgcacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KR013816_FT00000_P-RF-CB Feature FT:source KR013816_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgtcgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcgacg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtactttaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccatccgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcataaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963867_FT00000_P-RF-CB Feature FT:source KU963867_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534664_FT00000_P-RF-BC Feature FT:source MK534664_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D511). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgcctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaactccatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcaatcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ904405_FT00000_P-RF-DE Feature FT:source FJ904405_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A44). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacacctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttactgctgt
ttccaattttcttttgtctttgggtatacatttaaacactaacaaaacgaaaagatggggttattctctacattttatgg
gttatgtcattggctgttggggatcattgccgcaagatcatatcaaacacaaaatcaaagactgtttcagaaaactccct
gttaacaggcccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtctggcctgtgccaagtgtttgcagatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactcagtggttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctttcgtcctcttctctgcctgccgttccggccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctcaagacttctatccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcccgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggacttaatgaatctagctacctgggtgggagcaaatttggatgatccaggatctagggaccaagtagtcag
ttatgtcaataataatatagccctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttctgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctagcagacgaag
gtgtcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
ttcacggggctttattcttatactgtacctgtctttaaccctcattggaaaacaccctcgtttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagacaagaaggttgaaattgattatgc
ctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccatattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaaccctcta
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataacacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcaaccaaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM606750_FT00000_P-RF-DE Feature FT:source KM606750_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Cuba60). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctttatttccctgctggtggctccagttcaggaa
caataaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactgacaaaacaaagagatggggttattccttacatttcatgg
gttatgtcattggatgttggggatcattgccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccctgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggacatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtccccttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctctgccctgtatcgggatgccttagagtctcctgagcattgttctcctcaccatacggcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtacaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaaa
cccagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaaggttaaaattgattatgc
ctgctaggttttatcctaattttaccaaatatttacccttggacaagggcattaaaccgtattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattttttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctcaaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN683634_FT00000_P-RF-DC Feature FT:source MN683634_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ250). Complete genome. [Riboviria] (length=3215 residues).
ctctacaaccttccaccaaactctgcaagatcccagggtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccacaagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggtagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaagaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ111987_FT00000_P-RF-DE Feature FT:source DQ111987_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MMU36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttaacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacccgaacaaaacaaagagatggggttattctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagactgctttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgccgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactcagttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggcgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataaaagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664933_FT00000_P-RF-DA Feature FT:source JN664933_FT00000_P-RF-DA of [Viruses] Hepatitis B Virus recombinant form DA (isolate EN58_CHB). Complete genome. [Hepadnaviridae] (length=3188 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttgtcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacgtttaaaccctaataagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatmttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctcctgacttctttccttccgtccgggatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatacagcactcaggcaagccgttctc
tgctgggtggaattaatgacgctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgttcttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccactaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgagggcgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatataca
tttacaccaagacatcatcaacaaatgtggacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattga
ttatgcctgctaggttttaccctaacgttaccaaatatttacctttagataagggtattaaaccttactatccagaacat
ctagttaatcattactttcaaactagacactatttacacactctatggaaagcgggtattttatataagagagaaacaac
acatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaat
cctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcc
caacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggcc
ttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccag
tcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|JQ707432_FT00000_P-RF-GA Feature FT:source JQ707432_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C20). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccttgcaaaacctgcacgac
ttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggcaaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagtt
atataagaggactcttggactgtttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagt
gggaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagagtcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctgtat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattctgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcaattggaccctgcattcggagccaactcaaacaatccagattg
ggacctcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcagatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU695744_FT00000_P-RF-CB Feature FT:source KU695744_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5075). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtccaacttcgcgagaactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggaactttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcgtgtatacaagctaagcaggctttcactttctcgtcaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctcagccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattctcggcaccgacaactctgtcgtcctctctcggaagt
acacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtcgcggggccgtttggggatgtaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcta
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcttccagagaattagttgtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccacccaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtccctgtctttaatcctgagtggcaaaccccctcttttcctgacattcacttgca
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgccaggttctaccctaaccttaccaaatatttgccattagataaaggcatcaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagcgagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683680_FT00000_P-RF-DC Feature FT:source MN683680_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ93). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaaagatggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggtcataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaacattatcgggactgacaactctgttgttctctctcgcaaat
acacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtgttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683700_FT00000_P-RF-DC Feature FT:source MN683700_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ172). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttaggaaacttcct
gttaacaggcctgttgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccctcagcgcatgcgtggaacctttgtggctcctttgccgatccataccgcggagct
cctcgcagcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactccgttgttctcgcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964007_FT00000_P-RF-CB Feature FT:source KU964007_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534583_FT00000_P-RF-BC Feature FT:source MK534583_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 503). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgtcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgcgatctcctcgacaccg
cctctgctctgtatcgggagcccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattcta
tgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaagcagtagtcaa
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagata
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactaacaaatgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534633_FT00000_P-RF-BC Feature FT:source MK534633_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D453). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaactgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgtcgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgtcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaactaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaagcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM750133_FT00000_P-RF-CB Feature FT:source HM750133_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate GSD-54). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
ctgtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
tgaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacattaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ707474_FT00000_P-RF-GA Feature FT:source JQ707474_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C43). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttaacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgac
ttctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacataaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcacttcacctctgcacgttacatgaaaaccgccataaacacctctcatcatctgccaatgcagtt
atataagaggactcttagactgtttgttatgtcaacaaccagaatggaaaaatacttcaaaaactgtgtttttgctgagt
gagaagaattaggcaataagtccaagttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagagtcctctgagcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctatat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcaaatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN683579_FT00000_P-RF-DC Feature FT:source MN683579_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QH267). Complete genome. [Riboviria] (length=3215 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacacaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgttgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcagctgccgttccggccgcccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctatacgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccttacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggcccacttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttggacaaaggcataaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaggagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM750147_FT00000_P-RF-DC Feature FT:source HM750147_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate Tibet-29). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttactgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttcttgcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcttccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcgctcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggacccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF925384_FT00000_P-RF-DB Feature FT:source MF925384_FT00000_P-RF-DB of [Viruses] Hepatitis B Virus recombinant form DB (isolate BD-HBV28). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcgaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctacgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtgcgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcatctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggaaatttggatgatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttctgttgttagacaacgaggcaggtcccttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgagaaaaggagactgaagttaattatgc
ctgctaggttttacccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagacagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN683620_FT00000_P-RF-DC Feature FT:source MN683620_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ197). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttcctccaaactctgcaagatcccagggggagagacctgtgtttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctggttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcacaaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaagaacctctatgaatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggccttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggtctctaccgtcctcttcttcatctgccgttccggccacccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccatctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaattaagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaaatactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacatcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EF103285_FT00000_P-RF-DE Feature FT:source EF103285_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Ran128). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttgcccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcctgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactccctcaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgcaaagtgcttgctgacccacccccc
actggctggggcttggtcaagggccatcagcgcctgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtcgggggcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctcacgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacacccacttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggaccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatcccaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594436_FT00000_P-RF-DE Feature FT:source EU594436_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggcttcagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaagagatggggttattctctacattttatgg
gttatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggccttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactgcatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggcgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacatactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtcgccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642152_FT00000_P-RF-DE Feature FT:source JN642152_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Leb45). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttggtgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
attaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccgtttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcacttcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttttgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagaatctcctgaacattgttcagctcaccatactgctctcaggcaagcaattctg
tgctggggggacttaataactctatctacatgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacaccaatatgggcttaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggctgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcaggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ023673_FT00000_P-RF-GC Feature FT:source FJ023673_FT00000_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-4997). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagctcttcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggggaccttgcaccgaacatggag
aacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccttaaatttcatgg
gatatgtaattggaagttggggcaccttgccacaagatcatattgtacagaaaatcagacaatgttttagaaaactccct
gttaatcggcccgttgattggaaagtatgtcaaagaatttcaggtcttctgggctttgctgctccctttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctttcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccccttctccgtctgccgtaccggccgtccac
ggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacctggtattgcccaaggtattgcataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctactcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgtcctg
tgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcatccagggatttagtagtcag
ctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagactgaaattaattatgc
ctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatcctgaacacgcagtt
aatcattactttaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcggaaaggc
atggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctgagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774453_FT00000_P-RF-DC Feature FT:source KC774453_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1083). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacacaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgctgaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacagtatgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggcgcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683655_FT00000_P-RF-DC Feature FT:source MN683655_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ51). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaggatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacataacatcaggattcctaggacccctgctcgtgttacaggcggggttttcctggttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaagaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacacaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcctgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccggcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctttctctgccgttccagccaaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacac
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB210819_FT00000_P-RF-DE Feature FT:source AB210819_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE. Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgacgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaactaatgaccttagctacctgggtgggtgttaatttggaagatcaaacatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacctttcttgtatcacttttggaagagaca
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtggggaat
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagctttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttctgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT991420_FT00000_P-RF-DC Feature FT:source KT991420_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtacttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgttaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgcattacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaattgcct
gtaaataggcctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaagctcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattaatagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttctggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattggggcttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KT991421_FT00000_P-RF-DC Feature FT:source KT991421_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgttaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctctaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtcgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcgcgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggctaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatacgtaattggaagttggggtaccttaccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagcatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaagctcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctatcctaaccttaccaaatatttacccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB033559_FT00000_P-RF-DE Feature FT:source AB033559_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate PYW310). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgttttagaaaactccct
gttcataggcctattgattggaaagtgtgtcaacgaattgtgggccttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actgggtggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcggaactgacaactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggccctgtcgtccccttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
ccgcggctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttctagagtatttggtgtcttttggagtgtggattcgcactcccccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattctgctactgtacctgtctttaaccctcattggaaaacgccctcttttcctaatatacatttaca
ccaggatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggttgaaattgatcatgc
ctgctaggttttatcctaattttaccaaatatttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
cgacagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB195941_FT00000_P-RF-CB Feature FT:source AB195941_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctttgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatacctctat
taccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactcaaactcaagcactgttttcgaaaattgcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774498_FT00000_P-RF-DC Feature FT:source KC774498_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dyc1011). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacttttcaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggaactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtttgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|AP011102_FT00000_P-RF-CB Feature FT:source AP011102_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacaggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactgaaaatcaaacattgttttcgaaaacttcct
gtaaaccggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatatcagctaagcaggctttcactttctcgccaacttacaaggccttcc
tgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtctggtttctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcattaggccagcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggtaccgacaactctgttgtcctctctcgcaaat
acacctcatttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggggtctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacttggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctcggctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtctcacatttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcttacagaccacctaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccttcttttcctgacattcatttaca
ggaggatataatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagcggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatacttaccgttagacaagggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaacgaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgttcccaatccgctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaaacaagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagcgggagcatttgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagctgca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410520_FT00000_P-RF-CB Feature FT:source KJ410520_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Occult_HK4869). Complete genome. [Hepadnaviridae] (length=3236 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcacgattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cgtgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gttatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaaacaatgttttcgtaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggccttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcacttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctcggcataatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctccagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacc
tctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK534725_FT00000_P-RF-CB Feature FT:source MK534725_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate H528). Complete genome. [Riboviria] (length=3215 residues).
ttccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacaccttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggctactcccttaacttcatgg
ggtatataattggaggttggggcaccttaccccaagaacatattgtattgaaaatcaaacaatgttttagaaaacttcct
atcaataggcctattgattggaaggtatgtcaacgaattgtgggtctgttgggatttgctgctcccttcacacaatgtgg
ttatcccgctttaaagcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttataaggcctttc
tgaaaaaccaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgttctttcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccgcttctccgtctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggactctgcccaaggtcttacataagaggactattggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagaacaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacggcgctcaggcaagctattgtg
tgttggggagagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ttgttcttgagtatttggtgtcttttggagtgtggattcgcactccccctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgactggcaaaccccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggc
caggattcactccaccacacggcagtcttttggggtggagccctcaggctcagggtatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670303_FT00000_P-RF-CB Feature FT:source AB670303_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Non-HCC pt No.30). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactyccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatccggccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtgtctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcagcgcatgcgtggaaccttcgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
statstcaatgttaatatgggcctaaaawtcaggcaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggaaaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttgggggggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871985_FT00000_P-RF-CB Feature FT:source EU871985_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-00-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggcatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtgtcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF491451_FT00000_P-RF-DC Feature FT:source JF491451_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QH-35). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcttgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatatcattggaagttggggtactctaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgcaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaaccatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgcaagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377534_FT00000_P-RF-CB Feature FT:source GQ377534_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J41). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccactacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcctcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccgtttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaactccc
actggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtcgcgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaagacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacaaatctttct
gttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgtcaacagtgccagtagcacctcctcctgcctccacc
aatcggcagacaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774424_FT00000_P-RF-DC Feature FT:source KC774424_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz2021). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcttgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctgttgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccttaggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgcaactcatcggtactgacaactctgttgtcctctctcggaaat
acacctcctatccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683612_FT00000_P-RF-DC Feature FT:source MN683612_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ183). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaacctttggacggaaattgcacctgtattcccatcccatcatcctggggtttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
ggtatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtacacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccagagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacatcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873540_FT00000_P-RF-CB Feature FT:source KF873540_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 003_DR_Dal). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatctycacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcacyaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagyccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctatacaacatcttgagtcccttttttccgctgt
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacaaaacgatggggttattccctcaacttcatgg
gatatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacacagttttagaaaacttccc
gttaataggcctattgattggaaagtatgtcaacgaattgtaggtctcttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgccaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactccgttgtcctttctcggaaat
acacctcctttccatggctgctcggttgtgctgcraactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaaccccgcggacgacccgtctcgcggccgcttggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
atgtcgcatggcgaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccmttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctccttgacactg
cctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctwttctg
tgttggggtgarttaatgaatctggctacctgggtaggaagtaatttggaagatccagcatccagggaattagtartcag
ttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatcttttggagtgtggattcgcactcctcycgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggcccccttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggtattctatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcrggagcattcgggc
cagggttcactcccccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679942_FT00000_P-RF-CB Feature FT:source KU679942_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 094_CA_Mim). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcctcagcattccatcaagctctacaagaccccagagtaaggggtctgtattttcctgctggtggctccagttccggaa
cagtaagccctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggggaccctgcgacgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgacctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatctaaatcctcacaaaacaaaaagatggggttattccctcaacttcatgg
gttatgtgattggtagctggggaagcttaccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggctttcattttttcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacgggctggtctctgccaagtgtttgctgacgcaacgccc
actggctggggcttggccataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
tctagcagcctgtttcgctcgcagccggtctggagcgaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctgatcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatatttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtcgagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagaatctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtaag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcatttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagactaaaattaattatgc
ctgctaggttctatcctacactcaccaaatatttgcccttggacaaaggcattaagccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctatggaaggcgggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaagcctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcaggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagggccagcagcg
cctcctcctgcctccgccaatcggcagtcaggaagacagcccactcccatatcacaacctctaagagtcactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964311_FT00000_P-RF-CB Feature FT:source KU964311_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB188245_FT00000_P-RF-DE Feature FT:source AB188245_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate ALTAY136). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacagtacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttggggatctctcgtccccttctctgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttgcataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagctcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
tgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagacctccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacatactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttctgg
ggtggagccctcaggctcagggcatactacaaacgttgccagcaaatccacctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FN594771_FT00000_P-RF-DE Feature FT:source FN594771_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne442). Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcctatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgccctct
aattccagagtcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaacctttggatggaaactgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagaccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaggatggggttattctctacatttcatgg
gttatgtcattggatgttggggatcactgccacaagatcatattatacacaaaatcaaagaatgtttccgaaaactccct
gtcaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttctaggttttgttgctcctttcacacaatgtgg
ttatcctgctttgatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttccagttcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactcggttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtccccttctctgtctgccgttccgaccgaccac
gggtcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattcacctcacattccacctgggtgggtgtaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtaaatgagaaaagacggttgaaattgattatgc
ctgctaggttttatcctaatgttaccaaatatttgcccttggacaagggtattaaaccgtattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccagcaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccactggacagacgccaacaaggtaggagtgggagcattcgggccgg
ggttcacccctccgcacggaggccttttggggtggagcccgcaggctcagggcataatacaaaccttgccagcaaatccg
cctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MN683597_FT00000_P-RF-DC Feature FT:source MN683597_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ139). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gctataaaattggatgttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctcacggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacccccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttacaaaatatttgcccttggacaagggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcacattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ647349_FT00000_P-RF-DE Feature FT:source KJ647349_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV156). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaccatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gctatgtcattggatgttatgggtccttgccacaagaacacatcatacgaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcacrcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattatcggractgataactctgttgtcctctcccgcaaat
atacttcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccraccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagattgggaggagttgggggaggagaytagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacccttataa
agaatttggagcttcagtggagttactctcgtttttgcctaatgacttctttccttcagcacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacttgggtgggggctaatttggaagagcaagcatctagagacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacctttcttgtctctcttttggaagagata
cagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatccta
tcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtataccttggactcataaggtggggaac
ttnactgggctttattcttctactgtacctgtctttaatcctcattggaaaccaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacattttgtaggcccactcacagttaatgagaaaagaagattgcagttgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcttcattctgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattcttccccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcggactggggttcaccccaccgcacggaggtcttttgg
ggtggagtcctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
agacagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK534662_FT00000_P-RF-BC Feature FT:source MK534662_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D506). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgcctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcgaggtcgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtttcactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534719_FT00000_P-RF-CB Feature FT:source MK534719_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate H519). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggctccagttccggaa
cagcaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaaaccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttaggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtctcttgggttttgccgctccctttacccaatgtgg
atacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttgctgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagaccacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttaaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggaggttaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatattgtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccacctcacggaggtcttttggggcggagccctcaggctcagggcatattgacaacggtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700519_FT00000_P-RF-CB Feature FT:source HQ700519_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_G028A_2003). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccatcaagctctgctagatccccgagtaaggggcctttatcttcctgctggtggctccagttccggga
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcactgagcatggag
agcacaacatcaggattcctaggacccctgctcgkgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
gtcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttctatctttgggtatacatttaaaccctaataaaaccaagcgatggggctactgccttaacttcatgg
gatatgtaattggaagttggggaactttaccacaggaccatattgtgctcaaaatcaagcaatgttttagaaaactccct
gtaaataggccaattgattggaaagtgtgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttaatgcctttgtatgcatgtattcaagctaaacaagctttcactttctcgccaacatacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccatgggccacaggcgcatgcgtggcacctttgtggctcccctaccgatccatactgcggaact
cctagctgcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactcggttgtcctctctcggaagt
acacctccttcccatggctgctaggttgtgctgccaactggatactacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgatccgtctcggggccgcttggggatctatcgtccccttctccgcctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
atgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtaaatgttaatatgggcctgaaaattagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggatacgcacacctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttactcttctactacacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgcg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattagttatgc
ctgctcgattttatcctaaccttactaaatatttgccgttagataaaggcattaaaccttattatccggaacacgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggatttttgcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccaggagcaaatcaggtaggaacaggagcatttgggc
cagggttcaccccaccacacggaggtttgttggggtggagccctctggctcagggcacattgacaacggtgccagcagcg
cctcctcctgcatccaccaatcggcagtcagggagacagccgactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ272887_FT00000_P-RF-GF Feature FT:source JQ272887_FT00000_P-RF-GF of [Viruses] Hepatitis B Virus recombinant form GF (isolate HBV_MDQ24). Complete genome. [Hepadnaviridae] (length=3248 residues).
ctctacagcattccaccaagctctacaaaatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggga
tagtgaaccctgttccgactattgcctctcacatctcgtcaatcttctccaggattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacctcacacagaaaattaagcaatgttttcggaaactccct
gttaacaggccaattgattggaaagtctgtcaacgaataattggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaaccaccggggtggagaaatacttcaaggactgtgtttttgctgactgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactatttcacctctgcctaatc
atctcttgttcatgtcctattgtccaagcctccaagctgtgccttgggtggctttagggcatggatagcacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttactctcttttttgccttctg
actttttcccgtcagttcgggacctactcgacaccgcttcagccctctaccgggatgctttagaatcaccagaacattgc
acacctaaccataccgctctcaggcaagctatattgtgctggggtgagttaatgactttggcttcctgggtgggcaataa
cttggaagatcctgctgctagggacctagtggttaactatgtcaatactaacatgggcctaaaaattagacaattgctgt
ggtttcacatttcctgccttacttttggaagagaaacagttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcttatccacacttccggaaactactgttgttagacgacgaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctccagcttccc
aatgttagtattccttggactcataaggtgggaaattttacgggactctattcctctactgttcctacttttaatcctga
ctggttaactccttcttttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccctctca
caaaaaatgaattgagaagattgaaattagttatgccatccagattttttcctaaggttaccaaatattttcctatggaa
aagggaattaaaccctattatcctgataacgtggttaatcattattttaagaccagacactatttgcatactttatggaa
agcaggcattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatattcttgggaacaagatctac
agcatgggactttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctgggattctttccaga
tcaccagttggatcctgcattcagggcaaattccagcaatccagattgggacttcaatcccaaaaaggacaattggccag
aggccaacaaggtaggagtgggagcatatggtcccgggttcacacctccacacggaggcctgttggggtggagtccacag
gcacagggcacactaacaacattgccagcagatccgcctcctgcttccaccaatcgtcggtcagggaggaaacctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT991423_FT00000_P-RF-DC Feature FT:source KT991423_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate I137-8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttctcttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtggatcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaagctcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattaatagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctaccctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagactgcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013843_FT00000_P-RF-CB Feature FT:source KR013843_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctccttactcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaacttaagcaatgttttcgaaaactgcca
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaagcttttactttctcgccaacgtacaaggcctttc
tgtgtaaacagtatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctcagc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagtttggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccacacggcactcaggcaagctattctg
tgttgtggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgagcctaaaaatcagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcggacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcctttggacaaaggcattaaaccgtattgtcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattctatataagagagaaacaacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggcggagccctcaagctcagggcatattgacaacagtgcctgcagca
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963865_FT00000_P-RF-CB Feature FT:source KU963865_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964315_FT00000_P-RF-CB Feature FT:source KU964315_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ470886_FT00000_P-RF-DE Feature FT:source KJ470886_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 8117). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaagagatggggttattctctaaattttatgg
gctatgtcattggatgttggggatcattgccacaagatcacattatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtccccttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccaggcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctactagataccg
ctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtactaatttagaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtgggccccctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttacccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtgttttatataagagggaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU963860_FT00000_P-RF-CB Feature FT:source KU963860_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaagactggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MW887644_FT00000_P-RF-CB Feature FT:source MW887644_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate DD13_36947). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccarggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactacct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaatcttattggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcktcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctcctcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173320_FT00000_P-RF-CB Feature FT:source KJ173320_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate NH29M(e41)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacacatatcatcaatcttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagaacttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaaa
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatactatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatactcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagta
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU736915_FT00000_P-RF-DE Feature FT:source KU736915_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate Ethiopia_2). Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatattgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagakcctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgckgt
aaccaattttcttttgtctttgggtatacatttaaacactaacaagacaaaaagatggggttattctcttcatttcatgg
gttatgtcattggatgttggggatcattaccacaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccca
gttaacagacctattgattggaaagtgtgtcaacgaattgtgggtcttctaggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacatacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaagctgctcgggacggacaactctgttgttctttcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtctgcg
ctgaatccggcggacgacccttctcggggccgcttggggatctaccgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggatgccctagagtctcctgagcactgttcacctcatcatactgcactcaggcaagccattctt
tgttggggggacctaatgactctagctacctgggtgggtgyaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatgtgggcctaaaatttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaga
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
tcaagacattattgaaaaatgtgaacagtttgtaggccccctcacagtcaatgagaaaagaaggttgaaattaattatgc
ctgctaggttttatcctaattgtaccaaatatttgcccttggacaagggtattaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataaaagagagactacacatag
cgcctcattttgtgggtcaccttattcttgggaacaagagatacatcatggggctttcttggacggtccccctcgaatgg
gggaagaatcattccaccagcaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggacctcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgg
ggttcaccccacygcacggaggccttttggggtggagccctcaggcccagggcacaatacaaacattgccagcaaatccg
cctcctgcctctaccamtcgccagtcaggaagacagcctaccccgctgtctccacctctgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|MK534706_FT00000_P-RF-CB Feature FT:source MK534706_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate H426). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatattcccttcacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcaccaacttacaaggcctttc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccggaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgttaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagaatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY161140_FT00000_P-RF-AD Feature FT:source AY161140_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattctcctgctggtggctccagttcaggaa
cactcaaccctgttccaattattgcccctctcatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtatagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtgctccaatttgtactggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcctgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaatcgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaagagatggggttattccctgaatttcatgg
gttatgtaattggaagtaggggacataagccacaggatcatattgtacaaaacaacaaacactgttttagaaaacttcct
gccaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgttcgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggttcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcgggttctccgtctgccgtaccggtcgaccac
ggggagcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccagggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatcctcataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagcacgagatctcctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcactgctcacctcaccatacagcactcaggcaagccattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtggtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagatgtcgagaccgaggcaggttccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaatttcactgggctttattcttctactgtccctatcctcaatcctgaatggcaaaccccttcctttcctaaaattca
tttacatgaagatattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcaaagc
caattcaaacaatccagattgggacctcaaccccataaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF192837_FT00000_P-RF-DE Feature FT:source KF192837_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate TP55). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaacctgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggaccttgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatcttctagataccg
ctgcagcgctgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttgcccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtgttttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MZ097766_FT00000_P-RF-DE Feature FT:source MZ097766_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FR_HBV_173). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacataacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaattttatgg
gttatgtcattggaagttatgggtcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgmattgtgggccttttgggctttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttycgaccgaccac
ggggcgcacctctctttacgcggmctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagrtta
aagatctttgtactmggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtgsagttactctcgtttttgcctkctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctbatgaacattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggarctaatgactctagctacctgggtgggcgctaatttggaagatcmagcatctagggacctagtagtcag
ttatgtcaacactmatatgggcctaaagttcagacaamtcttgtggtttcacayttcttgtctcayktttggaagacaaa
cagttgtagaatatttggtgtctttcggagtgtggattcgcactcctccagcgtatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcrggtcccctagaagaagaactccctcgcctcgcagacgaag
rtctcaatcgccgcgtcgccgaagatctcaatctcgggaayctcaatgttagtattccttggactcataaggtgggaaac
tttacrgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccttcttttcctaatattcatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcggtctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactktgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ023666_FT00000_P-RF-GC Feature FT:source FJ023666_FT00000_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-1907). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttcaamcaagcgcttcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcatcaatctccgcgaggactggggaccttgcaccgaacatggag
aacatcacatcaggattcctcggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttattccttaaatttcatgg
gatatgtaattggaagttggggcaccttgccacaagatcatattgtacagaaaatcagaaaatgttttagaaaactccct
gttaataggcccattgattggaaagtatgtcaaagaatttcgggtcttctgggctttgctgctccctttacacaatgtgg
ttaccctgcattaatgcctttgtatgcaagtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctttcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccccttctccgtctgccgtaccggccgtccac
ggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtattgcccaaggtcttgcataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggcta
aaggtctttgtcctaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctactcgacaccg
ccgcagctctctaccgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgtcctg
tgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcatccagggatttagtagtcag
ctatgtcaatgttaatatgggcctaaagattagacaactactgtggtttcacatttcatgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggatgcgcactcctcccgcatacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
tgaggacattatcaataggtgtgaacagtttgtgggccctttgacattgaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatcctgaacacgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttcggtacccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatcccgattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctctggctcagggcatattaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964010_FT00000_P-RF-CB Feature FT:source KU964010_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacatggttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683616_FT00000_P-RF-DC Feature FT:source MN683616_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ191). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
ggtatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtacacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccagagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacatcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY161141_FT00000_P-RF-AD Feature FT:source AY161141_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatctccttgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattccatggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtatagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtgctccaatttgtactggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcctgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaatcgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaagagatggggttattccctgaatttcatgg
gttatgtaattggaagtaggggacataagccacaggatcatattgtgcacaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgttcgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggttcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctactcggaactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcgggttctccgtctgccgtaccggtcgaccac
ggggagcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccagggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatcctcataa
agaaattggagctactgtggagttactctcgtttttgccttctgacttctttccttcagcacgagatctcctagataccg
cctcagcactatatcgggaaggcctagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtggtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagatgtcgagaccgaggcaggttccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaatttcactgggctttattcttctactgtccctatcctcaatcctgaatggcaaaccccttcctttcctaaaattca
tttacatgaagatattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcaaagc
caattcaaacaatccagattgggacctcaaccccataaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KF917451_FT00000_P-RF-DC Feature FT:source KF917451_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate YN.071). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgcggacgcaaccccc
actggttggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctttctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgctagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttaccgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgtctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcgaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagcccacaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679955_FT00000_P-RF-CB Feature FT:source KU679955_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 120_K_Ngk). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagtttcgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaatccacacaaaacgaaaagatggggttattcccttcacttcatgg
gatatataattgggagctgggggaccttaccgcaagatcatattgtccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacagtctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatcagaacctttaccccgttgccaggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttyttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgcctwctgatttctttccgtctattcgcgatctcctcgacaccg
ccgccgctctgtatcgagaggccttagagtctccggaacattgctcagctcaccatacagcactcaggcaagccattctg
tgttggggsgagttaatgaayctggccacctgggtgggaagtaatttggaagaccmagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctgaaacttagacaactattgtggtttcacatttcctgtctaacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgagtggcaaactccttcttttcctgacattcacttacg
ggaggacattatcaatcggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttckgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaacccgaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcgrtcttktggggtggagcccgcaggcccagggcatrttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatcacaccacctctaagagacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF491448_FT00000_P-RF-DC Feature FT:source JF491448_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QH-29). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatctactcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatttgcggcattttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcacggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatacatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtactgacaactctgttgtcctctctcggaaat
acacctcctatccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctaccgcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF925402_FT00000_P-RF-BD Feature FT:source MF925402_FT00000_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate BD-HBV48). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaatcttctcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaacaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacagtgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatcttatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataaaggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
gaacatctggccggttgccaacaaggtaggagctggagcattcgggccagggttcacccctccccatgggggcctgttgg
ggtggagccctcaggctcagggcatactgacaacagtgccagcagcgcctcctcctgcctccaccaatcggcagtcagga
aggcagcctactcccatctctccacctctaagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464846_FT00000_P-RF-DE Feature FT:source MH464846_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MA124). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttctggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgataactcggttgtcctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgtgaccttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaactttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcctaatataca
tttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattga
tcatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacat
ctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagc
aaacaccgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcat
tcgggctgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgcca
gcaaatccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB367800_FT00000_P-RF-CB Feature FT:source AB367800_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ADVT Pt. 24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggtctttcccccac
tgtgtggctttcagttatgtggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaagatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacccaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacgtacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtgaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttagaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|FJ386578_FT00000_P-RF-CB Feature FT:source FJ386578_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1748). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctgactcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactacct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagctggtctggagcaaagcttatcggcaccgacaactctgttgtcctctctcggaaat
acacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcctcttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcatcaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctccgggcatactgacaacagtgccagtagca
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ882614_FT00000_P-RF-GC Feature FT:source FJ882614_FT00000_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate H1099/02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaaccttccaccaagctcttcaagatcccaaagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggggaccttgcaccgaacatggag
aacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttattccttaaatttcatgg
gatatgtaattggaagttggggcaccttgccacaagatcatattgtacagaaaatcagaaaatgttttagaaaactccct
gttaataggcccgttgattggaaagtatgtcaaagaatttcgggtcttctgggctttgctgctccctttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctttcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgtttggggatctaccgtccccttctccgtctgccgtaccggccgtccac
ggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtattgcccaaggtcttgcataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcamctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctactcgacaccg
cctcagctctctaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgtcctg
tgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcatccagggatttagtagtcag
ctatgtcaatgttaatatgggcctaaagattagacaactattgtggtttcacatttcatgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttgca
tgaggatattatcaataggtgtcaacagtttgtgggccctttgacagtgaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatcctgaacacgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcggaaaggc
atggggacgaatctttctgtacccaatcctctgggattttttggcgatcatcagttggaccctgcgttcagagccaactc
aaacaatccagattgggacttaaaccccaacaaggacccttggccacaagcccatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB933281_FT00000_P-RF-AG Feature FT:source AB933281_FT00000_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2010). Complete genome. [Hepadnaviridae] (length=3248 residues).
ttccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcatgcaactattgt
ggtttcacatttcctgtcttacttttgggagagagaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatattcatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF488702_FT00000_P-RF-DE Feature FT:source MF488702_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate OHBV-PCP015). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatccaggtatgttgcccgtttgtcctat
aattccaggatcctcaaccaccagcaagggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctatcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctggaagcataaattggtctgcgcaccagcaccatgcgactttttcacctctgcctaatc
atctcttgtgcatgtcctactgttcaagcctccaagctgtgcctgaggtggatttggggcatggacattgacacttataa
agaatttggagcgactgtggagatactctcatttttgtctcctgacttctttccttctctacgagatcttcttgataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctaaaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctatctttaatcctcattggaagacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgtgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MG826147_FT00000_P-RF-CB Feature FT:source MG826147_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM19H). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctaggtcccaaagtgagggccctaaaccttcctgctggtggctccagttccggaa
cagtaaacccttttccgactattgcctctcccatttcatcaatcttctcgagggctggggaccctgcaccgaacatggag
aacacaacatcgggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
ttccaattttcttttgtctttgggtatacatttaaaccctaacaaaaccaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacactgccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacgcaatgtgg
ttatcctgcattaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcactcctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggactttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatttgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaagccaggcattatttacatactctgtggaaggcgggtattttatataggagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagcggcaaccagggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgcgcagtggaa
>gnl|hbvnuc|EU871989_FT00000_P-RF-CB Feature FT:source EU871989_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-03-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcgggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccatttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873518_FT00000_P-RF-CB Feature FT:source KF873518_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 016_EA_Gap). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagygccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggttttgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctggggaagcttaccgcaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaacgaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagaktaggtta
awgrtytttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcmmgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttactattaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagyagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963870_FT00000_P-RF-CB Feature FT:source KU963870_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ478890_FT00000_P-RF-DC Feature FT:source DQ478890_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctatatttccctgctggtggctccagttcaggaa
caacaaaccctgttccgactactgcctctcccatatcgacaatcttctcgaggattggggaccctgtgcggaacatggaa
aacatcacatcacgattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgacgcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctcaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgtatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagttag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcctttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggtgacgaatctttctgttctcaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccacaaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
cgccatgcactggaa
>gnl|hbvnuc|EU939606_FT00000_P-RF-CB Feature FT:source EU939606_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C206). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcctcttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatctggaagacccagcatcccgggaattagttgtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagaaaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcctctactgtacctatctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcactatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggcatggggacgaatctt
tctgttcccaaccccctgggattctttcccgatcaccagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX357626_FT00000_P-RF-DE Feature FT:source KX357626_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate AA164ETH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaagccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacaccaacaaaaccaaaagatggggttattctctacatttcatgg
gttatgtcattggaagttggggatcattgccacaagatcatatcatactcaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctttatatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcggaactgacaactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccgcccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttcctgcggttcgagatcttctagataccg
cctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtggaaatttggacgatccagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaca
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagaggaagaggcaggtcccttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
cgaagacattctcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgaaaaaaggaggttgaaattgattatgc
ctgctaggttttatccaaaatttaccaaatatttgcccttggacaagggtattaaaccgtattatccagaacagctagtt
aatcattacttccaaactagacactatttacacactctttggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatccaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcaacctaccccgctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ386593_FT00000_P-RF-CB Feature FT:source FJ386593_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1877). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagaccccattcctgctggtggatccagttccggaacagtaaaccctgttccga
ctactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagaacacaacatcaggattc
ctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtg
gtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccccaacctccaatcactcac
caacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctg
ctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaac
taccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaac
cttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtc
cgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctat
atggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctattaccaattttcttttgtc
tttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaagtt
ggggtactttaccgcaagaacatattgtactaaaactcaaacaatgttttcgaaaattgcctgtaaatagacctattgat
tggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcctgccttaatgcc
tttatacgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatctga
acctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatggggcttggct
attggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcctgttttgc
tcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcgaaaatacacctcctttccatggc
tgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgac
ccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctctcttta
cgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccac
catgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgaccttg
aggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtactagga
ggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcct
actgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataaagaatttggagcttctgt
ggagttactctcttttttgccttccgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtatcggg
aggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttgatg
aatttggccacctgggtgggaagtaatttggaagatcaagcatccagggacttagtagtcggctatgtcaatgttaatat
gggcctaaaactcagacaactattgtggtttcacatttcctgccttacttttggaagagaaactgttcttgagtatttgg
tatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacacttccggaaact
actgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcg
cagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattct
tctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaaaggaggacattattaatag
atgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatccta
accttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagttaatcattacttcaaaact
aggcattatttacatactctgtggaaggctggcattctatataagagggaaactacacgcagcgcctcattctgtgggtc
accatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacaaatctttct
gtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcaccccctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM577664_FT00000_P-RF-DE Feature FT:source KM577664_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate NIR-2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggactcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaagaagatggggttactccctaaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtatccaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctc
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacacctacttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatcccaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacatactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggagcaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|LC279265_FT00000_P-RF-CB Feature FT:source LC279265_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_father_nail). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacactctaagcaggctttcactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcc
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JN257216_FT00000_P-RF-DE Feature FT:source JN257216_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHMQR1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtragaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgwcctggttatcgctggatgtgtckgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggcycatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcartttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgtggttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcacatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttatttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaattctg
tgctggggagaattaatgactctagctacctgggtgggtggtaatttggaagayccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggcygggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggycatgcagtggaa
>gnl|hbvnuc|KC774475_FT00000_P-RF-DC Feature FT:source KC774475_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1026). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgatgcccggcaacggtcaggtttgtcccaagtggttgaggtctcaacccac
agtggatgggggttggccataggccatcggcgcaggcgaggaacctttgtggctcctctggagatccatagtgtggtact
cctagcaacttgttttgattgcagccggtttggagtgaaactcatcggtacggacaaatattttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgttttgccaactggatcctgcgggggacgtcctttgtctacgtccggtcgccg
ttgtatcccgccggtggcccatgtcggggccggttgggtcttttcggtccccttcttcttttgccgttcccgccaaccat
ggggcgcacctccctatccggggtctccccgtttgtgccttggcatcccccggtccgtgttcacttcgcttcacctgtgc
acgttgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactagtggactctcagcaa
tgttaacgactgtccttgaggcatacttcaaagcctgtttgtttaaagaaagggaggagttgggggaggagaggaggtta
aaggtcttggtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtccccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccccgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacagcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK598652_FT00000_P-RF-DE Feature FT:source MK598652_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV_occult_VNovg25). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgtcaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caaccaccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaattttatgg
gctatgtcattggatgttatggatcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggccttttggggtttgctgccccatttacacaatgtgg
ttaccctgctttaatgcccttgtatgcatgtattcaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggatgccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaaggttgcaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacag
ggacgccttgccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggacttttgg
gctggagccctcaggctcagtgcataatacaaactttgccagcaaatccgcctcctgccttcatcaatcgtcagtcagga
aggcaggccaccccgctgtctccacctttgcgagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904430_FT00000_P-RF-DE Feature FT:source FJ904430_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate B10). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgktttatsatc
ttcctcttcrtcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgg
gttatgtcattggcagttggggatccttgccgcaagatcatatcaaacacaaaatcaaagactgtttcagaaaactccct
gttaacaggcccattgattggaaagtgtgtcaacggattgtggggcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaaagcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgatccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagccattctt
tgctggggggacttaatgtctctagctacctgggtgggagtaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctgacttttggaagagaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactccccaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttattagacgaagaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttgatattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatctaca
ccaagatattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggttgaaattgatcatgc
ctgctaggttttatcctaaggttaccaaatatttgcccttggacaagggtatcaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257191_FT00000_P-RF-DE Feature FT:source JN257191_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate WHWHD1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccytgcactgaacatggaa
aacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaacyaccagcacgggamcmtgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttwtaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacwaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccgtttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggccttct
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggayaactctgttgttytctcccgcaaat
atacatcgtayccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacatygacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattttg
tgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccaryatccagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcmagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataaaggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagctggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaacattgccagcaaatccgcctcctgtctctaccaatcgccrgtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN650085_FT00000_P-RF-DC Feature FT:source MN650085_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate KRN7708). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttaccacaatcacacatcatacaaaaaatcaaagattgttttagaaaactacct
gttaataggcctattgattggaaagtctgtcaacgaattgtgggtcttttaggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcgaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagaccgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttgacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tctacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgataaatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaactttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacatcgacaaggg
atggggacgaatctctctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873534_FT00000_P-RF-CB Feature FT:source KF873534_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 019_TI_Ngu). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagccctgcaagatcccagagtaaagggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgattactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtcccttttttccgctat
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacgaaaagatggggttattccctcaacttcatgg
gatatgtgattggcagctggggaagcttaccacaagatcatattgtgcaaaaaatcaaacactgttttagaaaactccct
gttaataggcctattgattggaaagtgtgccaacgaattgtgggtctattgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcagaact
cctggcagcttgttttgctcgcagcaggtctggagcgaaacttgtcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttggggatataccgtccccttcttcgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactatcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctattcgagatcttctcgacactg
catccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccgtggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaca
tgaagatattatcaataggtgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggaggtcttttggggtggagcccacaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatttctccaccactaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK052968_FT00000_P-RF-BD Feature FT:source MK052968_FT00000_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacacaaaatcaaactgtgttttcggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacacgcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttatccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttagagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgccccgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtattttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagtcggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683699_FT00000_P-RF-DC Feature FT:source MN683699_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ116). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggctattctctaaatttcatgg
gctatgtcattgggtgttatggttctttaccacaatcgcacatcatacaaaaaatcaaacattgttttagaaaactacct
gttgacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaaagcccttgtatgcatgtattcaatccaaacaggctttcacattctcgcacacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgagtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacg
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcatttgggc
caggattcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctcctcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY040627_FT00000_P-RF-CB Feature FT:source AY040627_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacatccttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctttctctgccgttccgaccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactgcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggactaaaaatcagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccattggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgcggaaggctggcattctatataagagggaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctctcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagca
cctcctcctgcctccacctatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ023665_FT00000_P-RF-GC Feature FT:source FJ023665_FT00000_P-RF-GC of [Viruses] Hepatitis B Virus recombinant form GC (isolate I2_M04-0033). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagcgcttcaagatcccagagtcaggggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatattgcctctcacatctcatcaatcttcgcgaggactggggaccttgcaccgaacatggag
aacatcacatcaggattcctcggacccctgctcgtattacaggcgggatttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccttaaatttcatgg
gatatgtaattggaagttggggcaccttgccacaagatcatattgtacagaaaatcagaaaatgttttagaaaactccct
gttaataggcccattgattggaaagtatgtcaaagaatttcgggtcttctgggctttgctgctccctttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtcaacaatatctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggctgtaggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagctgcctgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctttcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgtttggggatttaccgtccccttctccgtctgccgtaccggccgtccac
ggggcgcacctctctttacgcggactccccgtgtgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtattgcccaaggtattgcataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctactcgacaccg
cctcagctctgtaccgggaggctttagagtctccggaacattgttcacctcaccatacagcaatcaggcaagctgtcctg
tgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagacccttcatccagggagttagttgtcgg
ttatgtcaatgttaatatgggcctaaagtttagacaactattgtggtttcacatttcatgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacagtttgtgggccctttgacattgaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcctaacattaccaagtatttgcccttagataaaggtattaaaccttattatcctgaacacgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcggaaaggc
atggggacgaatctttctgtacccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ358155_FT00000_P-RF-CB Feature FT:source GQ358155_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J022). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacagcaacatattgtactaaaaatcaagcagtgttttcgcaaacttcct
gtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaattctgtcgtcctctctcggaaat
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcctcttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacaaccgaccttgaggcgtacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcatcatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagcatcaagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcatgtctcacatttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatactgagtggcaaactccctcttttcctgacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagattaaaattaataatgc
ctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaaccaggcattatttacatacactgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774322_FT00000_P-RF-CB Feature FT:source KC774322_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2053). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactacct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggatcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774472_FT00000_P-RF-DC Feature FT:source KC774472_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxn1020). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaattcaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534726_FT00000_P-RF-BC Feature FT:source MK534726_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate H529). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgtggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgtcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctctttttcgccttctgacttttttccttctattcgcgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactaccgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtcagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873533_FT00000_P-RF-CB Feature FT:source KF873533_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 028_TI_Ngu). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagccctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgattactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtcccttttttccgctat
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacgaaaagatggggttattccctcaacttcatgg
gatatgtgattggcagctggggaagcttaccacaagatcatattgtgcaaaaaatcaaacactgttttagaaaactccct
gttaataggcctattgattggaaagtgtgccaacgaattgtgggtctattgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttggggatataccgtccccttcttcgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactatcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttrgggcatggacattgaccmttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctattcgagatcttctcgacactg
catccgctctatatcgggaggccttagagtytccggaacattgttcacctcaccatacagcactcaggcaagctattytg
kgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaca
tgaagatattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactagacattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggaggtcttttggggtggagcccacaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatttctccaccactaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK516279_FT00000_P-RF-DE Feature FT:source MK516279_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 012/14/0533). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaagacgaaaagatggggttattctctacacttcatgg
ggtatgtcattggttgttggggatcattgccacaagagcacattttacacaagctgaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaaacgagcttttactttctcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacac
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgtacgagatcttctagacaccg
ccgcagctctatatcgggatgcgttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttgggagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaacttttcctaacatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacccttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|MN650083_FT00000_P-RF-DC Feature FT:source MN650083_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate KRN7683). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtggcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcagacaaaaaatcaaagattgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgcgtaaccaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgttgttctcgcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctgccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcaggcaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
ttcactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaacaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattactttatgactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562305_FT00000_P-RF-CB Feature FT:source FJ562305_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I191). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtgctttaccgcaagaacatattgtactaaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgccgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttayataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggacttagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KC774341_FT00000_P-RF-CB Feature FT:source KC774341_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxn1040). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgctgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcgcaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaacatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774450_FT00000_P-RF-DE Feature FT:source KC774450_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate dww1073). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagagggctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaagagatggggttactctctcaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctctaatgcccttgtatgcatgcattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttccaggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccgcagctctgtatcgggaagccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggtgaactaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
tcaagacattattaaaaaatgtgaacagtttgtaggcccactcacagtcaatgaaaaaagaagattgcaattaattatgc
ctgctaggttctatccaaaccttaccaaatatttgccattagataagggtattaaaccttactatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaagggcggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgtcaaggc
atggggacgaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB493837_FT00000_P-RF-CB Feature FT:source AB493837_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 03UC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtacaccctgttccgactattgcctctcccatctcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
agcacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacggcatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaacaaaactaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaccatattgtactaaaaatcaagcagtgttttcggaaacttcct
gtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtcaacaatatttgcacctttaccccgttgcccggcaacggtctggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcattaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaattccgttgtcctctctcggaaat
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgactggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacaaccgaccttgaggcgtacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagccttgtatcgggaggccttagagtctccggagcattgctcacctcaccatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagcatcaagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctcacatttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatactgagtggcaaactccctcttttcctgacattcatttgca
ggaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagattaaaattaataatgc
ctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaaccaggcattatttacatactctgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|AF461361_FT00000_P-RF-CB Feature FT:source AF461361_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate FH3Q). Complete genome. [Hepadnaviridae] (length=3209 residues).
ttccaccacattccaccaagctctgctagaccccagagtgaggggccttcctgctggtggctccagttccggaacagtaa
accctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaca
acatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagag
tctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccccaacct
ccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctc
ttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctctacttcc
aggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgtt
gctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggag
tgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttg
gctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaa
ttttcttttgtctttgggtatacagttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgggatatg
taattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgcaaactgcctgtaaat
agacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcc
tgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgta
aacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaacccccactgga
tggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagc
agcttgttttgctcgcagccggtctggagcggaacttatcggaaccgacaactctgttgtcctctctcggaaatacacct
ccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaat
cccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcg
cacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcg
catggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagagaactcttggactcgcagcaatgtcaa
cgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagantaggttaatgatc
tttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcatctttctcacctctgcctaatcatctca
tgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataaagaatt
tggagcctctgtggagttactctcttttttgccttctgacttttttccgtctattcgagatctccttgacaccgcctcag
ctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcacgccattctgtgttgg
ggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccaagcatccagggaattagtagtcggctatgt
caatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttc
ttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaaca
cttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaaggtctca
atcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttact
gggctttattcttctactnttcctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaaga
cattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgcctgcta
ggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagttaatcat
tacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcagcgcctc
attttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatgggg
acgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactcaaacaa
tccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattctggccagggt
tcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcct
cctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|KJ803827_FT00000_P-RF-BC Feature FT:source KJ803827_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate MY830498). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccctacacttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgacgactggggaccctgcgccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcaccggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatattgtattgggggccaagtctgtgcaacaccttgagtccctttttgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaagaaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaaagcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tatacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggaccgacaattctgtcgtcctgtcccggaaat
acacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaggacttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
ccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctgttttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtagg
ctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgctagagtatttggtgtcttttggagtgtggattcgcactcctgcaccttacagaccatcaaatgcccctatctta
tccacacttcctgagacttctgttgttagagcacggagcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcttccgtacctgtctttaatcccgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtgggccctcttacagttaacgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccatactaaatatttgcccttagataagggcattaaaccttattatcctgagcatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtgttttatacaagagggaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattcttccccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtggggtcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagtg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377594_FT00000_P-RF-CB Feature FT:source GQ377594_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J152). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatgggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgrccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagcccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacagctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774461_FT00000_P-RF-DC Feature FT:source KC774461_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dxa1577). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagcaaaccctgttccgattactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
atatcctgcgttgatgcctttatatgcatgtatacaggccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaaccttgtaaacgttgcccggcaacggtcaggtctgtcccaagtatttcatgactcaaccccc
aatggatgggggcagcccacaggccatgggggcaggcgaggaacctttgtggctcctgtggcgatccatagtgtggtact
cctatcagcttgttttgattgcaaccggtttggagcgatagtaatcggtacggacaaatattttgtcctctctcggaaat
acacctcctttccatggctgctaggtcgtgttgccaactggatcctgcgcgggacgtcctttttctacgtccggtggccg
ttgtatccggccgacgacccgtgtcggggccggatgggtcttttcggtcccgtttgtgttttgccgttcccgctgctcat
ggggcgcacctctctctcaggggtctcaccgttcgttccttgttctcccccggaccgtgtgcacttcgcttcacctgtgc
gcgttgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcacccataagaggactattggactctcagcaa
ggttaacgactctccttgaatcatacttcaaagcctgtttgcttaaagactgggaggagtttggagaggagattaggtta
aaggtgaggggactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggaggttaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgtcaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacattgccagcagca
cctcctcctgccgccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH464851_FT00000_P-RF-DE Feature FT:source MH464851_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate MA129). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaacttccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtatttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggaagttatgggtctttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgtgaccttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaactttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcctaatataca
tttacatgaagacattatcaaaaaatgtgaacagtttgtaggcccactcayagttaatgagaaaagaagattgcaattga
ttatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacat
ctagttaatcattacttccaaactagacactatttacacacactatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagc
aaacaccgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcat
tcgggctgggtttcaccccaccacacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgcca
gcaaatccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KX660684_FT00000_P-RF-DC Feature FT:source KX660684_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetShannan-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggagtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgccggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtagacatttaaaccctaataaaactaagcgatggggttattctctaaatttcatga
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacaaaaaatcaaagattgttttagaaaactccct
gttaataggcctattgattggacagtccgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcccctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaattctgttgttctcgcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttggtagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttcttctgtacctgtctttaatcctcagtggcaaactccttcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacctttggacaaaggcattaaaccgtattatcctgaacaagcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534663_FT00000_P-RF-CB Feature FT:source MK534663_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate D509). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaagctctacaagatcccagaatcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcatcaatcttcgcgaggattggggaccctgcaacgaacatggag
aacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttgtggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaactaaaagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacaaaaaatcaaacaatgttttagaaaactccct
gttaacaggcccattgattggaaagtatgtcaaagaatttcaggacttttgggctttgctgctcctttcacacaatgtgg
ttaccctgctttaatgcctttatatgcatgtatacaagccaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagccgcctgttttgctcgcagcaggtctggagcaaaccttatcgggactgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcgtcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgcgatctcctcgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagcagttttg
tgttggggtgagttaatgactctagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctgaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtctttcggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactcataaggtgggaaac
tttaccgggctttattcttctactatacctgtctttaatccggaatggcaaactccttcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattagtcatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacaggcagtt
aatcattacttcaaagctagacattatttacatactctgtggaaagcgggcattctatataagagagaaacaacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatactaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683638_FT00000_P-RF-DC Feature FT:source MN683638_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ29). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtggtacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcctgtgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU833890_FT00000_P-RF-GA Feature FT:source EU833890_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate 6). Complete genome. [Hepadnaviridae] (length=3248 residues).
ttccactgccgtccaccaagctctgcaggatcccagagtcaggggtctgaattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcgaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatattgatgatattgtattgggggccaaatctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccttaaattttatgg
gatatgtaattggaagttggggtactttgccacaagaacacatcacacagaaaattaagcaatgttttcggaaactcccc
gttaacaggccaattgattggaaagtctgtcaacgaataactggtctgttgggtttcgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacctataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccaccggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcagggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccaagcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgcctggggtggctttagggcatggatagaataactttgcc
gtatggcttttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagaatcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagctacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
gatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactactcctgtctttaatcctga
ttggcaaactccttcttttccaaatatccatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaacatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacagtccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagtgggagcattcgggccagggctcacccctccacacggaggccttttggggtggagccctcag
gctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcc
catctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ803785_FT00000_P-RF-CB Feature FT:source KJ803785_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY34920). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
actaccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatctaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaagcaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
gtatccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaaacctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcctctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggaccttctcgacaccg
cctctgctctgtgtcgggacgccttagagtctccggaacatgtttcagctcaccatacagcactaaggcaggctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctcaaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcttcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttaccgttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttagataaaggtatcaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttccgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatctttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534729_FT00000_P-RF-BC Feature FT:source MK534729_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate H533). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgtggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactaccgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtcagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgactggcaaaccccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcgggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM750144_FT00000_P-RF-DC Feature FT:source HM750144_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate QHX-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactccgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattctctaaatttcatgg
gctatgtcattgggtgttatgggtccttgccacaatcacacatcatacacaaaatcaaagattgttttcgaaaactccct
gttaacaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctggccgcttgttctgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttctcgcccgcaaat
atacttcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccat
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcgcctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggcgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagcagtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactcttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcgcctcgcagacgaag
gtcccaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534585_FT00000_P-RF-CB Feature FT:source MK534585_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 505). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaccaagctctactagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtcattggaagttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcgggaccgacaactctgtcgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactaccgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgtcagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatccgctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN507850_FT00000_P-RF-DE Feature FT:source MN507850_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate 2526_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcgaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaagaagatggggttactccctaaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaataggccaattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtatccaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcaagggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctc
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacacccacttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatcccaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacatactctatggcaggcgggtatattatataagagagaaaccacacatag
cgcctcattttgtgggtcaccatattcttgggagcaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcataatacacactgtgccagcaaatccgcctcctgcctccgccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774364_FT00000_P-RF-BC Feature FT:source KC774364_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate blz2088). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtagaaaaaatcaacatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggctaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccccttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963861_FT00000_P-RF-CB Feature FT:source KU963861_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ097745_FT00000_P-RF-DE Feature FT:source MZ097745_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FR_HBV_141). Complete genome. [Riboviria] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacaycacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggraactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgagcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtactaaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgcgcaccagcaccctgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggrcatggacatcgacccttataa
agaatttggagcttccgtggagttactctcgtttttgcctsvtgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagtatctagagacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctaaatcgccgcgtcgcagaagatctcaatctmgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagaytgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttactatccagaacatctagtt
gatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggcccgacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccaacaaatccgcctcctgcatccaccaatcgccagtcaaga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcargccatgcagtggaa
>gnl|hbvnuc|JF440002_FT00000_P-RF-DE Feature FT:source JF440002_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FEN43). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
catgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggccttagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaatcgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgctacacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactggggggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacttgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatccta
tcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacatcatcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccacttacagtgaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774422_FT00000_P-RF-DC Feature FT:source KC774422_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dlz1044). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctgtaccgtccccttctacatctgccgttccggccaacctc
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcgtttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcacattcatttaca
ggaggacattcttaatagatgtcaacaatatgtaggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacacgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgggggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacagcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645035_FT00000_P-RF-CB Feature FT:source MT645035_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HB25). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtggggcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacggcgaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttctgctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ478898_FT00000_P-RF-DC Feature FT:source DQ478898_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate CHN-QH38). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactttgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcactgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaatctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgaggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctatacgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacatacatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatccggaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacagcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ904416_FT00000_P-RF-DE Feature FT:source FJ904416_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A66a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcactttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgg
gttatgtcattggctgttggggatcattgccgcaagatcatatcctacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcccattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatacagcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggactgacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtctaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgtctctagctacctgggtgggagcaaatttagaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcactttcggaagagata
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatctta
tcaacacttccggagacttctgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctagcagacgaag
gtstcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
tcaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaaccaatgagaaaagaaggttgcaattgattatgc
ctgctaggttttatcctaagcataccaaatatctgcccttggacaagggtatcaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggatttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagcgggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttcaaccaatcgccagtccgga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|KY470854_FT00000_P-RF-DC Feature FT:source KY470854_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 15-8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttcctccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatctcctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaacacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaaacatctctatgtatccct
cctgttgctgtacaaaaccttcggccggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcaccttgagtccctttttaacgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatagaattggaagttggggtactttaccacaggaccatattgtacacaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaaccttcaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcacctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctattcgcgatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagatattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaactagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtaggccctcttactgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttggacaagggcattaaaccgtattatcctgaacgtgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcatcctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagtgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtcgagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctca
ggccgtacagtggaa
>gnl|hbvnuc|JQ707461_FT00000_P-RF-GA Feature FT:source JQ707461_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC3_C15). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagtt
atataagaggactcttggactgtttggtatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagt
gggaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgggccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagaggcctctgatcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctgtat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcaaatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ173279_FT00000_P-RF-CB Feature FT:source KJ173279_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX004C(e207)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacggtggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggagccttcgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttaca
ggaggacattattaatagatgtcagcaatatgtgggccctcttacagttaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683650_FT00000_P-RF-DC Feature FT:source MN683650_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ41). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacacattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873523_FT00000_P-RF-CB Feature FT:source KF873523_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 055_WA_Oen). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccagcaagctctgctcgatccgagagtaaggggtctgtatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatctycacgaagactggggaccctgcaacgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccccacaaaacgaaaagatggggttattccctcaacttcatgg
gctatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacattgttttaggaaacttcct
gtcaataggcctattgattggaaagtgtgccaaaggattgtgggtctattgggctttgctgctccattcacacaatgtgg
atatcctgccttgatgcctttgtatgcatgtatacattctaaacaagctttcaccttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatagggcatcagcgcatgcggggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcctgtttcgctcgcagccggtctggagcgaamcttctcggcaccgacaactcagttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggrctgtaccgtccccttcttcgtctaccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
catccgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagmwattttg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcaayagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctacccttaccaaatatttgcctttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaacyaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtctgttggggtggagcccgcaggcccagggcatattgacaacggtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacaacccactcccatctcaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534566_FT00000_P-RF-BC Feature FT:source MK534566_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 457). Complete genome. [Riboviria] (length=3215 residues).
ctccaccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacgttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgcgatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagcagttttg
tgttggggtgagttaatgactctagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagttag
ctatgtcaatgttaatatgggcctgaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtctttcggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgtacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MN683588_FT00000_P-RF-DC Feature FT:source MN683588_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate XZ118). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacggtggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacacaaactcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtctgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaagctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaatcagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ904396_FT00000_P-RF-DE Feature FT:source FJ904396_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate A12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaaatctgcaagatcccagagtgagagacctgaattcccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgg
gttatgtcattggctgttggggatcattgccgcaagatcatatcatacacaaaatcaaagactgtttcagaaaactccct
gttaacaggcccattgattggaaagtatgtcaacggattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaaagcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaatttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtagttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaakcttgcccaaggtcttacataagaggactcttggactctctacaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
acctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agagtttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcactgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggagcaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaca
ccgtcgtagagtatttggtgtctttwggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttatcctaagtttaccaaatatttgcccttggacaagggtatcaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagccacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
gttggagccctcaggctcagggcataatacaaaccttgccagcaaaaccgcctcctgcctccgccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcckcaggccacgcagtggaa
>gnl|hbvnuc|KX357635_FT00000_P-RF-DE Feature FT:source KX357635_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate GD39ETH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaagccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacaccaacaaaaccaagagatggggttattctctacatttcatgg
gttatgtcattggatgttggggatcattgccacaagatcatatcatactcaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcggaactgacaactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggttcgagatcttctagataccg
cctcagccctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattctcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgaaaaaagaaggttaaaattgattatgc
ctgctaggttttatccaaattttaccaaatatttgcccttggacaagggtattaaaccgtattatccagaacagctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatccaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT645071_FT00000_P-RF-CB Feature FT:source MT645071_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH3). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaacaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattggggaccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
ggtatgtaattggaagttggggcacattgccacaggaacatattacacagaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tacgtaatcagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccatccatccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccccaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcagagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggcggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774443_FT00000_P-RF-DC Feature FT:source KC774443_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate dww1036). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtgaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaccatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaagccaagcaggctttcactttctcgctaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaatcccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC875338_FT00000_P-RF-DE Feature FT:source KC875338_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate HBV4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaatgagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcggccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaa
tgtcaatgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcaactgtggagttactctcatttttgccttccgatttctttccgtctgtccgagatcttctagataccg
cctcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactttagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagacagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|MZ097721_FT00000_P-RF-DE Feature FT:source MZ097721_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate FR_HBV_110). Complete genome. [Riboviria] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggatactctctaaattttatgg
gctatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgcattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattatcgggactgataactctgtcgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtagtaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccctataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatagggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaagattaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaactttgccagcaactccggctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FN594767_FT00000_P-RF-DE Feature FT:source FN594767_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate bne127). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaacattccaccaagctctgcaggatcccagagtaagaggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
acttccaggatcgtcaactaccagcacgggaccctgcmgaacctgcacgactcttgctcaaggaacctctatgtttccct
catgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctyctrgctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gmtatgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggactgataattctgtcgttctctcccggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaactcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctcatgacttctttccttcrgtaaaagatcttctagataccg
cctcagctctgtatcgggatgccttagaatctcctgagcattgttcacctcaccacactgcactcaggcaggcaattgtt
tgctgggggaacataatgactctagctacctgggtgggtgtgaatttggaagatcaagcatccagggacctactagtcag
ttatgtcaatactmatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagacaaa
tcgtcatagagtacttggtgtcgttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaat
tttacggggctttactcttctactatacctgtctttaatcctaactggaaaactccatcttttcctgatattcatttgca
ccaggacattattaacaaatgtgagcaatttgtaggtcctttaacagtaaatgaaaaacgaagattaaacttagtcatgc
ctgctagattttttcccatctctacgaaatatttgcccctagagaaaggtataaaaccttattatccagataatgtagtt
aatcattacttccaaaccagacactatttacataccctgtggaaggcgggcatcttatataaragagaaactacacgtag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacatcatggggctttcttggacggtccctctcgaatgg
gggaagaatcattccaccaccaatcctctgggattttttcccgaccaccagttggatccagcattcagagcaaacaccag
aaatccagattgggaccacaatcccaacaaagaccgctggacagaagccaacaaggtaggagtgggagcattcgggccgg
ggttcactcccccacacggaggccttttggggtggagccctcaggctcaaggcatgcaaaaaacattgccagcagatccg
cctcctgcctccaccaatcggcagtcaggaaggcagcctaccccaatcactccacctttgagagacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|JQ707448_FT00000_P-RF-GA Feature FT:source JQ707448_FT00000_P-RF-GA of [Viruses] Hepatitis B Virus recombinant form GA (isolate MC1_C42). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttcccctgctggtggctccagttcaggaacagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcga
ggactggggaccctgtggcgaacatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggagtgcc
cgtgtgtcctggcctaaattcgcagtccccaacctccaatcactcaccaatctcctgtcctccaacttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcctcgaccaccagtacgggaccctgcaaaacctgcacgac
ttctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggttattccctaaacttcatgggttacataattggaagttggggaactttgccacaggatcatattgtacaaa
agatcaaacactgttttagaaaacttcctgttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
ggctttgctgctccatttacacaatgtggatatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaac
tgacaattctgtcgtcctctcgcggaaatatacatcgtttccatggctgctaggctgtactgccaactggatccttcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccc
cttctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagtt
atataagaggactcttggactgtttgttatgtcaacaaccgggatggagaaatacttcaaggactgtgtttttgctgagt
gggaagaattaggcaatgagtccaggttaatgatttatgtattaggaggctgtaggcataaattggtctgttcaccagca
ccatgcaactttttcacctctgcctaatcatctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtgg
ctttagggcatggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaatttggagctac
tgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtacc
gggaatccttagagtcctctgagcattgttcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttg
atgactctagctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattatgttaatactaa
tatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggag
actactgttgttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcg
tcgcagaagatctgcatctccagcttcccaatgttagtattccttggactcacaaggtgggaaactttacggggctatat
tcttctactatacctgtctttaatcctgattggcaaactccttcttttccaaatatacatttgcatcaagacattataac
taaatgtgaacaatttgtgggccctctcacagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcc
caaactctactaaatatttaccattagacaaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccag
accagacattatttacataccctttggaaggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgg
gtcaccatatacttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctt
tctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctc
cacacggaggccttttggggtggagccctcagtctcagggcacactaacaactttgccagcaaatccgcctcctgcctcc
accaatcgtcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT591275_FT00000_P-RF-DE Feature FT:source MT591275_FT00000_P-RF-DE of [Viruses] Hepatitis B Virus recombinant form DE (isolate BM-2025). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaaggtggggttattctctacattttatgg
gttatgtcattggaagttggggatctttgccgcaagatcatatcagatacaaaatcaaagaatgtttccgaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggcgataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacatcctcgggactgacaactctgtggttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctaccgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataacaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgtgaatttggaagatcaatcttccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaaagaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgcacctgtctttaaccctcagtggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggttaaaattgattatgc
ctgctaggttttatcctaatgttaccaaatatttgcccttggacaagggtatcaaaccctattatcccgaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccccacggaggcctgttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatcctcctcctgcctccaccaatcgccagttagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU695743_FT00000_P-RF-CB Feature FT:source KU695743_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5073). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtccatcttctcgaggactggggaccctgcaccgaacatggag
aataccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagagatggggctattcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgcccacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaactccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaacattctcggaaccgacaactctgtcatcctctctcggaaat
acacctcatttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtccctgtctttaatcctgagtggcaaaccccctcttttcctgacattcatttacg
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttagataaaggcattaaaccttattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagcgagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaagtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279266_FT00000_P-RF-CB Feature FT:source LC279266_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_father_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacactctaagcaggctttcactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcc
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttatactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF925404_FT00000_P-RF-AC Feature FT:source MF925404_FT00000_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate BD-HBV50). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccctgcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB674504_FT00000_P-RF-DC Feature FT:source AB674504_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate 11B18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccatttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggaaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaggcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctttctcggaaat
acaccgcctttccatggctgctaggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagaatatttggtgtcctttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcggac
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccgcctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX660674_FT00000_P-RF-DC Feature FT:source KX660674_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate TibetAli-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacaggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcartggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactctaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattacct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaatccaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtgggtcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactrttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattttg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY629632_FT00000_P-RF-DC Feature FT:source KY629632_FT00000_P-RF-DC of [Viruses] Hepatitis B Virus recombinant form DC (isolate GSK1901). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacattacatcaggactcctagcacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatataa