HBVdb

Dataset for nucleotide sequence Genomes of genotype RF

[Download (right click)] [Alignment] [Repertoires]

798 sequence(s)

>gnl|hbvnuc|AB033557_FT00000_P-RF-CB Feature FT:source AB033557_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate IWK146). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacgacattccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcatcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggccttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactcaaaatcaaacaatgttttcggaaactgcct
gttaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgccaggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgtttcgctcgcagccggtctggagcgaatcttatcggcactgacaactctgttgtcctgtctcggaaat
acaccgccttcccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcttccgtacctgtctttaatcctgattggcaaactccctcctttcctcatattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgctaggttctaccctaacattaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB105172_FT00000_P-RF-CB Feature FT:source AB105172_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hawaii 2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaatttccaccaagctctgctagatcccagagtgagaggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggcaccctgccacaggaacatattgtactaaaaatcaaacagtgttttcgaaaacttcct
gtaaatcggcctattgattggaaggtgtgtcaaagaattgtgggacttttgggatttgctgctcctttcacacaatgtgg
gtatcctgctctcatgcctttgtatgcatgtatacacactaaacaggctttcactttttcgccaacttacaaggcctttc
tgtatcaacaatatctgcacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctttaggccatcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaattctgttgtcctctctcggaaat
acacctcctttccatggctgctaggttgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccctacttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagtga
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctattcgagatctcctcgacaccg
catcagctttgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagccctcagacaagctgttctg
tgttggggtgagttaatgaacctggctacctgggtgggaagtaatttggaagacccagcatccagggaactagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctgtctcacatttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacccgtctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattatcaatagatgtcagcaatttgtgggccctcttacagttaatgaaaagcggagattaaaattaatcatgc
ctgctaggttctatcctaatcttaccaaatacttgccattagataagggcattaaaccttattatcctgatcatgcagtt
aatcattacttcaaaactagacattatttacatactctatggaaggctggtattctatataagagagaaactacccgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaacccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggaacgggagcattcgggc
cagggttcacacccccacacggaggtcttttggggtggagccctcaggctcagggcatagtgacgacagtgccagcagtg
cctcctcctgcctcaaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB194949_FT00000_P-RF-AE Feature FT:source AB194949_FT00000_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate CMR151). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatcttcctgctggtggctccagttcaggaa
cagtaagccctgttccgaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgcttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttatgtaattggaagttgggggtcattacctcaggaacacatcagaatgaaaatcaaagactgttttagaaaactccct
gttaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgctttaatgcctctgtacgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcccggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctatatcgggaagcactagagtctcctgagcattgctctcctcaccatacggcactcaggcaagccactcta
tgctggggggagttaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaactgttgtggtttcatatttcttgccttacttttggaagagaaa
ctgtacttgagtatttggtctcttttggagtgtggattcgcactcccccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
gggaattttactgggctttattcttctactgtacctatctttaatcctgaatggcaaactccttcttttcctaagattca
tttacatgaggacattattaatagatgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctaacagcaccaaatatttgccactagacaaaggaattaaaccttattatcctgatcat
gtagttaatcattacttccaggcccgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttcgtcaccaaaacctcgc
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggactacaaccccatcaaagaccactggccacaagccaatcaggtaggagtgggagcat
tcgggccagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacggtgcca
gcagttcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacctctaagagacagtca
tccgcaggccgtgcagtggaa
>gnl|hbvnuc|AB367393_FT00000_P-RF-CB Feature FT:source AB367393_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate LAMr Pt. 2/Adefovir-treated Pt. 2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaacagacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcc
ctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaagctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcataaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB453985_FT00000_P-RF-AC Feature FT:source AB453985_FT00000_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate JPN_CH7). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacaggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcaaaatctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacgtaattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagccggtctggagcaaagatcatcggaactgacaactctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggaactgggggaggagattaggtta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttaatctcgtttttgcctcctgacttctttccttccatcagagatctcctagacaccg
cctcagctctgtatcgagaagccttagagtcttctgagcattgctcagctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctaactgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagctcaggcaaatattgtggtttcacgtatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattgacaggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctactcacactaaatatttgcccttagacaaaggaattaaaccttattatcctgatcag
gtagttaatcattacttccaaaccagacattatttacatactctttgggaggctggtattctatataagagagaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
tcgggccagggctcacccctccacacggcggtattttggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB933279_FT00000_P-RF-AG Feature FT:source AB933279_FT00000_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2008). Complete genome. [Hepadnaviridae] (length=3248 residues).
ttccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagagaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatattcatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB933280_FT00000_P-RF-AG Feature FT:source AB933280_FT00000_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Tk/JP/2009). Complete genome. [Hepadnaviridae] (length=3248 residues).
ttccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatattcatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB933281_FT00000_P-RF-AG Feature FT:source AB933281_FT00000_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2010). Complete genome. [Hepadnaviridae] (length=3248 residues).
ttccactgccttccaccaaactctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagtgcccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccttttacccaatgtgg
ttaccctgccttaatgcctttgtatgcatgtatacaagctaagcaggcttttactttctcgccaacttataaggcctttc
tctgtaaacaatacatgaacctttaccccgttgctaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcattgggactgacaattctgtcgtcctttctcggaaat
atacatcctttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccagcggacgacccctcccggggccgtttggggctctgtcgcccccttctccgtctgccgttcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttacatggaaaccgccatgaacacctctcatcatctgccaaggcagttatataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcatgcaactattgt
ggtttcacatttcctgtcttacttttgggagagagaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtc
ccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagatctgcatctccagcttccc
aatgttagtattccttggactcacaaggtgggaaactttacggggctgtattcttctactatacctgtctttaatcctga
ttggcaaactccttcttttccaaatattcatttgcatcaagacattataactaaatgtgaacaatttgtgggccctctca
cagtaaatgagaaacgaagattaaaactagttatgcctgccagatttttcccaaactctactaaatatttaccattagac
aaaggtatcaaaccgtattatccagaaaatgtagttaatcattacttccagaccagacattatttacataccctttggaa
ggcgggtattctatataagagagaaacatcccgtagcgcttcattttgtgggtcaccatatacttgggaacaagatctac
agcatggggctttcttggacggtccctctcgagtggggaaagaacctttccaccagcaatcctctaggattccttcccga
tcaccagttggacccagcattcagagcaaataccaacaatccagattgggacttcaatcccaaaaaggacccttggccag
aggccaacaaggtaggagttggagcctatggacccgggttcacccctccacacggaggccttttggggtggagccctcag
tctcagggcacactaacaactttgccagcagatccgcctcctgcctccaccaatcgtcagtcagggaggcagcctactcc
catctctccaccactaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB933282_FT00000_P-RF-AG Feature FT:source AB933282_FT00000_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2011). Complete genome. [Hepadnaviridae] (length=3257 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggactggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaacccctaacaaaacaaaagatgggggttattccctaaacttcatgg
gttacataattggaagttggggaagtttgccacaggatcatattgtacaaaagatcaaacactgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggcctatctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcttatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacgggaccgagg
caggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcagaagatctcaatctcggg
aatctcaatgttagtattccttggactcataaggtgggaaactttacggggctttattcctctacagtacctatctttaa
tcctgaatggcaaactccttcctttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggcc
ctctcactgtaaatgaaaagagaagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgccc
ttagacaaaggaattaaaccttattatccagatcaggtagttaatcattacttccaaaccagacattatttacatactct
ttggaaggctggtattctatataagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaag
agctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggatt
ctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggacc
actggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtgg
agccctcaggctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggca
gcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB933283_FT00000_P-RF-AG Feature FT:source AB933283_FT00000_P-RF-AG of [Viruses] Hepatitis B Virus recombinant form AG (isolate Os/JP/2013). Complete genome. [Hepadnaviridae] (length=3257 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcgtcaatctccgcgaggaytggggaccctgtgacgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggakyrcccgtgtgtcytggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttrttggttcttctggaytatcaaggtatgttgcccgtttgtcctct
rattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtwtccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtytggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcktgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaackttgccacaggatcatattgtacaaaagatcaaacactgtttyagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctckcggaaat
atacatcgtttccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccakccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggcgaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactgtttgtta
tgtcaacaaccggggtggagaaatacttcaaggactgtgtttttgctgagtgggaagaattaggcaatgagtccaggtta
atgacctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatagaacaactttgcc
atatggcctttttggcttagacattgacccttataaagaatttggagctactgtggagttgctctcgtttttgccttctg
actttttcccgtctgttcgtgatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactctagccacctgggtgggtaataa
tttggaagatccagcatccagagatttggtggtcaattatgttaatactaatatgggtttaaaaatcaggcaactattgt
ggtttcacatttcctgtcttacttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
cctcctgcctatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacgacsggaccgasg
caggtcccctagaagaagaactccctcgcctcgcagacgcagatctcaatcgccgcgtcgcasaagatctcaatctcggg
aatctcaatgttagtattccttggactcataaggtgggaaactttacggggctttattcttctacagtacctatctttaa
tcctgaatggcaaactccttcctttcctaagattcatttacaagaggacattattaataggtgtcaacaatttgtgggcc
ctctcactgtaaatgaaaagagaagattgaaattaattatgcctgctagattttatcctacccacactaaatatttgccc
ttagacaaaggaattaaaccttattatccagatcaggtagttaatcattacttccaaaccagacattatttacatactct
ttggaaggctggtattctatataagagggaaaccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaag
agctacagcatgggaggttggtcatcaaaacctcgcaaaggcatggggacgaatctttctgttcccaaccctctgggatt
ctttcccgatcatcagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccatcaaggacc
actggccagcagccaaccaggtaggagtgggagcattcgggccagggctcacccctccacacggcggtattttggggtgg
agccctcaggctcagggcatattgaccacagtgtcaacaattcctcctcctgcctccaccaatcggcagtcaggaaggca
gcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AF330110_FT00000_P-RF-CB Feature FT:source AF330110_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 975484). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactctcttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcttctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacrgccctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY161140_FT00000_P-RF-AD Feature FT:source AY161140_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattctcctgctggtggctccagttcaggaa
cactcaaccctgttccaattattgcccctctcatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtatagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtgctccaatttgtactggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcctgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaatcgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaagagatggggttattccctgaatttcatgg
gttatgtaattggaagtaggggacataagccacaggatcatattgtacaaaacaacaaacactgttttagaaaacttcct
gccaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgttcgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggttcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcgggttctccgtctgccgtaccggtcgaccac
ggggagcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccagggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatcctcataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagcacgagatctcctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcactgctcacctcaccatacagcactcaggcaagccattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtggtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagatgtcgagaccgaggcaggttccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaatttcactgggctttattcttctactgtccctatcctcaatcctgaatggcaaaccccttcctttcctaaaattca
tttacatgaagatattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcaaagc
caattcaaacaatccagattgggacctcaaccccataaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY161141_FT00000_P-RF-AD Feature FT:source AY161141_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtatctccttgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattccatggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtatagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtgctccaatttgtactggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcctgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaatcgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaaatctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaagagatggggttattccctgaatttcatgg
gttatgtaattggaagtaggggacataagccacaggatcatattgtgcacaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgttcgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggttcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctactcggaactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttggggctgtatcgtcgggttctccgtctgccgtaccggtcgaccac
ggggagcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcaggtcctgcccagggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatcctcataa
agaaattggagctactgtggagttactctcgtttttgccttctgacttctttccttcagcacgagatctcctagataccg
cctcagcactatatcgggaaggcctagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtggtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagatgtcgagaccgaggcaggttccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcttcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaatttcactgggctttattcttctactgtccctatcctcaatcctgaatggcaaaccccttcctttcctaaaattca
tttacatgaagatattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactgaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcaaagc
caattcaaacaatccagattgggacctcaaccccataaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY161145_FT00000_P-RF-AD Feature FT:source AY161145_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaactttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagcttcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
tacctcttcatcctgcatgcatgcctcatcttcttattagttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatctggtactgggggccaagtctgtacaacatcttgagtccctttatatcgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggaacattgccacaggatcatattgtacaaaaaatcaaaaattgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgcattaatgcctttatatgcatgcatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taggtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgttcgctgacgcaaccccc
actggctggggcttggccatcggccatcagtgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgttctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtccccttctccgtctgccgtacccgccgaccac
ggggcgcacctctctttacgaggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactccccgcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttagggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctcctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtggtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttactgggccttattcttcatctgtccctatctttaatcctgaatggcaaaccccttcgtttcctaaaattcatttaca
tgaagatattatcaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaattatgc
ctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaggtattt
aatcattactttcaagcccgacattatttatatactctttggaaggctgggattctatataagagggaaactacacgtag
cgcttcattttgcgggtcactatattcttgggaacaagagctacatcatgggaggttggacatcaaaacctcgcaaaggc
atggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcatttgggc
cagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccagcagtg
cctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY161146_FT00000_P-RF-AD Feature FT:source AY161146_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaactttccaccaagctctacaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagcttcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
tacctcttcatcctgcatgcatgcctcatcttcttattagttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatctggtactgggggccaagtctgtacaacatcttgagtccctttatatcgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggaacattgccacaggatcatattgtacaaaaaatcaaaaattgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttatcctgcattaatgcctttatatgcatgcatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taggtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgttcgctgacgcaaccccc
actggctggggcttggccatcggccatcagtgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgttctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggatacttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcgaggccgcttgggactgtatcgtccccttctccgtctgccataccgtccgaccac
ggggtgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactccccgcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttagggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctcctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtggtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttactgggccttattcttcatctgtccctatctttaatcctgaatggcaaaccccttcgtttcctaaaattcatttaca
tgaagatattatcaataggtgtcaacaatttgtaggccctctcactgtaaatgaaaagagaagactaaaattaattatgc
ctgctaggttttaccctaacagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaggtattt
aatcattactttcaagcccgacattatttatatactctttggaaggctgggattctatataagagggaaactacacgtag
cgcttcattttgcgggtcactatattcttgggaacaagagctacatcatgggaggttggacatcaaaacctcgcaaaggc
atggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcatttgggc
cagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgccagcagtg
cctccttctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY206374_FT00000_P-RF-CB Feature FT:source AY206374_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttcctccaaactctgctagatcccaaagtaaggggcctttactttcctgttggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaacctccggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattatactaaaaatcaaacaatgttttcggaaacttcct
gtaaataggccaattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgcaccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtactgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggatctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccgccaggtcttgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctctggagttactctcttttttgccttctgacttctttccttccattcgtgatcttctcgacaccg
cctccgctctgtatcgggaggctcttgagtctccggaacattgttcacctcaccatacagcactcaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacgtttggaagagata
ctgttattgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggcaac
tttactgggctttattctcctactgcacctgtctttaatcctgagtggcaaactccctcctttcctcacgtacatttgaa
ggaggacattatcgatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaataatgc
ctgctaggttctatcccaaccttaccaaatatttgccattagataaaggcatcaaaccttattatcctggacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtccccatattcttgggaacacgagctacatcatgggaggttggtctgccaaacctcggaaaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaagcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|AY233277_FT00000_P-RF-AC Feature FT:source AY233277_FT00000_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate 1848). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
tactcaaccctgttccaaatactgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggctcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattaccaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
tacccattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gatatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttaggaaacttcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgccttaatgcctttgtgtgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taaatcaacagtatatgaacctttaccccgttgcccggcaacggtctggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggctataggccaccagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgttccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggaaaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctccggagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcagacaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactcataaggtg
ggaacttttactgggctttattcctctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctttaactgtaaatgaaaagagaagattaaaattaa
ttatgcctgctagattttatcctaacagcaccaaatatttgcctctagacaaagggattaagccttattatccagatcaa
gtagttaatcattacttccagaccagacattatttacatactctttggaaggctgggattctatataagtgggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcaacaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggctacagtgcca
acagttcctcctcctgcctccaccaatcggctgtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AY247030_FT00000_P-RF-CB Feature FT:source AY247030_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate KUHB81). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccatcaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtgctaaaactcaagcaatgttttcggaaactacct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccgacttacaaagcctttt
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgaggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctagacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcacatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggcagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EF103283_FT00000_P-RF-AD Feature FT:source EF103283_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran105). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacagctttccaccaagctctgcaagatcccacagtcaggggactgtattttcctgctggtggctccagttcacgaa
cactcaaccctgttccaactattgcctctcacatctcgacaatctcctcgaggattgcggaccctgcgacaaacatgcac
aagatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttatcttgttgacaagaatcctctctctacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcacagaatgttttaaaaaacttcct
gttaacaggcctattgattggaaggtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtatgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaaactttcggactcctctgccaatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagttaatgactcttgctacctgggtgggtgttaacttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcacactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EF103284_FT00000_P-RF-AD Feature FT:source EF103284_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate Ran113). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cacacaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggattggggaccctgcgccgaacatggag
aacatcacatcacgattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctatggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gctatgtcattggatgttatggttcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtacgcctgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgtacacctcaccatacggcactcaggcaagcaattctt
tgctggggagaattaatgactctagctacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagctaatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttacctttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccagcgcacggaggccttctgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EF494376_FT00000_P-RF-CA Feature FT:source EF494376_FT00000_P-RF-CA of [Viruses] Hepatitis B Virus recombinant form CA (isolate TW706). Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagggacctatactttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacgacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcgaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtccccttcttcgactgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccatgtattgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttccgtcagagatctcctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcatcgctcacctcaccatactgcactcaggcaagcaattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagaga
ctgtacttgaatatttggtctctttcggagtgcggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttctggaaactactgttgttagacgacgggaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttactgggctttattcctctacagtacctatctttaatcccgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaataggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttcaaaaccagacattatttacatactctttggaaggctggtattctatataagagagaaactac
acgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcga
aaaggcatggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagc
caactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcat
tcgggccagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgcca
gtagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtca
tcctcaggccataaagtggaa
>gnl|hbvnuc|EF494378_FT00000_P-RF-CA Feature FT:source EF494378_FT00000_P-RF-CA of [Viruses] Hepatitis B Virus recombinant form CA (isolate TW1244). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcatcacactctgctagatcccagagtgaggggcctatactttcctgctggtggctccagctccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccttgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcacttactaacctcttgtcctccgacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcgtcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcatctctatgtttccct
cttgttgctgttcaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacgttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcctgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
atacatcgtttccatggctgctaggttgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttcccatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtgcagttactctcatttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggagcattgtacacctcaccatacagcactacggcaaactattctg
tgttggggtgagttggtgaacctggccacctgggtgggaagtaatttggacgacccagcatccagggaattagtagtcgg
ctatgtcaacggtaatatgggcctaaagatcagacacttgttgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatataggccaccaaatgcccctatctta
tcaatacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaagtctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcttttcctgatatacatttgaa
agaggacatttttgatagatgtcaacaatttgtgggccctcttactataaatgaaaaaaggagattaaagttaattatgc
ccgctagattttttcctaaacttaccaaatatttgcccttggataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaaccacacgtag
tgcctcgttttatgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttccccgaccaccagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcggtt
cctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccattcagtggaa
>gnl|hbvnuc|EU185780_FT00000_P-RF-AD Feature FT:source EU185780_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate H-IDU7 (Rec.Arg-1)). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctkctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaacaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtywwcgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgwgtgcacttsacttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggacccttggactctctacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagcatctagagacctagtagtcgg
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcgttcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcatccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU522070_FT00000_P-RF-CB Feature FT:source EU522070_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient 7N). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaacaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccaattccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttgccacaggaacatattgtacttaaaattaagcaatgttttcggaaacttcct
gtaaatagacctgttgattggcaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgccgttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccaccagcgcatgcgtggaacctttgtggctcccctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgtctctgccgttccggccaaccac
ggggcgcacctctctctacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgagaagccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccccgcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattctactactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagtaaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU660227_FT00000_P-RF-BC Feature FT:source EU660227_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate HBV-14N). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaaccaaaagttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaaatcaaaatgtgttttaggaaatttcct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatcgaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacaatatctgaacctttaccccgttgcccggcagcggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcattgggactgacaattctgtcgtgctctcccgcaagt
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccttgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcgcctttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
ccactgccctgtatcgagaagccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgagcatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagactgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871996_FT00000_P-RF-CB Feature FT:source EU871996_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490A-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939627_FT00000_P-RF-BC Feature FT:source EU939627_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaatatggag
aacatcgcatcaggactccyaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggraacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacgaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgtcgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaccgagtgggaggagttgggggaggaagttaggtta
atgatctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacmcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccacacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcaracaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttrcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaatctgcacaaggacaactggccggacgccaacaaggtgggagtgggggcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939629_FT00000_P-RF-BC Feature FT:source EU939629_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate C95). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgtaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaagaccatattgtgcaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggactgacaattctgtcgtgctctcccgcaaat
atacatcatttccatggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccccaggaacctgcccaaggtcttgcataagaggactcttggactgtcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaactaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcaggcaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtattccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcc
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ023659_FT00000_P-RF-BC Feature FT:source FJ023659_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate I1_M04-0469). Complete genome. [Hepadnaviridae] (length=3212 residues).
ttccacaaccttccaccaagctctgcaagatcccagaatcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatctcatcaatcttcacgaggattggggaccctgcaacgaacatggag
aacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttstggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccttaaacttcatgg
gttatgtaattggaagttggggtaccttgccacaagatcatattatacagaaaattaaaaaatgttttagaaaactacct
gttaacagacccattgattggaaagtatgtcaaagaatttcaggacttttgggctttgctgctccattcacacaatgtgg
ttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcaccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgccaggcaacggcccggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagccgcctgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctcttcttcatctgccgtaccggccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctgatcttgcccaaggtattgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccctataa
agaatttggagcttccgtggagttactctcttttttgccttctgatttctttccatctattcgagaccttctcgacaccg
catcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagcatttttg
tgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaacttaattatgc
ctgctaggttctatcctaaccttactaagtatttgcccttagataaaggcattaaaccttattatcctgaacaggcagtt
aatcattacttcaaaactagacactatttacatactctgtggaaagcgggcattctatataagagagaaacaacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaaggtgttccaccactcggaaaggcatg
gggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcattcggagccaactcaaa
caatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcgggagcattcgggccag
ggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacgtgccagtagttcct
cctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagacagtcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|FJ386585_FT00000_P-RF-CB Feature FT:source FJ386585_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1800). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactacct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagctggtctggagcaaagcttatcggcaccgacaactctgttgtcctctctcggaaat
acacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtcctcttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcatcaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctccgggcatactgacaacagtgccagtagca
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386635_FT00000_P-RF-CB Feature FT:source FJ386635_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 2399). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtcctcttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctatccgagatctcctcgacacag
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcacgctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagcatccagggaattagttgtcgg
ctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcctctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaaccctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ386674_FT00000_P-RF-BC Feature FT:source FJ386674_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate S659). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggcactgtactttcctgctggtggctccagttcaggaa
cactgagccctgctcagaacactgtctctaccacatcgtcaatctcatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatatgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttagaaaacttcct
ataaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacgcaatgtgg
atatcctgctttactgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaaacctttc
tgcgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggcacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgatcgcccaccggaacttgcccaaggtcttgcatcagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagatgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgctcaccactaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcctctgcggagttaatctcttttttgccttctgacttctttcctaatattcragatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaacctagccacctgggtgggaggtaatttgcaagatcaagcatccagggatttagtagtcaa
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttgggagagata
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcctgacattcatttgaa
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagactaaaattaattatgc
ctgctaggttttatccaaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggaccgcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacatgggggactgttggggtggagccctcaggctcagagcatattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccgtaactccacctctaagggacactcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|FJ562247_FT00000_P-RF-CB Feature FT:source FJ562247_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I75). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaraatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctttggtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattacct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggacttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcgtacataataggactcttggagtctcctcaa
tgtcgacgaccaaccttgatgcatacttcaaagactgtgtatttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctgtattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgca
ggaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaccaggagattaaaattaattatgc
ctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
tagggttcacccctccccacgggggattgttggggtggagccctcaagctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562328_FT00000_P-RF-CB Feature FT:source FJ562328_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I229). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccactttccaccaaactctccaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggctttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacagccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatagtgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtgtgttcaccggcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctacagagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
tctctgctctgcatcgggaggccttagagtctcccgaacattgtacacctcaccatacggcactcaggcaagctatacta
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggactaaaactcagacaactattgtggtttcacctttcctgtattacttttgggagagata
ctgttcttgaatatttggtttcttttggagtgtggattcgcactcctgctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttccggacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
actcattacttccaaacgcgacattatttacacacactttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgagaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaagctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgaagtggaa
>gnl|hbvnuc|GQ161753_FT00000_P-RF-AE Feature FT:source GQ161753_FT00000_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate GH2537). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaatttccaccaagctctgcaggatcccagagtaaggggcctgtattttcctgctggtggctccagttcagaaa
cagtaaaccctgttccgaatatcgcctctcacatcttgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaataaccagtacgggaccctgcagaacttgcacgactcctgctcaaggcgactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccctttacacaatgtgg
ataccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggagcctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgttttgctcgcagccggtctggagcaacactcatcgggactgataattctgtcgtcctctctcggaaat
atacttcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccgccagatcctgcccaagatcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcagagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctcctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgctcacctcaccatacagcactcaggcaagctattctc
tgctggggggaattaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctaagattcatttgca
tgaggacattgttaataggtgtcaacaatttgtgggccctctcaccgtaaatgaaaaaagaagactgaaattaattatgc
ctgctagattctatcctaacagtacaaaatatttgcccctagacaaagggattaaaccttattatcctgatcatgtagtt
aatcattactttcagactcgacattatttacatactctttggaaggctggtattctatataagagggaaactacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggagcgaatctttctgttcccaaccctctg
ggattctttcccgatcatcagttggaccctgcattcggagccaactcaaacaacccagattgggacttcaaccccatcaa
ggaccactggccagcagccaatcaggtaggagtgggagcatttgggccagggttcacccctccacacggaggtgttctgg
ggtggagccctcaggctcagggcatattgactacagtgccagcagttcctcctcctgcctccaccaatcggcagtcagga
aggcagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ331048_FT00000_P-RF-AE Feature FT:source GQ331048_FT00000_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate BV-201). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgtaccgaacatggag
aacatcacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctcgactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggtacttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggaaccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggaatgggcctcagtccgtttctcatggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaagagatggggttactccctaaacttcatgg
gatatgtaattggaagttggggaacattaccacaggatcatattgtacaaaaacttaaacactgttttagaaaacttcct
gttaataggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgctccttttacacaatgtgg
ataccctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcttttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagagcctgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaagcttacttcaaagactgtgtgtttaaagactgggaagagtcgggggaggaaattaggtta
aaggtttatttattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccctataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctccttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgtcttacttttggaagagata
ctgtgcttgagtatttggtttctttcggagtgtggattcgcactcctcctgcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagggaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtg
ggaaattttactgggctttattctactactgtacctacctttaatcctgattggcaaactccttcttttcctaagattca
tttacatgaggacattattaataggtgtcaacattttgtgggccctcttactgtaaatgaaaaaagaagattgaaattaa
ttatgcctgctaggttctatcctaacagcactaaatatttgcccctagacaaagggattaaaccctattatccagatcag
gtagttaatcattacttccagactcgacattatttacatactctttggaaggctggtattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaacacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtaggagtgggagcat
ttgggccagggttcacccctccacacggaggtgttttggggtggagccctcaggctcagggcatattgaccacagtgcca
aaggttcctcctcctgcctcgaccaatcggcagtcaggaaggcagccgactcccatctctccacctctaagagacagtca
tcctcaggccatacagtggaa
>gnl|hbvnuc|GQ377595_FT00000_P-RF-BC Feature FT:source GQ377595_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J155). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccacttttcttttgtctttgggtatacatttaaatcctcataaaacaaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggcaccttgccacaagaacatattgtattgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcmtttc
tgtgyaaacartatctgaacctttaccccgttgcycggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccgaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagactaaaattgatcatgc
ctgctaggttctatcctaatgttactaaatatttgcccctagataaaggaattaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaagggagtcaacacgtag
cgcctcattctgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggatcctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctgagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377630_FT00000_P-RF-BC Feature FT:source GQ377630_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J236). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttagaaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttttcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggactttaccgcccgcttctccgccttgtgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgaccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagtcgggggaggaggttaggtta
aagatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccacacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
ttcactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcttttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377635_FT00000_P-RF-BC Feature FT:source GQ377635_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J245). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggaacatcaactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtggtttacgaaacttcct
ggaaacaggcctattgattggaaagtatgtcaacaaattgggggtcttttggggtttgccggccctttcacgcaatgggg
atatcctgctttaatgcccttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtagcatggagaccaccgtgaacgcccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactccccccgcttacagaccaccaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctataatcctgagtggcaaactccctcttttcctaacatccatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacacactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacatggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctcaccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HF571060_FT00000_P-RF-AE Feature FT:source HF571060_FT00000_P-RF-AE of [Viruses] Hepatitis B Virus recombinant form AE (isolate 56325). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgaacattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattgtcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcagaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcatgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatctaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggatcattgccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgcagctccctttacacaatgtgg
ataccctgccttaatgcctttgtattcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
taagcaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctctctcggaaat
atacctcctttccatggctgctaggctgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagcgaactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatcttctagataccg
cctcagccctgtatcgggatgccttagaatctcctgagcattgttcaccgcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagctacctgggtgggtgtaaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcatttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaatactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaat
tttactggtctttattcctctactgtacctatttttaatcctgaatggcaaactccttcttttcctaagattcatttaca
tgaggacattgttaataggtgtcaacaatttgtgggtcctctcacagtaaatgaaaaaagaagattacaattgattatgc
ctgctagattctatcctatcagaacaaaatattttcccttagacaaagggatcaaaccctattatcctgatcatgtagtt
aatcattacttccagacccgacattatttacatactctttggaaggcgggtattctatataagagggaaactacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggttaccaaaacctcgcaaaggc
atggggacgaatctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaatcaggtgggagtgggagcatttgggc
cagggttcacccctccacacggaggtgttctggggtggagccctcaggctcagggcatattgactacagtgccagcagtt
cctcctcctgccgccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatccaca
ggccatgcagtggaa
>gnl|hbvnuc|HQ684848_FT00000_P-RF-CB Feature FT:source HQ684848_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBVJSTZ1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgttctttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggaacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaaacttatcggaactgacaattctgtcgtgctctcccgcaagt
atacatcttttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacccccaccggaacttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaggaaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaata
aaatcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaatttataatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgtacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700505_FT00000_P-RF-CB Feature FT:source HQ700505_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_KI178P_2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtccatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgatggggctattctcttaatttcatgg
gatatgtaattggatgttggggtaccttacctcaggaacatattatactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtgtgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtctaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaaattctcggaaccgacaactctgtcgtcctctcccggaaat
acccctcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgcctggggatttaccgtccccttctttgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccattcgggatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccacacagcactcaggcaagccattctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctaccgttcctgtctttaatcctgagtggcaaaccccctcttttcctgacattcatttgca
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatacttgcccttagataaaggcattaaaccttattatcctgagcatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagcgagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcatacgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700557_FT00000_P-RF-CB Feature FT:source HQ700557_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_Tonga_BB6189_2002). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattcctaggacccctgctcgtattacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataagactaaaagatggggctattcacttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattatactaaaaatcaaacactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtctgttgggctttgctgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagcgaaacaagctttcactttttcgtcaacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtrcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcra
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttyaaagactgggaggagttgggggaggagattagatya
aaggtcwttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttcttcccatcgattcgagatctcctcgacaccg
cctcagctctgtaccgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggcagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctaccgcgtacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801477_FT00000_P-RF-BC Feature FT:source JQ801477_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate AIDS19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccgccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
caatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaggccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattccctcaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctctaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaatttacaaggcctttc
ttcgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggratctcaatgttagtattccgtggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctaacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcgggaatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagcgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagtcctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctct
ggcaatgcattggaa
>gnl|hbvnuc|KC012653_FT00000_P-RF-AD Feature FT:source KC012653_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD. Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgtgacgaacatggag
aacatcacatcaggactcctaggacccctkctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaacaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtywwcgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgwgtgcacttsacttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggacccttggactctctacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttatactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagcatctagagacctagtagtcgg
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcgttcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcatccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774178_FT00000_P-RF-BC Feature FT:source KC774178_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate GS12lz2088). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtagaaaaaatcaacatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggctaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccccttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774188_FT00000_P-RF-CB Feature FT:source KC774188_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz1028). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctaatattcacttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagacttaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaagggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatccaaacctcgacgaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctcctcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774222_FT00000_P-RF-CB Feature FT:source KC774222_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz2166). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtgctttaccgcaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggactttaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774258_FT00000_P-RF-CB Feature FT:source KC774258_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cww1060). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtggggcttctgggctttgttgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcaggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774324_FT00000_P-RF-CB Feature FT:source KC774324_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2060). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgacttctgcctcacccatatcgtcaatcttctcgaggactggggaccctgcatcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgcttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttatctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaaacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccgacaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacgaggc
atggggacaaatcttgctgttcccaatcctctgggattctttcccgatcaccagttggaccttgcgttcagagccaactc
aaacaatccagattgggacttcaaccccaacaaggatccttggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774349_FT00000_P-RF-CB Feature FT:source KC774349_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxn1095). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtctgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccctagcccatcggggcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaaatctgttgtcctctctcgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ttgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccac
ggggcgcacctctctttacgcggtttccccgtctgtgccttatcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacccgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774364_FT00000_P-RF-BC Feature FT:source KC774364_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate blz2088). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtagaaaaaatcaacatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttt
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggctaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccccttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774414_FT00000_P-RF-BC Feature FT:source KC774414_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate bxa2061). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatattcccttaacttcatgg
gatatgtaattgggggttggggaacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tcagtaaacagtatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccatctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcccactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaaaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaattcgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggacaccatattcttgggaacaagatctacagcatgggaggttggtcctccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacatgggggactgttggggtggagccctcaggctctgggcctactcacaactgtgccaacagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF214656_FT00000_P-RF-AC Feature FT:source KF214656_FT00000_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate IND-2009-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccgctttccaccaaactctgcaagatcccagggtcagaggcctgtatttccctgctggtggctccagttcaggga
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctccttgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaccacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaaccttcggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatataattggaagttggggtacattgccacaggatcatattgtacaaaaaatcaaaaactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgctttaatgcctttgtatgcatgtatacaagcgaaacaggcttttaccttctcgccaacttataaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgaggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
atacatcatttccatggctgctcggatgtactgccaactggattcttcgcgggacgtcctttgtatacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttggggctgtatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccagattctgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcccctctgcctaatc
atctcaagttcatgtcccactcttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcacatttcttgccttacttttggaagagata
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggcaat
tttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttccaaaaattcatttaca
tgaagacattgctaataggtgtcaacaatatgtgggccctcttactgtaaacgaaaagagaagactgaaattaattatgc
ctgctaggttttatcctaacctcaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgatcatgtagtt
aatcattactttcaaacccgacattatttacatactctgtggaaggcagggattctatataagagggaaactacacgtag
cgcctcattttgcgggtcaccatattcctgggaacaagagctacatcatgggaggttggtcatcaaaacctcgcaaaggc
atggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcaattggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagccttcgggc
cagggttcactcccccacacggcggtgttctggggtggagcccgcaggctcagggcatattgaccacagtgccaacagtg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctacacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KF873517_FT00000_P-RF-BC Feature FT:source KF873517_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 005_EA_Gal). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggttttgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctggggaagcttaccgcaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaacgaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatwggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttactattaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873521_FT00000_P-RF-BC Feature FT:source KF873521_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 063_K_Ngk). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagtttcgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaatccacacaaaacgaaaagatggggttattcccttcacttcatgg
gatatataattgggagctgggggaccttaccgcaagatcatattgtccaaaaactcaaacagtgttttaggaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacagtctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatcagaacctttaccccgttgccaggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcagcgc
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgcgatctcctcgacaccg
ccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctgaaaattagacaactattgtggtttcacatttcctgtctaacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgcttacagaccaccaaatgcccctatctta
tccacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgagtggcaaactccttcttttcctgacattcacttacg
ggaggacattatcaatcggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaacccgaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatcacaccacctctaagagacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873527_FT00000_P-RF-CB Feature FT:source KF873527_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 052_K_Vic). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcctcagcattccatcaagctctacaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccggaa
cagtaagccctgttcagaatactgtctctcacatctcatcaatcttcacgaagactggggaccctgctacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgacatggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggcatacatctaaatcctcacaaaacaaaaagatggggttattcccttaacttcatgg
gatatgtaattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacactgttttagaaaaatacct
gttaataggcctattgactggaaagtgtgccaaagaattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttttcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttttagtttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcggggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggagcgcaacttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgccgacgacccttctcggggccgcttgggactttaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacctgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttcagtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatctagagaattagtagtaag
ttatgtcaatgttaatatgggcctaaaaattcgacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcaataggtgtcaacaatacgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctacccttaccaaatatttgcccttggacaaaggcattaagccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctatggaaggctggtattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagcagcg
cctcctcctgcctccgccaatcggcagtcaggaagacagcccactcccatatcaccacctctaagagtcactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873531_FT00000_P-RF-CB Feature FT:source KF873531_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 021_TI_Ngu). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagccctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgattactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtcccttttttccgctat
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacgaaaagatggggttattccctcaacttcatgg
gatatgtgattggcagctggggaagcttaccacaagatcatattgtgcaaaaaatcaaacactgttttagaaaactccct
gttaataggcctattgattggaaagtgtgccaacgaattgtgggtctattgggctttgctgccccttttacacaatgtgg
gtatcctgccttgatgcctttgtatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttggggatataccgtccccttcttcgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactatcarcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctattcgagatcttctcgacactg
catccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaar
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaca
tgaagatattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactagacattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaamaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggaggtcttttggggtggagcccacaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatttctccaccactaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173320_FT00000_P-RF-CB Feature FT:source KJ173320_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate NH29M(e41)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacacatatcatcaatcttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagaacttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaaa
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatactatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatactcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagta
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410497_FT00000_P-RF-BC Feature FT:source KJ410497_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate HK_1325). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaactggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggcaatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacttgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagatta
atgatctatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctctggttcatgtcctactgttcaagcctccaagctgtgccttgggtggctgtggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaacatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggatccgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttagtataccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
cagctaggttttatcccaatgttaccaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcatct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ586803_FT00000_P-RF-AF Feature FT:source KJ586803_FT00000_P-RF-AF of [Viruses] Hepatitis B Virus recombinant form AF. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacccagttccaccaggccctgtcggatccgagggtaagggctctgtattttcctgctggtggccccagttcagaga
cacagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaagactgggggccctgctatgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaacctacggatggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaaatctggacaacatcgtgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaagaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaacattaccacaggatcatattgtacaaaagatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tacgtcaccagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
atcacgtggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctttcgcggaaat
atacatcgttcccatggctgctaggctgtactgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgattcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactctgcattttttttggg
ggtcaatcacctggatcgaagaatacatcaaagactgtgtatttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggaattactctcttttttgccttctgactttttcccgtcagttcgggacctactcgacaccg
cttcagccctctaccgggatgctttagaatcaccagaacattgcacacctaaccataccgctttcaggcaagctatattg
tgctggggggagttaatgactttggcttcctgggggggcaataacttggaagatcctgctgctagggacctagtggttaa
ctatgtcaatactaacatgggcctaaaaattagacaattgctggggtttcacatttcctcccttacttttggaagagaaa
cagtttttgagtatttggtgttttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattcatttaca
tcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattagttatgc
catccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccaccgagcc
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggagcacctctctcaacgaccaatcatggg
gaattctttccagaccatcagctggatcctcttttcagagcaaattccagcagtcccgattgggacttcaacaaaaacaa
ggacacttggccaatggcaaacaaggtaggagtgggaggttacggtccagggttcacacccccacacggcggcctgttgg
ggtggagccctcaggcacaaggtgttctaacaaccttgccagcagatccgcctcctgcttccaccaatcggcggtccggg
aggaagccaaccccagtctctccacctctaagagacacacatccacaggcaatgcagtggaa
>gnl|hbvnuc|KJ586810_FT00000_P-RF-AF Feature FT:source KJ586810_FT00000_P-RF-AF of [Viruses] Hepatitis B Virus recombinant form AF. Complete genome. [Hepadnaviridae] (length=3221 residues).
ctccactcagttccaccaggctctgttagatccgagggtaagggctctgtattttcctgctggtggctccagttcagaga
cactcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcggcctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgcagctccatttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaagactcatcgggactgataattctgtcgtcctctcgcggaaat
atacatcatttccatggctgctaggttgtactgccaactggattcttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcgcggggccgcttgggactctatcgtccccttctccgtctgccgtaccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccatcagatcctgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccatcatcatgcaactttttcacctctgcctaatc
atctcttgtacatgtcccacttttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgatttctttccttccgtccgggatctacttgatacag
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcaccgcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggcctaaagatcaggcaactattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctccttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtg
ggaaattttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttcttttcctgacattca
tttacatcaagatttgatacacaaatgtgaacaatttgtaggccctctcacaaaaaatgaattgagaagattaaaattag
ttatgccatccagattttttcctaaggttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataac
gtggttaatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatataagagagaatccac
acgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggagcacctctatcaacgactcga
aggggcatgggacagaatctctctgtacccaatcctctgggattctttccagaccatcagctggatcctctattcagggc
aaattccagcagtcccgactgggacttcaacaaaaacaaggacaattggccaatggcaaacaaggtaggagtgggaggat
acggtcctgggttcacacccccacacggtggcctgttggggtggagtccacaggcacagggtgtgcttacaacattgcca
gcagatccgcctcctgcttccaccaatcggcggtccgggagaaaaccaaccccagtctctccacctctaagagacactca
tccacaggccatgcagtggaa
>gnl|hbvnuc|KJ803772_FT00000_P-RF-BC Feature FT:source KJ803772_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate MY816598). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccacgttccaccaaactcttcaggatccccgagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccgcaggaacatattgtacaaaaaatcaaacaatgttttaggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgctcctttcacacaatgtgg
ttatcctgctctgaagcctttatatgcatgtatacaagctaaacaggcttttactttctcgccaacgtataaggcctttc
tccgcgatcaatatctgaacctttaccccgttgcacggcaacggccaggtgtgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatagggcatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaattccgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccgcttctccgtctgccgtatcgaccgacaac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaatttgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagagtaggtta
atgatttttgtaataggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaactagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttagtctcttttggagtgtggattcgcactcctcaggcatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacatcgttagtaggtgtgaacgatttgtggggcccctcacagtgaatgaacgcaggagactaaaattgattatgc
ctgctaggttctatcctaaggttactaaatatttgcccttagataaaggaattaaaccttactatccagagcatgtagtt
aatcattacttccagacgagacattatttacatactctttggaaggcgggtattttatataaaagagagacaacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgtcaaggc
atggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgcattcaaagccaactc
cgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagtgggagcattcggga
cgggattcactccaccccatgggggactgttggggtggagccctcaagctcaaggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctgtctccacctttgagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803827_FT00000_P-RF-BC Feature FT:source KJ803827_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate MY830498). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccctacacttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgacgactggggaccctgcgccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcaccggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatattgtattgggggccaagtctgtgcaacaccttgagtccctttttgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaagaaaacaaaaagatggggctactcccttaacttcatgg
ggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttgaaaatcaaacaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgctcctttcacacaatgtgg
ttatcctgctttaaagcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tatacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggaccgacaattctgtcgtcctgtcccggaaat
acacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaggacttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
ccactgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctgttttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtagg
ctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgctagagtatttggtgtcttttggagtgtggattcgcactcctgcaccttacagaccatcaaatgcccctatctta
tccacacttcctgagacttctgttgttagagcacggagcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcttccgtacctgtctttaatcccgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtgggccctcttacagttaacgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccatactaaatatttgcccttagataagggcattaaaccttattatcctgagcatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtgttttatacaagagggaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattcttccccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtggggtcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagtg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM875422_FT00000_P-RF-CB Feature FT:source KM875422_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate pt12N). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtcattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcagacgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttccgttcgggatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacggcactcaggcaagctattctg
agttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatcaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KP148337_FT00000_P-RF-BC Feature FT:source KP148337_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate D282-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagctggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttagggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcacaacaggcttttactttctcgccaacttacaaggccttcc
tcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcttgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148442_FT00000_P-RF-BC Feature FT:source KP148442_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate Y132-2-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaacttccaccaagctctgcaggatcccagaatcaggggcctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgtctctcacatctcatcaatcttcgcgaggactggggaccctgcaacgaacatggag
aacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtatccct
catgttgctgtaccagacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcgtaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacagaaaatcaaacaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaaagaatttcaggactcctgggctttgctgctccattcacacaatgtgg
ttaccctgcgttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tctgtaaacaatatatgaacctttaccccgttgacaggcaacggcccggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagccgcctgttttgctcgcagccggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggatctaccgtcctcttcttcatctgccgtaccgtccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctgatcttgcccaaggtcttgcataagcggactcttggactctcagcag
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggcgttactctcttttttgccttctgatttctttccgtctattcgagaccttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacagcactcaggcaagcagttttg
tgctggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaacttttatggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttgca
tgaggacattattaataggtgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaatttaattatgc
ctgctaggttctatcctaaccgtactaagtatttgcccttagacaaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaacaacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcagagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagcgggagcatttgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KT003704_FT00000_P-RF-CB Feature FT:source KT003704_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate IND-DIB-RMRC-667). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacgtcaacgaccagtacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaagcgatggggctactcccttaacttcatgg
gctatgtaattggaagttggggttccttaccgcaggatcatattgtaggaaaaatcaagcaatgttttcgaaaacttcct
gttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttaggatttgctgccccttttacacaatgtgg
gtatccagccttaatgcctttatatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tatgcaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcctgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcggctgccgttccggccccccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtattgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctatccgagacctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcgtccagggaattagttgtaag
ttatgtcaacgttaatatgggtctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
cttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctgacatacatttgcg
ggaggacgttatcaacagatgtcaacaatttgtaggccctcttacagtcaatgagaaaaggagattatccctaattatgc
cggctaggttttatccgaatattaccaaatatttgcccttagataaaggcattaaaccttattatcctaaccatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggcacgga
atggggacgaatctttctgttcccaatcctctgggattctttcccgaacaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagtgggagcgtttgggc
caggattcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcacattgacatcagtgccagcagcc
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679939_FT00000_P-RF-CB Feature FT:source KU679939_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 083_WA_Man). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatatcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggcaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttcccgctat
taccaattttcttttgtctttgggtatacatttgaatcccaacaaaacaaaaagatggggttattcccttaacttcatgg
gatatgtgattggaagctggggaagcttaccacaagatcatattgtgcaaaaaatcaaactctgtttcagaaaactccct
gttaataggcctattgattggaaagtatgccaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttatatgcatgtatacaagctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgccaacaatatctgaacctttaccccgttgcccggcaacgggcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
tctggcagcctgtttcgctcgcagcaggtctggagcgaacctcatcgggactgacaacgctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttggggatctaccgtcccctccttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatcttccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagcttcagtggagttactctcttttttgccttctgatttctttccatctattcgagatcttctcgacaccg
ccgccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcccgacattcatttaca
tgaagatattatccataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacattaccaaatatttgcccttagagaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctgggattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggaggtcttttggggtggagcccacaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679943_FT00000_P-RF-BC Feature FT:source KU679943_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 096_CA_Mim). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcctcagcattccatcaagctctacaagaccccaragtaaggggtctgtattttcctgctggtggctccagttccggaa
cagtaagccctgttccgaatactgtctctcacatctcatcaaycttcacgaagactggggaccctgcgacgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcytggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgacctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatctaaatcctcacaaaacaaaaagatggggttattccctcaacttcatgg
gttatgtgattggtagctggggaagcttaccacargatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggctttcattttttcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacgggctggtctctgccaagtgtttgctgacgcaacsccc
actggctggggcttggccataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
tctagcagcctgtttcgctcgcagccggtctggagcgaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccacctgatcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatatttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtcttwgkactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcmtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattgaccmttataa
agaatttggagcttccgtcgagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
ccwccgctctgtatcgggaggccttagaatctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtarg
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcatttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcaracgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagactaaaattaattatgc
ctgctaggttctatcctacactcaccaaatatttgcccttggacaaaggcattaagccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctatggaaggcgggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaagcctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcaggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccgccaatcggcagtcaggaagacagcccactcccatatcacaacctctaagagtcactcatcctca
ggcaatgcagtggaa
>gnl|hbvnuc|KU679944_FT00000_P-RF-BC Feature FT:source KU679944_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 097_EA_Mil). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaatttycttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattccctccacttcatgg
gatatgtaattgggagctgggggagcttaccgcaagatcatattatccaaaaamtcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
atatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagtcctttc
tgtgtaaccaatatctgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
cctcgcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcgc
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcagrcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgktaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgacattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgarcatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679946_FT00000_P-RF-BC Feature FT:source KU679946_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 100_EA_Gal). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccgacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctggggaagcttaccgcaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaacgaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttataagacctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacgggccggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagcagtgccttgagtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacaraccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctaraagaagaactccctcgcctcgcaracgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttactattaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctacccttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679948_FT00000_P-RF-CB Feature FT:source KU679948_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 103_EA_Gap). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactyaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaargaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggttttgggggccaagtctgtacaacatcttgagtcmctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctggggaagcttaccgcaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaacgaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacaktctaagcaagctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgcggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aagatttwtgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccmttayaa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctmaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttactattaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggamgacagcccactcccatcacaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679953_FT00000_P-RF-BC Feature FT:source KU679953_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate 116_EA_Num). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagyccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattccctccacttcatgg
gttatgtaattgggagctgggggagcttaccgcaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
atatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagtcctttc
tgtgtaaccaatatctgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcmtgcggggaacctttgtggctcckctgccgatccatactgcggaact
cctcgcagcctgtttcgctcgcagccggtctggagcgaaccttmtcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctytgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcgc
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaaygttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgkggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgacattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaarggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963858_FT00000_P-RF-CB Feature FT:source KU963858_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963869_FT00000_P-RF-CB Feature FT:source KU963869_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963993_FT00000_P-RF-CB Feature FT:source KU963993_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcgggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963994_FT00000_P-RF-CB Feature FT:source KU963994_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964304_FT00000_P-RF-CB Feature FT:source KU964304_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX096713_FT00000_P-RF-CA Feature FT:source KX096713_FT00000_P-RF-CA of [Viruses] Hepatitis B Virus recombinant form CA. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggatcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctttataccgctgt
taccaattttcttatgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctctctatgcatgtatacaatckaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaagactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttaragtctccggaacattgttcagctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcaggcaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgagtggcaaactccctcctttcctaacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881840_FT00000_P-RF-CB Feature FT:source KY881840_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaaaatgtgtttcgagaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaagcttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgccctcttctctacctgttgtaccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaccgagtgggaggaattgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279265_FT00000_P-RF-CB Feature FT:source LC279265_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_father_nail). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacactctaagcaggctttcactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcc
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF488705_FT00000_P-RF-AD Feature FT:source MF488705_FT00000_P-RF-AD of [Viruses] Hepatitis B Virus recombinant form AD (isolate OHBV-PCP243). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
ctctcaaccctgttccaaatattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctcgggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatccacaacaaccagtacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctattccctgaatttcatgg
gatatgtcattggaagttggggttcattgccacaggatcatattgtacacaaaatcaaacaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctccgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgtggagttactctcgtttttgccttctgatttctttccttcagtacgggatctactagataccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgcacacctcaccatacagcactcaggcaagccattctc
tgctggggggaattaatgactctagctacctgggtgggtaataatttgcaagatccagcatccagggatctagtagtcaa
ttatgtcaatactaacatgggcctaaagatcaggcaattattgtggtttcatatatcttgccttacttttggaagacaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgagaccgaggtaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtg
ggcaattttacggggctttattcttctactgtccctatctttaatcctgaatggcaaactccttcttttcctaaaattca
tttacatgaggacattattaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaacgaagactgaaattaa
ttatgcctgctagattttatcctaatagcactaaatatttgcctctagacaaagggattaaaccttattatcctgatcaa
gtagttaatcattacttccagacccgacattatttacatactctttggaaggctgggattttatataagagggaaactac
acgtagcgcttcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctatctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccaatggccacaagcccaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagttcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtca
tcctcaggcagtgcagtggaa
>gnl|hbvnuc|MF925386_FT00000_P-RF-AC Feature FT:source MF925386_FT00000_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate BD-HBV30). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccactgccttccaccaagctctgcaggatcccagagtcaggggtctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgctccgaatattgcctctcacatatcgtcaatctccacgaggactggggaccctgtggcgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggtcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgcttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgaggccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattccctaaacttcatgg
gttacataattggaagttggggaactttgccacaggatcatattgtacaaaagatcaaacactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
taagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaagctcatcggaactgacaattctgtcgtcctctcgcggaaat
ayacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggctctaccgtcccctgcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttccgtcggagatctcctagacaccg
cctcagctttgtatcgagaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagccattctc
tgctggggggaattgatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaacatgggtttaaagatcaggcaactattgtggtttcatatatcttgccttacttttggaagagagg
ttgtacttgaatatttggtctctttcggagtgtggattcgcactcctccaccctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgggaccgagtcaggtcccctagaagaagaactccctcgcctcgcag
acgcagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcctctacagtacctatctttaatcctgaatggcaaactccttcctttcctaagattca
tttacaagaggacattattaagaggtgtcaacaatttgtgggccctctcactgtaaatgaaaagagaagattgaaattaa
ttatgcctgctagattctatcctacccacactaaatatttgcccttagacaaaggaattaaaccttattatccagatcag
gtagttaatcattacttccaaaccagacattatttacatactctttggaaggctggtattctatataagagggaaaccac
acgtagcgcatcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaatctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caactcaaacaatccagattgggacttcaaccccatcaaggaccactggccagcagccaaccaggtgggagtgggagcat
tcgggccagggctcacccctccacacggcggtattctggggtggagccctcaggctcagggcatattgaccacagtgtca
acaattcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925402_FT00000_P-RF-BD Feature FT:source MF925402_FT00000_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate BD-HBV48). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgcctctgccatatcgtcaatcttctcgaagactggggaccctgtaccgaacatggag
aacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaacaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacagtgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatcttatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataaaggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
gaacatctggccggttgccaacaaggtaggagctggagcattcgggccagggttcacccctccccatgggggcctgttgg
ggtggagccctcaggctcagggcatactgacaacagtgccagcagcgcctcctcctgcctccaccaatcggcagtcagga
aggcagcctactcccatctctccacctctaagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925404_FT00000_P-RF-AC Feature FT:source MF925404_FT00000_P-RF-AC of [Viruses] Hepatitis B Virus recombinant form AC (isolate BD-HBV50). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacagctttccaccaagctctgcaagatcccagagtcaggggcctgtattttcctgctggtggctccagttcaggaa
cactcaaccctgttccaactattgcctctcacatctcgtcaatctcctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatcacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcaacaacaaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggcaactctatgtttccct
catgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattccctgaatttcatgg
ggtatgtaattggaagttggggtacattgccacaggatcatattatacaaaaaatcaaacactgttttagaaaacttcct
gtcaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgccgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtcaacagtatatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgataattctgtcgtcctttctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtcccctgcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtccgggatctactagatacag
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatacagcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtaataatttggaagatccagcatccagggatctagtagtcaa
ttatgttaatactaatatgggcctaaagatcaggcaattattgtggtttcatatttcttgccttacttttggaagagaaa
ctgtccttgagtatttggtctctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagaccgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
ggaaattttactgggctttattcttctactgtccctatctttaatcctgaatggcaaaccccttcttttcctaaaattca
tttacatgaagacattgctaataggtgtcagcaatttgtaggccctctcactgtaaatgaaaaaagaagactaaaattaa
ttatgcctgctaggttttatcctaacagcacaaaatatttgcctttagacaaagggattaaaccttattatcctgatcat
gtagttaatcattactttcaaacccgacattatttacatactctttggaaggctgggattctatataagagggaaactac
acgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcatcaaaacctcgc
aaaggcatggggacgaacctttctgttcccaaccctctgggattctttcccgatcatcagttggaccctgcattcggagc
caattcaaacaatccagattgggacttcaaccccatcaaggaccactggccacaagccaaccaggtaggagtgggagcat
tcgggccagggttcactcccccacacggaggtgttttggggtggagccctcaggctcagggcatattggccacagtgcca
gcagtgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MG826141_FT00000_P-RF-CB Feature FT:source MG826141_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM57). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagctctgctaggtcccaaagtgaggggcctagaccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgtacagggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgactcctgctcagggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaatcctcataaaaccaagcgatggggctactcccttaactttatgg
gctatgtaattggaagttggggtactttaccacaagatcatattgtagaaaaaatcaaacaatgtttcagaaaacttcct
gttaagagacctattgattggaaggtatgtcaacgcattgtcggtcttttaggctttgctgccccttttacacaatgtgg
gtatccagccttaatgcctttgtatgcttgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgccggtccgtgtgcacttcgcttcacctttgc
acgtcgcatggagaccaccgtgaacgcccaacaggtcttgcccaaggtcttgcataagaggactcttggactctcggcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtcttcggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggcagtaatttggaagatgcggcatccagggaattagttgtcag
ttatgtcaatgttaatatgggcctgaaacttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggagtgtggattcgcacccctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatttgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaagccaggcattatttacatactctgtggaaggcgggtattttatataggagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG826145_FT00000_P-RF-BC Feature FT:source MG826145_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagctctacaagatcccagaatcaggggcctgtattttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatatttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaactctaacaaaactaagagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacaaaaaatcaaacaatgttttagaaaactccct
gttaacaggcccattgattggaaagtatgtcaaagaatttcaggactcttgggctttgctgctccatttacacaatgtgg
ttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctggctgcctgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccacctgatcttgcccaaggtattgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggaccttctcgacaccg
catcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacagcactcaggcaagcagttttg
tgttggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaaaaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaattccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacggttaatgaaaaaagaagattaaacttaatcatgc
ctgctaggttctatcctaaccttactaagtatttgcccttagataaaggcattaaaccttattatccggagcaggcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaacaacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
acacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagtgggagcattcgggt
cagggttcacccctcctcacggaggtcttttggggtggagccctcaggctcagggcatgttaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagacagtcatcctca
agccatgcagtggaa
>gnl|hbvnuc|MG826150_FT00000_P-RF-BC Feature FT:source MG826150_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM15H). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtaagccctgctcagaatactgtctcagccatatcgtcaatctcatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggaacaaccgtgtgtcgtggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttctatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctttgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttctgtctttgggtatacatttgaaccctcacaaaaccaaaagatggggatactcccttaacttcatgg
gatatgtaattggaagttggggcactttgccacaagaacatattgtacaaaaaatcaaacaatgttttagaaaactccct
gtcaatagacctattgattggaaagtatgtcaacgaattgcaggtcttttgggatttgctgcccctttcacgcaatgtgg
atatccagccttaatgcctttatatgcttgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgcgcacacaatatctgaacctttaccccgttgctcggcaacggcccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcgaaactcatcggcaccgacaattctgttgtcctctctcgcaaat
acacctcctttccatggctgctcgggtgggctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctaccgtccccttcttcgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgaccactggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggaattgggggaggaggttaggtta
atgatttatgtattaggaggctgtaggcataaattggtgcgttcaccagcatcatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttaatctcttttttgccttctgacttctttcctactattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacggcactcaggcaagctatacta
tgttggggtgagttgatgaatctagccacctgggtgggaggtaatttgcaagatcaagcatccagagatttagtagtcaa
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttgggagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccgacaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatttgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaagccaggcattatttacatactctgtggaaggcgggtattttatataggagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgcgcagtggaa
>gnl|hbvnuc|MG826151_FT00000_P-RF-BC Feature FT:source MG826151_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM26H). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaaaatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccaatcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaagggaactctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggaagttggggcaccttgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggatttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttacgttctcgccaacctacaaggcctttc
tgcgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgtttgggactctaccgtcctcttcttcatctgccataccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccatatagaccaccaaatgcccctatcgta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcccctggcagaggaag
gtttcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcccttattcttctactgtacctgtctttaatcctgactggcaaactcccttttttcctcacattcatttgaa
agaggacattatccccagatgccaacaatttgtgggccctcttccagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaagccaggcattatttacatactctgtggaaggcgggtattttatataggagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgcgcagtggaa
>gnl|hbvnuc|MG893559_FT00000_P-RF-CB Feature FT:source MG893559_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SD14052). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttacccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtggggcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatacctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtccccttcttctgctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgaattgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH094410_FT00000_P-RF-BC Feature FT:source MH094410_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate J61). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacctcatcgggactgacaattctgtcgtcctctctcgcaagt
acacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccatctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgcgttcaccagcaccatgcaactttttcacctctgcctaatc
atttcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH746811_FT00000_P-RF-BC Feature FT:source MH746811_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91_1). Complete genome. [Hepadnaviridae] (length=3215 residues).
catcaccactttccaccaaactctccaagatcccagagtcagggctctgtactttcctgctggtggctccagtgcaggaa
cagtgagccctgctcagaatactgtatcgaccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatatttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctcataaaactaagagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacaaaaaatcaaacaatgttttagaaaactccct
gttaacaggcccattgattggaaagtatgtcaaagaatttcaggactcttgggctttgctgctccatttacacaatgtgg
ttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggcgcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctggctgcctgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccacctgatcttgcccaaggtattgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggaccttctcgacaccg
catcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacagcactcaggcaagcagttttg
tgctggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccagtgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaattccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacggttaatgaaaaaagaagattaaacttaatcatgc
ctgctaggttctatcctaaccttagtaagtatttgcccttagataaaggcattaaaccttattatccggagcaggcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaacaacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
acacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagtgggagcattcgggt
cagggttcacccctcctcacggaggtcttttggggtggagccctcaggctcagggcatgttaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagacagtcatcctca
agccatgcagtggaa
>gnl|hbvnuc|MH746812_FT00000_P-RF-BC Feature FT:source MH746812_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
catcaccactttccaccaaactctccaagatcccagagtcagggctctgtactttcctgctggtggctccggttcaggaa
cagtgagccctgctcagaatactgtatcgaccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaaacatcctcacaatacc
acagagtctagactcgaggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatatttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatrccgctgt
taccaattttcttttgtctttgggtatacatttaaactctaacaaaactaagagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacaaaaaatcaaacaatgttttagaaaactccct
gttaacaggcccattgattggaaagtatgtcaaagaatttcaggactcttgggctttgctgctccatttacacaatgtgg
ttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctggctgcctgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccacctgatcttgcccaaggtattgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggaccttctcgacaccg
catcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacagcactcaggcaagcagttttg
tgttggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaattccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacggttaatgaaaaaagaagattaaacttaatcatgc
ctgctaggttctatcctaaccttactaagtatttgcccttagataaaggcattaaaccttattatccggagcaggcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaacaacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
acacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagtgggagcattcgggt
cagggttcacccctcctcacggaggtcttttggggtggagccctcaggctcagggcatgttaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagacagtcatcctca
agccatgcagtggaa
>gnl|hbvnuc|MH746813_FT00000_P-RF-BC Feature FT:source MH746813_FT00000_P-RF-BC of [Viruses] Hepatitis B Virus recombinant form BC (isolate YNKM91_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagctctacaagatcccagaatcaggggcctgtactttcctgctggtggctccggttcaggaa
cagtgagccctgctcagaatactgtatcggccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccacaagcaccgggccatgcagaacctgcacgactcctgctcaaggaacctctatatttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaactctaacaaaactaagagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacaaaaaatcaaacaatgttttagaaaactccct
gttaacaggcccattgattggaaagtatgtcaaagaatttcaggactcttgggctttgctgctccatttacacaatgtgg
ttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctggctgcctgttttgctcgcagcaggtctggagcaaaacttatcgggactgataattctgtcgtcctttcgcggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcctcttcttcatctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccacctgatcttgcccaaggtattgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggaccttctcgacaccg
catcagctctgtatcgggaggcattagagtctccggaacattgttcacctcaccatacagcactcaggcaagcagttttg
tgttggggtgagttgatgactttagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaaaaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaattccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacggttaatgaaaaaagaagattaaacttaatcatgc
ctgctaggttctatcctaaccttactaagtatttgcccttagataaaggcattaaaccttattatccggagcaggcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaacaacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggaccctgcgttcggagccaactc
acacaatccagattgggacttcaaccccaacaaggaccattggccacaagcccatcaggtaggagtgggagcattcgggt
cagggttcacccctcctcacggaggtcttttggggtggagccctcaggctcagggcatgttaacaaacgtgccagcagtt
cctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccatctctccacctctaagagacagtcatcctca
agccatgcagtggaa
>gnl|hbvnuc|MK052967_FT00000_P-RF-BD Feature FT:source MK052967_FT00000_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgttgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgattccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcattggatgttatggttcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcagcgaattgtgggtcttttggggtttgctaccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttatccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgaactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttctttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcagcccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK052968_FT00000_P-RF-BD Feature FT:source MK052968_FT00000_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacacaaaatcaaactgtgttttcggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgcattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacacgcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttatccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttagagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgccccgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtattttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagtcggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK052970_FT00000_P-RF-BD Feature FT:source MK052970_FT00000_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtccgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttactgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcattggatgttatggttcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcagcgaattgtgggtcttttggggtttgctgccccttttacacgatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgcctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccaggaaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttaaatatttggtgtcttttggagtgtggattcgcactcctcctacatatagaccaccaaatgcccctatctta
tcaacacttccgaaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacaaag
gtctcaatcgccgcgtcacaaaagatctcaatctcggaaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK052976_FT00000_P-RF-BD Feature FT:source MK052976_FT00000_P-RF-BD of [Viruses] Hepatitis B Virus recombinant form BD (isolate NP137Q-20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtaccgaacatggag
aacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctgtgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
cattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtatcgggggccaaatctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcattggatgttatggttcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcagcgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttgaagcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacgatacatgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccggcggacgacccgtctcggggccgcttgggtctctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagattgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggcactaatttggaagatccagcatctagggacctaatagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaaccc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaactgtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK720628_FT00000_P-RF-CB Feature FT:source MK720628_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate p1331_CL). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacactg
cctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
tgaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB049609_FT00000_P-RF-CB Feature FT:source AB049609_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV AN28). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttctacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactgaaaatcaagcaatgttttcggaaactgcct
gtaaataggcctattgattggaaagtatgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgcggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaagtctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctgtacgcggtctccccgtctgtgccatctcgtctcccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcccaacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacaactaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatcctgaacaggcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcaattggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcacgtaggagcgggagcattcgggc
cagggttcaccccaccacacgggggtcttttggggtggagccctcaggctcagggcatattgaccacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB195957_FT00000_P-RF-CB Feature FT:source AB195957_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcaccgaatatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactcaaaatcaagcactgttttcgaaaattgcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatccaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctattcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB205152_FT00000_P-RF-CB Feature FT:source AB205152_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HB-JFH7-99). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctcgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacgsaaactgcacttgtattcccatcccatcrtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaatyggaagttggggtactttaccacaggaacatattgtattaaaaattaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctttgtatgcatgtatacaatctaagcaggccttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgctcagctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB241109_FT00000_P-RF-CB Feature FT:source AB241109_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate PhCH24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtaccttaccacaagatcatattctactaaaaatcaagcaatgttttcgaaaactccct
gttaatcgaccgatagattggaaagtatgccaaagaattgtgggtcttttgggctttgttgccccttttacacaatgtgg
ttatcctgcattactgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaagacttttc
tgtgtaaacaatatctgaccctttaccccgttgcccggcaacggccaggtctatgccaagtatttgctgacgcaaccccc
actggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaactcataggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggtcgcttggggctctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcaggcaactgttgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatctggtgtccttcggggtgtggattcgtacaccccccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttacggggctttattcttctaatgtacctgtctttaaccctgagtggcaaactccctcttttcctgatatacatttgca
ggaggacattattaatagatgtcaacaatttgtgggtccgcttactgtaaatgaaaaaaggagactaaagttaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgagcatatagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgccagaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagctggagcattcgggc
cagggttcacaccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB493837_FT00000_P-RF-CB Feature FT:source AB493837_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 03UC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtacaccctgttccgactattgcctctcccatctcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
agcacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacggcatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaacaaaactaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaccatattgtactaaaaatcaagcagtgttttcggaaacttcct
gtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtcaacaatatttgcacctttaccccgttgcccggcaacggtctggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggcattaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaattccgttgtcctctctcggaaat
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgactggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacaaccgaccttgaggcgtacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagccttgtatcgggaggccttagagtctccggagcattgctcacctcaccatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagcatcaagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctcacatttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatactgagtggcaaactccctcttttcctgacattcatttgca
ggaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagattaaaattaataatgc
ctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaaccaggcattatttacatactctgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|AB493842_FT00000_P-RF-CB Feature FT:source AB493842_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 31UC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgttagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacggggccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaactaaacggtggggatactcccttcacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacttaaaatcaagcagtgttttcgaaaacttcct
gtaaatagacctattgattggaaggtgtgtcaaagaattgtggggcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatccaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatttgcacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccttaggccatcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgtggtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccaactac
ggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgccgacccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtgttgcctaaggtcttgcataagaggactcttggactctctgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccaccaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctattcgagatctcctcgacaccg
catcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctcacatttggaagagaaa
ctgttctcgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaaccccctcttttcctgacattcatttgaa
ggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagcggagattaaaattaattatgc
ctgcccggttctatcctaaccttaccaagtacttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaaacaagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AP011103_FT00000_P-RF-CB Feature FT:source AP011103_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagaccccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaattcctgcacaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgatggggctacacccttaacttcatgg
gatatgtaattggaagttgggggaccttaccacaggaacatattgtacaaaaaattaagcagtgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaggctaagcaggctttcactttctcgccaacctacaagacctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggctggggcttggccttaggccatcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaactcatcgggaccgacaattctgtggtcctctctcggcgat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttggggatctaccgtccccttcttcgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctctgcta
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctcagcgttgtatcgggaagccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctgaaaattagacaactattgtggtttcacatttcctgtctcacatttggaagagaaa
cagttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttaca
ggaagacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaagcgaagattaaaattaattatgc
ctgctaggttctttcccaaccttactaaatacttgccattagataaaggcattaaaccttattatccagaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctctggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggcgcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY123424_FT00000_P-RF-CB Feature FT:source AY123424_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaagaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatccggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871983_FT00000_P-RF-CB Feature FT:source EU871983_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 318-97-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acgcctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgcctccccatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871987_FT00000_P-RF-CB Feature FT:source EU871987_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-01-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctatgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggcgattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871990_FT00000_P-RF-CB Feature FT:source EU871990_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 490-04-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgtttacgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcacaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaagggcgattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcagaaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871997_FT00000_P-RF-CB Feature FT:source EU871997_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 530-00-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttcccatctgccggaccgtgtgcacttcgcttcacctctac
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcctggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaggactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctacggttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtggcaagtaatttggaaggcccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU881995_FT00000_P-RF-CB Feature FT:source EU881995_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccaaagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttctcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccagggacgtcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaagctgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgtaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtcctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggcgcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcccgagtggcaaattccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgaaaaggc
atggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU916240_FT00000_P-RF-CB Feature FT:source EU916240_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SWT3.2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttccccttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttttacgttctcgccgacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgctgccggtcgggagcaacacttatcggaaccgacaactctgttgtcctctctcggaaat
acaccccctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgaaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaatatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU919167_FT00000_P-RF-CB Feature FT:source EU919167_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient25). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaactttccaccaagcactgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtactaaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcacctgcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaacggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgcattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagagactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaaccgtgccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU939547_FT00000_P-RF-CB Feature FT:source EU939547_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C45). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaaactctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcactcaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgactcctgccaacggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacagtctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcttctgccgatccatactgcggaaat
cctagcagcttgttttgctcgcagccggtatggggcgaaacttatcggaactgacaattctgttgtcctctctcggaaat
acacctcctttccatggctggtagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcattcgccgttccggccgacctc
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggaggtgggggaggagattaggtta
aagatttatgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatagggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
ttcactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcctgtctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU939551_FT00000_P-RF-CB Feature FT:source EU939551_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C56). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggatactcccttaatttcatgg
gatatgtaattggaagttggggtacattaccgcaggaacatattgtattaaaaatcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcttctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagcatccagggaattaatagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939668_FT00000_P-RF-CB Feature FT:source EU939668_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C182). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagcacgggaccttgcaagacatgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaaatctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgtttccgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgcctatttacaaggcctttc
tatgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactgtaccgtccccttcttcgtctgccgtaccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacctgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagccattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaactagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcctgcttatagaccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggtattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactatgcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagcgggatcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctcaccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386581_FT00000_P-RF-CB Feature FT:source FJ386581_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1764). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccacccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattaatagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatccagaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggtrtactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386586_FT00000_P-RF-CB Feature FT:source FJ386586_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1811). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggcccatgcaagacctgcacaatacctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacactaccacaggaacatattgtattaaaaatcaagaaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacgcaatgtgg
gtatcctgccttaatgcctttatatgcctgtatacaatctaagcaggcttttacattctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatacagcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgt
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcacctgcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgcagagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctatgtttcgggaggccttagagtctccggaacattgttcagctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttatggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|FJ562294_FT00000_P-RF-CB Feature FT:source FJ562294_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I168). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttctagatcccagagtgaggggcctgtactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggaataccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggagactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacacttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctccggcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattgttaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagactaaaattaattatgc
ctgctaggttctatcctaacgttaccaaatatttgcccttggacaaagggattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctgggattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggcggacttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccttctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562317_FT00000_P-RF-CB Feature FT:source FJ562317_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I209). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatctccctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactccctgaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaaatcaagcaatgtttccgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccgtttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggmaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtctgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcctcagcgcagttactctcttttttgcctactgacttctttccttcaattcgagatctcctcgacaccg
cccaagctttatatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcgg
ttatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcatttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
ttcactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaagattatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattactttaagactaggcattatttacacaccctgtggaaggctggcattttatataagagagaaactacgcgcag
tgcctcattttgtgggtcaccatactcttgggaacaagagatacagcatgggaggtccggcttccaaacctcgacgaggc
atggggacgaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaagcaggtaggagtgggagcattcgggc
caggggtcaccccaccacacggcggtcttgtggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagccatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FR714496_FT00000_P-RF-CB Feature FT:source FR714496_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate QL523). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcaaattccaccaagctctgctagatcccagagtgaggggcctatactctcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcaactctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttattccttaaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagatcatattatacagaaaatcaaacaatgttttagaaaactccct
gttaacaggcccattgattggaaagtatgtcaaagaatttcaggactctggggctttgctgctccatttacacaatgtgg
ttaccctgcattaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
gctagctgcctgttttgctcgcagcaggtctggagcaaaccttatcgggactgataattctgtcgtcctttcacggaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcagacgacccctctcggggccgcttggggatctatcgtcctcttctgcgtctgccgtaccgcccgtccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctgatcttgcccaaggtcttgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctccattttgccttctgatttctttccgtctactcgggaccttctcgacaccg
catcagctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagcagttttg
tgttggggtgagttgatgactctagctacctgggtgggaagtaatttggaagaccctgcctccagggatttggtagtcag
atatgtcaatgttaatatgggcctaaaaatcagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcatacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaacgaaaaaaggagattaaacttaatcatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggataaaggcattaaaccttattatcctgagcaggcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaacaacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggatttcttcccgatcatcagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaaccaggtaggagtgggagcattcgggc
cggggttcactccaccacacggcggtctgttggggtggagccctcaggctcagggcatattgacaacattaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|GQ358155_FT00000_P-RF-CB Feature FT:source GQ358155_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J022). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacagcaacatattgtactaaaaatcaagcagtgttttcgcaaacttcct
gtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaattctgtcgtcctctctcggaaat
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtcctcttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacaaccgaccttgaggcgtacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagccttgtatcgggaggccttagagtctccggaacattgctcacctcatcatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagcatcaagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcatgtctcacatttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatactgagtggcaaactccctcttttcctgacattcatttgca
tgaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagattaaaattaataatgc
ctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaaccaggcattatttacatacactgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377534_FT00000_P-RF-CB Feature FT:source GQ377534_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J41). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccactacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcctcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccgtttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaactccc
actggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtcgcgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaagacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacaaatctttct
gttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgtcaacagtgccagtagcacctcctcctgcctccacc
aatcggcagacaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ377556_FT00000_P-RF-CB Feature FT:source GQ377556_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J87). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaagcgatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtttgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaakctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggaaccgacaactctgttgtgctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgctgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggaggctctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttagtgtcttttggagtgtggattcgcactcctcctccatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaaggagcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaacctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacggtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacttcaacccycacaaggacaactggccggacgccaacawggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactattggggyggagccctcaggctcagggcatatccacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377560_FT00000_P-RF-CB Feature FT:source GQ377560_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J93). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcagctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccacttttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattatactaaaaatcaaacaatgttttcggaaacttcct
gtaaataggccaattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggtactgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacaaccgccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatcttctcgacaccg
cctccgctctgtatcgggaggctctagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggcaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacatacatttgca
ggaggacattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgcaaggttctatcccaacctcaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgtgggtccccatattcttgggaacaagagctacaccatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccttgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaagcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377564_FT00000_P-RF-CB Feature FT:source GQ377564_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J99). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccrccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggactaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactacagttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggggcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377594_FT00000_P-RF-CB Feature FT:source GQ377594_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J152). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccactttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatgggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgrccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagcccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacagctggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377611_FT00000_P-RF-CB Feature FT:source GQ377611_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J179). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatwggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggrctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaaa
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattactttaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377634_FT00000_P-RF-CB Feature FT:source GQ377634_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J242). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactctgcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacgcaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctctttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctttaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggaggttaggtta
atgatctttgtactgggaggctgtaagcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataaatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaactgtgccagcagct
cctcctcttgcctccaccaatcggcaatcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924618_FT00000_P-RF-CB Feature FT:source GQ924618_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate M35). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcaagtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttctacgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattcggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacggttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcataaaaccttattatcctgaacatacagtt
aatcattacttccaaacgaggcattatttacatactctgtggaaggctgggattttatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU357843_FT00000_P-RF-CB Feature FT:source GU357843_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Y580). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttatcgaagactggggaccctgcaccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatgcc
acagagtctagactcgtggtggacttctcacaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
aaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaacatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggccggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccctttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctcagccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataataggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctatccgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaaataatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaacttagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttagtcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GU385774_FT00000_P-RF-CB Feature FT:source GU385774_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C2-Shanghai). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgagcatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagagtccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttacctcaagaacatattgtacaaaaaatcaagcactgttttcggaaactgcct
gtcaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgagtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcatctacggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactttggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattgatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggaattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttgtggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700462_FT00000_P-RF-CB Feature FT:source HQ700462_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NZL_HU27_1996). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctgtatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagactaaaagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattatactcaaaatcaaaaactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgccctaatgcctttgtatgcatgtattcaagctaagcaagctttcactttttcgtcaacttacaaagtttttc
trtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtcccctccttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggrcatggacatygacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctattcgagacctcctcgacaccg
cctcagctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggwcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgaatggcaaactccctcttttcctgacattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggccctcttactgttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaagcgggcattctatataagagagaaactacacgcag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagtg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|HQ700485_FT00000_P-RF-CB Feature FT:source HQ700485_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NZL_TE55_1984). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaaaagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattatactcaaaatcaaacactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgccctaatgcctttgtatgcatgtattcaagctaagcaagctttcactttttcgtccacgtacaaagtttttc
tatgtaaacaatatatgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaactcatcgggactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctccgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagaytagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctattcgagacctccttgacaccg
cckcagctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgaatggcaaactccctcttttcctgacattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggccctcttactgttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaagcgggcattctatataagagagaaactacacgcag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagtg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700499_FT00000_P-RF-CB Feature FT:source HQ700499_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_F528C_2005). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttattttcctgctggtggctccagttccggag
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataagaccaaacgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggaaccttaccacaagaacatattgtactaaaaatcaaacactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaagcaagctttcactttttcgtctacttacaaggtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactccgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccgaccaacaac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagctc
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagttgtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctatctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattattaataggtgtcaacaatatgtgggccctcttacaattaatgaaaagcggagattaaaattaattatgc
ctgctaggttttatcccaaccttaccaaatatttgcccttagataaaggcataaaaccttattaccctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaagctggtgttttatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccggaggcaaatcaggtaggagcgggagcattcgggc
caggtttcaccccaccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700509_FT00000_P-RF-CB Feature FT:source HQ700509_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NC_3001_2003). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggragcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaaagatggggatattcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtaatcaaaatcaaacaatgttttcgaaaactgcct
gtacataggcctattgattggaaggtgtgtcaaagaattgtgggtttgttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgccgttgtatgcatgtatacaagctaagaaggctttcactttctcgccaacttataaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaacattctcggcaccgacaactctgtcgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctctacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctattcgggatctactcgacaccg
cctcagctctgtatcgggaggccttagagtccccggagcattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ttatgtcaatattaatatgggcytaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactggrctttattcttctactgtacctgtctttaatactgaatggcaaactccctcttttcctgacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacaabtaatgaaaaacggagattaaaattaattatgc
ctgctaggttctatcctaacyttaccaaatatttgcccctagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactactcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaagcccagggcatactgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700520_FT00000_P-RF-CB Feature FT:source HQ700520_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_GM009A_2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
tgccaaaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctttcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggccaaaattcgcagtccc
taacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgttgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaacccgcataaaaccaaacgatggggctactcccttcacttcatgg
gttatgtaattggaagttgggggtctttaccacaagaacatattgtactaaaaatcaaacaatgttttcgaaaactgcct
gttaatmggcctattgattggaaggtgtgtcaacgcattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaagcaatattcggccctttaccccgttgcccggcaacggtctggcctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctttgccgatccataccgcggaact
cctagcagcctgttttgctcgcagcmggtctggggcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtcgcggggccgcttgggactctaccgtccccttcttcgcctgccgttccggcccaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgattcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactcggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgcggagttactctcatttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cttcagctttgtatcgggaggccttagagtctcctgaacattgttcacatcaccatacagccctcaggcaagctgttctr
tgttggggtgagttaatgaatctggcgacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacctttcctgccttatgtttggaagagaaa
ctgttcttgagtttttggtgtcttttggagtgtggattcgcactcctcaagcctacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacaacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagcagatctcaatctcgggaatcccaatgttagtataccctggactcataaggtgggaaac
tttactgggctttattcttctacagtacctgtctttaatcctgagtggcaaactccctcctttcctaacatccatttgca
ggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagaggagactaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggcaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagcgggcgcattcgggc
cagggttcacccccccacacggaggtcttttggggtggagccctcaggctcagggcatgttaacatcagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagggacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700528_FT00000_P-RF-CB Feature FT:source HQ700528_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_W034A_2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgagaggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctccaggactggggaccctgcgccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaactttatgg
gatatgtaattggatgttggggtactttaccacaagaccatattgtactaaaaatcaagcaatgttttcgaaaacttcct
gttaataggcctattgattggaaggtgtgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgcccggcaacggtctggcctctgccaagtatttgctgatgcaaccccc
actggatggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccttgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cttcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggcgacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgca
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaccagtgccagcagcg
cctcctccggcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700531_FT00000_P-RF-CB Feature FT:source HQ700531_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_T107_1994). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgttagatcccagagtgaggggtctttattttcctgctggtggctccagttccggaa
cactaaaccctgttccgactactgcctctcccatatcgtcaatcttatcgaggactggggaccctgcactgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaagcacgggaccctgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaacccgaataaaacaaaaagatggggttactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattcaaaatcaagcactgttttcgcaaactgcct
gttaataggcctattgattggaaagtgtgtcaaaggattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcggcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaatctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgcttggggatctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctgtgcca
tgtcaacaactgaccttgaggcgtacttcaaagactgtgtgtttaaagactggaaggagttgggggaggagattaggtta
aaggtctttgtactaggagggtgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctttgtatagggacgccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaga
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttgca
ggaggacattatcaacaggtgtcagcaatatgtgggccctcttacagttaatgaaaagaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtatcaaaccttattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggcgggtattttatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaacccagattgggacttcaaccccaacaaggattactggccaaaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacacccgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF436922_FT00000_P-RF-CB Feature FT:source JF436922_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SZ16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggccttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcctttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcaacgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgcgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttaatctcttttttgcctttggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatccagaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatatctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF436923_FT00000_P-RF-CB Feature FT:source JF436923_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SZ19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacagaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagcccc
aaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttgtcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggccttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatacctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaattaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgcagctccctttacacaatgtgg
ttacccagcattaaagcctttgtatgcatgtatacaagctaagcaggcgttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttggtgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaaccagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgtagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtacaaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtatattatataagagagaaactacccgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF828933_FT00000_P-RF-CB Feature FT:source JF828933_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgaaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JF828935_FT00000_P-RF-CB Feature FT:source JF828935_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttgctagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgaaattggaagttggagtactttaccacaggaacatattgtattaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaagccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcgctcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JF828936_FT00000_P-RF-CB Feature FT:source JF828936_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgaaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcgttacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JF828938_FT00000_P-RF-CB Feature FT:source JF828938_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcacgacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgaaattggaagttggggtactttaccgcaggaacatattgtattaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JQ027310_FT00000_P-RF-CB Feature FT:source JQ027310_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagagggagcacccgcgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
tccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacakcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaggctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccatctcggggccgyttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactytcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggctaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcacgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgtwcacctcaccatacrgcactmagacaagytattctr
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagayccagcatccagggaakyagtagtmag
ctatgtcaatgttaatatgggcctaaaartcagacaactattgtggtttcacatttcytgtcttacttttggragagaar
ytgttctwgartatttggtgtcttttggagtgtggattcgcactcctccygcwtacagaccacmaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgamgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaacgaaagaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatacagtt
aatcattacttccagacgaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040142_FT00000_P-RF-CB Feature FT:source JQ040142_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 262). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatccaaaagtgagaggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcactggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattatacaaaaaattaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggcagtaacttggaagacccagcatccagggaattagtagtcag
ctatgttaatattaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttactcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaaccccgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040148_FT00000_P-RF-CB Feature FT:source JQ040148_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate G67). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtkgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccrraattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccwacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgstgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctst
ayttccaggaacatcaactaccagcactggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaarcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtackttaccrcargaacatattgtactaaaamtyaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaragaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttratgcctttatatgcatgtatacawtctaagcaggctttcactttctcgccaacttayaaggccttyc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgaygcaaccccc
actggatggggcttggcyattggccatcascgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaaatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtsccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgkggagttactytcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggcttkattcttctactgtacctgtctyyaatcctgagtggcaaactccctcytttcctaacatkcatttaca
ggaggacattattmatagatgtsaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagcgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatatctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040175_FT00000_P-RF-CB Feature FT:source JQ040175_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate G250). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacattacc
acagagtctagactcgaggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatm
ttcctctkcatcctgctgctatgcctcatcttcttgttggttcttctggactaycaaggtatgttgcccgtttgtcctct
amttccaggawcatcaackaccagcacsggaccatgcaaracctgcacraytcctgctcaaggaacctctatgtttccct
cwtgttgctgtacaaaacctwcggacggaaactgcacytgtattcccatcccatcatcttgggctttcgcaarattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacttaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcwaarcaggctttyactttctcgccaacttacaaggcctttc
trwgtaaacartatctgaacctttaccccgttgckcggcaacggycwggtctstgccaagtgtttgctgacgcaaccccc
actggwtggggcttggcyatwggccatcrscgcatgcgtggracctttgtgkctcctctgccgatccatactgcggaact
cctagcmgcttgttttgctcgcagcmggtctggrgcraaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaaatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX026887_FT00000_P-RF-CB Feature FT:source JX026887_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate WY-NJ-79). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgcaaattgcct
gtaaatagacctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttctgccttctgacttctttccttctattcgagatctcctcgacaccg
ccaccgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccgcacattcatttaca
agaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacatggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX429896_FT00000_P-RF-CB Feature FT:source JX429896_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate WY-HZ-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttacctcaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccaccgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctttctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ttgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgctcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661494_FT00000_P-RF-CB Feature FT:source JX661494_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1203-C2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctggatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttacctcaagaacatattgtactgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ttgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatcttggtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttttttccttctattcgagatctcctcgacaccg
cctcggctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcttctgttcctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagccttcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661498_FT00000_P-RF-CB Feature FT:source JX661498_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1213-C6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtattaaaactcaagcaatgttttcgcaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttactctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttatagacccccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatatacatttaca
ggaggacattattaatagatgtcaacagtatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccctattatcctgaacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcgttggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctcctcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774230_FT00000_P-RF-CB Feature FT:source KC774230_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cur1027). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcaccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccaccgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatctaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatactgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774234_FT00000_P-RF-CB Feature FT:source KC774234_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cur1038). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaacccgaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtcctgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaagcctttc
tgtgtaaacaatatatgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctttcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgataccg
cttcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttggacaaaggcattaaaccgtattatccggaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774323_FT00000_P-RF-CB Feature FT:source KC774323_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2057). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcggaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcgaaacttatcggtacggacaactccgttgttctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcgtccagggaattagtagggat
ttatgtcaatgttaatatgggactaaaaatcacacaactattgtggtttcttccttcctgtcttacttttggaagacaaa
ctgttcttgcttatctggtaacttttgcagcgtggatacgaactcctccagcttaccgaccaccaaatgcccctatctta
tcatcacttcgggaaactactgtggactcacgacgaggcaggtcccataggcgcgttactccctcgcctcgcagacgaga
agaccaattgccgcgtcccagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggggcttattattctacagtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaagccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacacactttgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774328_FT00000_P-RF-CB Feature FT:source KC774328_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2073). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctaaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtacttgcccttggacaaaggcattaaaccatattatccagaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcagtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873511_FT00000_P-RF-CB Feature FT:source KF873511_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 010_EA_Ram). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctttgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaatttgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctgggggagcttaccgcaagaccatattatccacaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagacctttc
tgtataaacaatatctgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaacatgggcctaaaaattagacaactattgtggtttcacatttcctgcctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccgcacggcggtcttcttgggtggagcccgcaggcccagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacccctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873515_FT00000_P-RF-CB Feature FT:source KF873515_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 022_EA_Gap). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatatcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcacyaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctgggggagcttaccgcaagatcatatcatccgaaaaatcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacacag
ccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgcctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttctggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacccctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873519_FT00000_P-RF-CB Feature FT:source KF873519_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 017_EA_Gun). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaccatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcacyaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctgggggagcttaccgcaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcaggcggggaacctttgtggctccgctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tggcaacgaccgaccttgaggcrtacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aagrtytttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ccaccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctaacttttggaagagaaa
cggtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcmmgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacaattaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873532_FT00000_P-RF-CB Feature FT:source KF873532_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 031_TI_Ngu). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagccctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgattactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtcccttttttccgctat
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacgaaaagatggggttattccctcaacttcatgg
gatatgtgattggcagctggggaagcttaccacaagatcatattgtgcaaaaaatcaaacactgttttagaaaactccct
gttaataggcctattgattggaaagtgtgccaacgaattgtgggtctattgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcmtttccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttggggatataccgtccccttcttcgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactatcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctattcgagatcttctcgacactg
catccgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaca
tgaagatattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactagacattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggaggtcttttggggtggagcccacaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatttctccaccactaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873540_FT00000_P-RF-CB Feature FT:source KF873540_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 003_DR_Dal). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatctycacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcacyaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagyccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctatacaacatcttgagtcccttttttccgctgt
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacaaaacgatggggttattccctcaacttcatgg
gatatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacacagttttagaaaacttccc
gttaataggcctattgattggaaagtatgtcaacgaattgtaggtctcttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgccaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactccgttgtcctttctcggaaat
acacctcctttccatggctgctcggttgtgctgcraactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaaccccgcggacgacccgtctcgcggccgcttggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
atgtcgcatggcgaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccmttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctccttgacactg
cctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctwttctg
tgttggggtgarttaatgaatctggctacctgggtaggaagtaatttggaagatccagcatccagggaattagtartcag
ttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatcttttggagtgtggattcgcactcctcycgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggcccccttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggtattctatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcrggagcattcgggc
cagggttcactcccccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873542_FT00000_P-RF-CB Feature FT:source KF873542_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 038_DR_Wad). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctatacaacatcttgagtcccttttttccgctgt
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacaaaacgatggggttattccctcaacttcatgg
gatatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacacagttttagaaaacttccc
gttaataggcctattgattggaaagtatgtcaacgaattgtaggtctcttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactccgttgtcctttctcggaaat
acacctcctttccatggctgctcggttgtgctgcgaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaaccccgcggacgacccgtctcgcggccgcttggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
atgtcgcatggcgaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctccttgacactg
cctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatcttttggagtgtggattcgcactcctcycgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggcccccttacagtcaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttttatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggtattctatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcactcccccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873543_FT00000_P-RF-CB Feature FT:source KF873543_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 050_DR_Wad). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctatacaacatcttgagtcccttttttccgctgt
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacaaaacgatggggttattccctcaacttcatgg
gatatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacacagttttagaaaacttccc
gttaataggcctattgattggaaagtatgtcaacgaattgtaggtctcttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactccgttgtcctttctcggaaat
acwcctcctttccatggctgctcggttgtgctgcgaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaaccccgcggacgacccgtctcgcggccgcttggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
atgtcgcatggcgaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctccttgacactg
cctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggcccccttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggtattctatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcactcccccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173279_FT00000_P-RF-CB Feature FT:source KJ173279_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX004C(e207)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacggtggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggagccttcgtgtctcctctgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcttgttgtaccgaccgactac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttaca
ggaggacattattaatagatgtcagcaatatgtgggccctcttacagttaatgaaaacaggagattaaaattaattatgc
ctgctaggttttatcccaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173300_FT00000_P-RF-CB Feature FT:source KJ173300_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HS005M(e23)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttgccacaagaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggag
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgactac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcctcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcgtttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattactttaaaaccaggcattatttacataccctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173358_FT00000_P-RF-CB Feature FT:source KJ173358_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX065M(e314)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcsaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccttccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttgcataagaggactcttggacttttagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtttgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttttgtggagttactttcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggttcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803785_FT00000_P-RF-CB Feature FT:source KJ803785_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY34920). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
actaccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatctaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaagcaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
gtatccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaaacctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcctctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggaccttctcgacaccg
cctctgctctgtgtcgggacgccttagagtctccggaacatgtttcagctcaccatacagcactaaggcaggctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctcaaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcttcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttaccgttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttagataaaggtatcaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttccgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatctttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803798_FT00000_P-RF-CB Feature FT:source KJ803798_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY464961). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccatcaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcaccggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattggaagttggggcacattaccacaggaacatattgtacaaaaaatcaaaatgtgctttaggaaacttcct
gtaaacagacctattgattggaaagtatgccaacgaattgtgggtcttttggggtttgccgcccctttcacacaatgtgg
ataccctgctttaatgcctttgtatgcatgtatacaagcaaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacagtatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggaggtgaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaacttcttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgaggtaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacggtaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtctcacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttatagacctccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccttcttttcctcacattcatttgaa
agaggatattattaatagatgtcaacaatatgtaggcccgcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaacggtactaaatatttgcccttagataaagggattaaaccttattatcctgaacatgtagtt
aatcattacttccaaactaggcattatttacatactttgtggaaggctggtattttatataaaagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtccccaatcctctgggattcttccccgatcatcagttggaccctgcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacatcaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcaaggcatattgacaaccgtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803803_FT00000_P-RF-CB Feature FT:source KJ803803_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY501032). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcaatcaggcaagctatcctg
tgttgggttgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattgattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
gagcattacttccagacgagacattatttacacactctttggaaggcggggattttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaaatggccggacgccaacaaggtgggagtgggagcagtcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggatactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM213033_FT00000_P-RF-CB Feature FT:source KM213033_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate WSQ-k1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttattgggactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacggcactcaggcaagctatcctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttgggagagaca
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcctctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatacttgcccttggacaaaggcattaaaccgtattatccggaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013806_FT00000_P-RF-CB Feature FT:source KR013806_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccggttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacgaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggttctttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcgccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatattggcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgccttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KR013816_FT00000_P-RF-CB Feature FT:source KR013816_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgtcgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcgacg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtactttaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccatccgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcataaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679958_FT00000_P-RF-CB Feature FT:source KU679958_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 125_WA_War). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccagcaagcgctrctcgatccgagagtraggggtctgtatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcrtcaatcttcrcgaagactggggaccctgcamcgaacatggag
agcacamyatyaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggargctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgactaccagcacgggaccttgcagracctgcaccataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatctygagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacccccacaaaacgaaaagatggggttattccctcaacttcatgg
gctatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacattgttttaggaaacttccy
gttaataggcctattgattggaaagtgtgccaaagrattgtgggtctaytgggctttgctgccccattyacacaatgtgg
atatcctgccttgatgcctttgtatgcatgtatacattctaaacaagctttcacyttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgmacctttaccccgttrcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggytggggcttggccataggccatcagcgcatgcggggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcctgtttcgctcgcagccggtctggagcgaaccttmtcggcaccgacaactcmgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgcgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatgtaccgtccccttcttcgtctaccgttccggccgaccac
ggggcrtacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccrtgaacgcccacatgagcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagyaccatgcaactttttcacctctgcctaatc
atctcatrttcatgtcctactkttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgrtttctttccgtctattcgagatctcctcgacaccg
catccgctctgtatcgggaggccttagagtctccggagcattgcacacmtcaccatacagcactcaggcaagctattttg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ttatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaacgaggcaggtccactagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcratagatgtcaacaatatgtgggccctctkacagttaatgaaaaaagaarattaaaattrattatgc
ctgcyaggttctatcctrcccttaccaaatatttgcctttagacaaaggyattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccckgcgttcggagccaactc
aaacaatccagattgggatttcaactccaacaagrmtcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtctgttggggtggagcccgcaggcccagggcatattgacaacggtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacarcccactcccatctcaccaccyctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU695741_FT00000_P-RF-CB Feature FT:source KU695741_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5022). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtccatcttctcgaggactggggaccctgcaccgaacatggag
aataccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagagatggggctattcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgcccacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaactccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaacattctcggaaccgacaactctgtcgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtccctgtctttaatcctgagtggcaaaccccctcttttcctgacattcatttacg
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttagataaaggcattaaaccttattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagcgagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaagtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU695742_FT00000_P-RF-CB Feature FT:source KU695742_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5072). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtaaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataagaccaaacgatggggttattcccttaacttcatgg
gatatgtcattggaagttggggtactttaccacaggaccatattgtacaaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtctgttgggatttgctgccccttttacacaatgtgg
gtatcccgctttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaggtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggacatgagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaacattatcgggaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctccgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctatacgagatctcctcgacaccg
cctcagccctgtatagggaagccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctagctacctgggtgggtagtaatttggaagaccccgcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccatcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttgaa
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattacaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggataaaggcattaaaccttattatcctgcacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtattttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU695744_FT00000_P-RF-CB Feature FT:source KU695744_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5075). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtccaacttcgcgagaactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggaactttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcgtgtatacaagctaagcaggctttcactttctcgtcaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctcagccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattctcggcaccgacaactctgtcgtcctctctcggaagt
acacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtcgcggggccgtttggggatgtaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcta
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcttccagagaattagttgtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccacccaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtccctgtctttaatcctgagtggcaaaccccctcttttcctgacattcacttgca
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgccaggttctaccctaaccttaccaaatatttgccattagataaaggcatcaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagcgagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU695746_FT00000_P-RF-CB Feature FT:source KU695746_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5093). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtccagcttcgtgagaattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgccttatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaaccacaaccaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactcaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagcgaagcaggcttttactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagccggtctggagcaaacatcctcggaaccgacaactctgttgtcctctctcggcggt
acacctcctttccatggctgctaggttgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgccgacgacccgtctcggggccgcttggggatctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcttttttgccttctgatttctttccgtccattcgggatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ttatgtcaacgttaatatgggcttaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtccctgtctttaatcctgagtggcaaaccccctcttttcctgacattcatttgca
ggaggacattatcaataggtgtcaacaatttgtgggccctcttacagtcaacgaaaaaaggagattaaaattaattatgc
ctgctaggttttaccctaaccttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagcgagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atgggcacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcgctggccagaggcaaatcaggtaggagcgggagcattcgggc
caggtttcaccccaccacacggaggtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963863_FT00000_P-RF-CB Feature FT:source KU963863_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963864_FT00000_P-RF-CB Feature FT:source KU963864_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963866_FT00000_P-RF-CB Feature FT:source KU963866_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963867_FT00000_P-RF-CB Feature FT:source KU963867_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963883_FT00000_P-RF-CB Feature FT:source KU963883_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 6_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggagcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgcctgctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacac
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964001_FT00000_P-RF-CB Feature FT:source KU964001_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964006_FT00000_P-RF-CB Feature FT:source KU964006_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttctcatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964008_FT00000_P-RF-CB Feature FT:source KU964008_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964009_FT00000_P-RF-CB Feature FT:source KU964009_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaaccttcgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964010_FT00000_P-RF-CB Feature FT:source KU964010_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 15_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacatggttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964303_FT00000_P-RF-CB Feature FT:source KU964303_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaatcggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964314_FT00000_P-RF-CB Feature FT:source KU964314_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 36_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaccctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470893_FT00000_P-RF-CB Feature FT:source KY470893_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 24-B1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagggtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaacataagcaggctttcactttctcgccaacttacaaggcctttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggaacttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279264_FT00000_P-RF-CB Feature FT:source LC279264_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_father_hair). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacactctaagcaggctttcactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcc
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacgtaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatactccaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279266_FT00000_P-RF-CB Feature FT:source LC279266_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi_father_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacactctaagcaggctttcactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcc
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttatactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279267_FT00000_P-RF-CB Feature FT:source LC279267_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Hi-child_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacactctaagcaggctttcactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcc
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttatactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF925370_FT00000_P-RF-CB Feature FT:source MF925370_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate BD-HBV14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaacacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagctggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggaacctgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtagg
ctatgtcaatgttaacatgggcctaaaactcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaacctaaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtatattatataagagagaaactacacgaag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG826148_FT00000_P-RF-CB Feature FT:source MG826148_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate YNKM50). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacctttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaaccaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacattacctcaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtacatagacctattgattggaaagtatgtcaaagaattgtggggcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtatgcatgtatacaagctaagcaggcttttaccttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcaaaccttatcggaactgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgggccttctcatctgccggaccgtgtccatttcgcttcacctttgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactccggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttgca
ggaagacattattaagagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG893555_FT00000_P-RF-CB Feature FT:source MG893555_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SD14022). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaaaagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcactggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacactgttcgcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaactttaccaagtatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggattactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagcgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK321265_FT00000_P-RF-CB Feature FT:source MK321265_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 1331). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagancccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgntgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctnttggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacactg
cctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
tgaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcnggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB031265_FT00000_P-RF-CB Feature FT:source AB031265_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV VietF-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
amttccaggawcatcaacyaccagcacsggaccatgcarracctgcacgaytcctgctcaaggaacctctatgtttccct
cwtgttgctgtacaaaacctwcggacggaaaytgcacytgtattcccatcccatcatcttgggctttcgcaaratwccta
tgggagtgggcctcagtccgtttctcytggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgactccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaccaaaaccaaacgttggggctacacccttaactttatgg
gatatgtaattggaagttggggcaccttaccacaggaacatattgtacacaaaatcaaacactgttttcggaaacttcct
attaatagacctattgattggaaagtatgtcaacgcattgtggggcttctgggatttgccgctccttttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaarcaggctttyactttctcgccaacttacaaggcctttc
tgwrtmaacartatctgaacctttaccccgttgctcggcaacggtcwggtctwtgccaagtgtttgctgacgcaaccccc
actggytggggcttggccataggccatcagcgcatgcgyggaacctttgtgkctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaattctgtcgtgctgtcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactggaacctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacatacatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcacaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacagcagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB195939_FT00000_P-RF-CB Feature FT:source AB195939_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatacctctat
taccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactcaaactcaagcactgttttcgaaaattgcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB195941_FT00000_P-RF-CB Feature FT:source AB195941_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctttgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttatacctctat
taccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactcaaactcaagcactgttttcgaaaattgcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB195950_FT00000_P-RF-CB Feature FT:source AB195950_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcccttatatgcatgtatacaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgtcaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactcagttgtcctctctcggaaat
acacctcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgataccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcgaagcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB195951_FT00000_P-RF-CB Feature FT:source AB195951_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcccttatatgcatgtatacaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgtcaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactcagttgtcctctctcggaaat
acacctcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgataccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcgaagcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB195955_FT00000_P-RF-CB Feature FT:source AB195955_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactcaaaatcaagcactgttttcgaaaattgcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB195956_FT00000_P-RF-CB Feature FT:source AB195956_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcaccgaatatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactcaaaatcaagcactgttttcgaaaattgcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatccaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctattcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattcacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB198084_FT00000_P-RF-CB Feature FT:source AB198084_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctgtat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcgagaacatattgtaatgaaaatcaagcaatcttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcctgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttatgccttctgacttctttccttctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaattactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB300369_FT00000_P-RF-CB Feature FT:source AB300369_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaacaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccacat
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggttattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
catagcggcttgttttgctcgcagccggtctggagcgaaacttattgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggacttccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaagaccaagcatccagggaagcagtagtcaa
tcatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaacttacaaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcaatt
aatcattacttcaaaactaggcattatttacatactctgtgggaggctggcattctatataagagagaaactacacacag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtgggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB367419_FT00000_P-RF-CB Feature FT:source AB367419_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate LAMr Pt. 28). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctttgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttctctttgggtatacatttgaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggccttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaacgactgggaggagctgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctcctgaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacctttcctgccttatgtttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcagatcaggtgggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggaggagccctcaggctcagggcatattgacaacagtgccagctgcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367800_FT00000_P-RF-CB Feature FT:source AB367800_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ADVT Pt. 24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggtctttcccccac
tgtgtggctttcagttatgtggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaagatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacccaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacgtacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggacgacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtgaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttagaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB493840_FT00000_P-RF-CB Feature FT:source AB493840_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 16UC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatctcgtcaatcttctcgaggattggggaccctgcacagaacatggag
agcacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacgggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctcacaaaactaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtattaaaaatcaagcagtgttttcggaaacttcct
gtaaataggcctattgattggaaggtgtgtcaacggattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
gtatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggaccgacaattctgttgtcctctctcggaaat
acacctccttcccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacaaccgaccttgaggcgtacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggacctccttgacaccg
cctcagctttgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttagaagacccagcatccagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcatatttcctgtctcacatttggaagagaaa
cggttcttgaatatttggtgtcctttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactcaacctgtctttaatactgagtggcaaactccttcttttcctgacattcatttgca
ggaggacattatcaataggtgtcaacaatttgtgggccctcttacagttaatgaaaagcggagattaaaattaataatgc
ctgcgaggttctatcctaaccttaccaaatacttgccattagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaaccaggcattatttacatactctgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcattggccaaaagcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|AF411409_FT00000_P-RF-CB Feature FT:source AF411409_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggctgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccagtttacaaggcctttc
tatgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaacttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccacaaaatgcccctatctta
tcaacacttccggaagctactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctgacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaaccacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtccaaacctcgacacggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggaaccctcaggctcagggcatattgaaaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AP011102_FT00000_P-RF-CB Feature FT:source AP011102_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacaggaccttgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactgaaaatcaaacattgttttcgaaaacttcct
gtaaaccggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatatcagctaagcaggctttcactttctcgccaacttacaaggccttcc
tgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtctggtttctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcattaggccagcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggtaccgacaactctgttgtcctctctcgcaaat
acacctcatttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggggtctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacttggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctcggctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctgttctg
tgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtctcacatttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactccccccgcttacagaccacctaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccttcttttcctgacattcatttaca
ggaggatataatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaagcggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatacttaccgttagacaagggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaacgaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctgtctgttcccaatccgctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaaacaagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagcgggagcatttgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagctgca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AP011105_FT00000_P-RF-CB Feature FT:source AP011105_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttctgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaagcgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccgcaagatcatattgtagaaaagatcaagcattgttttcgaaaacttcct
gttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttgggctttgctgccccttttactcagtgtgg
gtatccagccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttt
taagcaaacaatatctgaacctttaccccgttgcccggcaacggcctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccatctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagttgtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggggtgtggattcgcacccctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcctgacatacatttgcg
ggaggacattattaacaaatgtcaacaatatgtaggccctcttacagtcaatgagaaaagaagattatccttaattatgc
cggctaggttttatcctaatataaccaaatatttgcccttagataaaggcattaaaccttattatcctaaccatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagagactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgaacatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcgttcgggc
cagggttcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcatattgacaccagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY040627_FT00000_P-RF-CB Feature FT:source AY040627_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacatccttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctttctctgccgttccgaccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatactgcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggactaaaaatcagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccattggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgcggaaggctggcattctatataagagggaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctctcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagca
cctcctcctgcctccacctatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167095_FT00000_P-RF-CB Feature FT:source AY167095_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate IIc). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctactagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaactagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089798_FT00000_P-RF-CB Feature FT:source DQ089798_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HK477). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtattcaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctcttccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctcctagctgtgccttgggtggctttagggcatggacattgacccatataa
agaattgggagcttccggggagttactctctttttggccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccaggatccaggcaagcagtagtcag
ctatgtcaatgttamtatgggcctaaaaatcagacaactatggtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggatcctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcacttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871981_FT00000_P-RF-CB Feature FT:source EU871981_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 318-95-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccgccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactggggggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871999_FT00000_P-RF-CB Feature FT:source EU871999_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 530-00-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgttagaccccagagtgaggggcctatactttcctgctggtggctccagttccgcaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcagacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggcccagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtcctaaaaatcaaacactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccgccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactggggggagctgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttaccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcatctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU882006_FT00000_P-RF-CB Feature FT:source EU882006_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate patient22). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctctgctagatcccagagtgaggggcctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgttccgactactgcctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaaccagtaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgctgt
taccaattttctgttgtctttgggtatacatttgaaccctcacaaaacaaaaagatggggatattcccttaactttatgg
gatatgtaattgggggttggggcactttaccacaggaacatattgtactaaaaatcaagcaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgccttaatgccattgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcacgtctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccccttctgcttctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttagagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcagagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctccgctctgtaccgggaggcattagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagatccagcatccagggaattggtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacatttgggagagaaa
ctgtccttgaatatttggtgtcttttggagtgtggattcgcactcctgccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatacagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccttattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|EU916232_FT00000_P-RF-CB Feature FT:source EU916232_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate S8.3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagagtcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacaaccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaaatcaagcaatgctttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatacgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcggcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagcgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccataccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU916239_FT00000_P-RF-CB Feature FT:source EU916239_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SWT3.1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgctgccggtcgggagcaacacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgttagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcgatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaatatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939606_FT00000_P-RF-CB Feature FT:source EU939606_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C206). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtcctcttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatctggaagacccagcatcccgggaattagttgtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagaaaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcctctactgtacctatctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcactatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggcatggggacgaatctt
tctgttcccaaccccctgggattctttcccgatcaccagttggaccctgcattcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU939621_FT00000_P-RF-CB Feature FT:source EU939621_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C94). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcgtgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaagtgtgtcagagaattgtgggtttgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctggagagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcctgaacattgttcagctcatcatacggcactcaggcaagctattctg
tgttggggggagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcatgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctgctgcatatagaccaccaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgttagtattccttggacacataaggtgggaaat
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgataaatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939630_FT00000_P-RF-CB Feature FT:source EU939630_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C122). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacttccctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttataccgctat
taccaattttcttatgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccgcaggagcatattgtactgaaactcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcactcctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcctctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggacttagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacctttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagacctccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcctaatgttactaaatatttgcccttagataaaggaatcaaaccttattatccagagcatgtagtt
aatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtag
cgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccacacgggggactgttggggtggagccctcaggctcagggcatattcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562226_FT00000_P-RF-CB Feature FT:source FJ562226_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctaggtcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtggctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgattggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggtattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaagtctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtgttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562227_FT00000_P-RF-CB Feature FT:source FJ562227_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I25). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatacattcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggaactttaccacaagaccatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcwggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctatctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtgttgcccaaggtcttatataaaaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atggtctttgtactaggaggctgtaggcataaaktggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttcaattcgagatctcctcgacactg
cctctgctctatatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ttatgtcaatgttaacatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgaggcaggtccgctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcc
cctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562267_FT00000_P-RF-CB Feature FT:source FJ562267_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I120). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctttgctagaccccagagtgagaggcctatactttcctgctggtggctccagttccggaa
cagtagaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcaccaaagtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattggggtccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccagacgttggggctactccctcaatttcatgg
gatatgtaattggaagttggggaactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgccgccccttttacacaatgtgg
ctatccagccttaaagcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctatcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggatttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcaatcaggcaagttgtcctg
tgttggggtgatttgatgaatctagccacctgggtgggaagtaatctggaagatccagcatccagagaattaatagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtctcacttttggaagagaga
ctgttattgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagacccccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccatattatcctgaacaagcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggcgggtattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttgggcctccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562287_FT00000_P-RF-CB Feature FT:source FJ562287_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I151). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggccttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgactac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtttgttcacccaccccaagcaactttttcacctttgcctaatc
atttcctgttcaagtcctactgttcaagccttcaaagtgtgccttggggggctttggggcatgggccttgacccgtataa
agaatttggagcttttggggagttacttttttttttgccttttgacttttttccttccattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ562314_FT00000_P-RF-CB Feature FT:source FJ562314_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate I206). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtggggcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttctgctgccgttccagccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacttgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctaccgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgagcatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377544_FT00000_P-RF-CB Feature FT:source GQ377544_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J69). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggct
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctgcttctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagataaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377592_FT00000_P-RF-CB Feature FT:source GQ377592_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J149). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccaccggaccatgcaaaacctgcacgattcctgctcaaggaacctctttgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaaaatgtgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
tgagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcaccgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcggaactgacaattctgtcgtgctctcccgcaagt
atacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttgggactctaccgcccgcttctccttctgttgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaatgactgggaggagtttggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggctctagagtctccggagcattgttcacctcaccatacggccatcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatcaagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttgggagacaaa
ttgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctccctatagaccccaaaatgcccctatctta
tcaacacttccggaaactactgttattagaggaaggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcgtttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaagattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatacaaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaaccaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377596_FT00000_P-RF-CB Feature FT:source GQ377596_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J156). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtagatataaattggtgtgttcacaagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactattggggtggagccctcaggctcaaggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377602_FT00000_P-RF-CB Feature FT:source GQ377602_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J165). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctat
taccaattttcttttttctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccctgatgcctttatatgcatgtatacaatctaagcaggctttcacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcgccgtatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaagcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctctcgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgctagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccaaacgcgacattatttacacactctttggaaggcggggattttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377607_FT00000_P-RF-CB Feature FT:source GQ377607_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J172). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggtctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggtgattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttcaaaaccaggcattatttacataccctgtggaaggctggcattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377633_FT00000_P-RF-CB Feature FT:source GQ377633_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate J241). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagaccccagagtgaggggcctataytttcctgctggtggctccagttccggaa
cagyaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
arcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactcaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcaccaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctccttgacaccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700518_FT00000_P-RF-CB Feature FT:source HQ700518_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_D071A_2005). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagatcccagagtgaggggcctttattttcctgctggtggctccggttccggaa
cagtaaaccctgttccgactattgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacctctacaaccagcacgggaccatgcaagacttgcacgactcctgctctaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaagcgatggggctactctctcaactttatgg
gctatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcgaaaccttcct
gttaataggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacacgctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgcacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccgtaggccatcagcgcatgcgtggaacctttgtggctcctttgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcacggacaactctgttgttctctctcggaagt
acacctcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgttccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatttaccgtccccttcttcgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcctaaggtcttgcataagaggactcttggactctcagcca
tgtcaacggccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaactagtagttag
ttatgtcaatgttaatatgggcctaaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcctttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcacttgca
ggaggacattattgatcgatgtcaacaatatgtgggccctcttacagttaatgaaaagaggagattaaaattaattatgc
ctgccagattctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatccagaacatgtagtt
aatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggaggtattttggggtggagcccgcaggctcagggcatattgacaccagtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700523_FT00000_P-RF-CB Feature FT:source HQ700523_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_P032C_2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaagctctgttagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cactaaaccttgttccgactactgcttatcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaagcacgggaccctgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaaagatggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaggaacatattgtattaaaaatcaaacagtgttttcgcaaacttcct
gttaataggcctattgattggaaagtgtgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacacgctaagcaggcttttactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcggcgcatgcgaggaacttttgtggctcctttgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgattggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagaggactcttggactctctgcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcatttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctttatatagggacgccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattartagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaga
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttgca
ggaggacattatcaacaggtgtcagcaatatgtgggccctcttacagttaatgaaaagaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtatcaaaccttattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggcgggtattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaaaccagattgggacttcaaccccaacaaggatcactggccgaaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaccagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700526_FT00000_P-RF-CB Feature FT:source HQ700526_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_PNG_143PF_2005). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccatcaagctctgctagatcccagagtgagaggcctgtattttcctgctggtggctccagttccggaa
cagtaacccctgttccgacttctgcctctaccatatcgtcaatcttatcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaactaagcgatggggatattcccttaacttcatgg
gttatgtaattggaagttggggtaccttaccacaggaacatattgttctaaaactaaagcaatgttttcgaaaacttcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtatacacgctaaacaggctttcactttctcgccagtttacaaggcctttt
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcagcgcatgcgtggtgcctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaactcatcggaaccgacaactctgttgtgctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttctctgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgaatattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccacacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggctacctgggtgggaagtaatttggaagatcctgcatccagggaattagtagttag
ttatgtcaacgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcctttcctgacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggaggttaaaattaatcatgc
ctgctagattttatcctaaccttaccaaatatttgcccctagataaaggcattaaaccttattatccggaacatgcagtt
aatcattactttaaaactaggcattatttgcatactctgtggaaggctggcatcctctataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctctggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagttagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700554_FT00000_P-RF-CB Feature FT:source HQ700554_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_NZL_PA81). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgygttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaaaagatggggttattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccmcaagaacatattatactcaaaatcaaacactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
atatcctgccttaatgccrttgtatgcatgtattcaagctaagcaagctttcactttttcgycaacttacaaagtktttc
tatgtmaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgattggggatctaccgtccccttcttcgtctgccgttccggccaactac
ggggcgcacctctctttacgcagtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacatggyattgcccaaggtcttgcataagaggactcttggactctccgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagcttagatta
aagatctttgtactaggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgaccattataa
agaatttggcgcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
ccacagctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacagcaatcaggcaagctgttctt
tgttggggggagttaatgaatctggcyacctgggtgggaagtaatttggaagacccagcatccagggaactagtggtcgg
ttatgtcaacattaatatgggcataaaaatcagacaactattgtggtttcacctttcctgtcttatgtttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgaatggcaaactccctcttttcctgacattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggccctcttacagctaatgaaaaaagaagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttcagttcccaatcctctgggattctttcccgatcaycagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagckggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700560_FT00000_P-RF-CB Feature FT:source HQ700560_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate C_Tonga_BE4253_2001). Complete genome. [Hepadnaviridae] (length=3215 residues).
tkccacaacattccaccaagctctgctagatcccagagtaaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaaaagatggggctattcccttaacttcatgg
gttatgtaattggaagttggggtaccttaccacaagaccatattatactaaaaatcaaacactgttttagaaaacttcct
gtaaataggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgcattaatgcctttgtatgcctgtattcaagctaaacaagctttcactttctcgtcaacttacaaggtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcggcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatcttccgtccccttcttcgtctgccgtaccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactmaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcttccagggaattagttgtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtcttcaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaagctggcgttctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacatcagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF436919_FT00000_P-RF-CB Feature FT:source JF436919_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SZ5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatccggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatctgcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcatgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagcgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttctacctctat
taccaattttcttttatctttggggatacagataaaccctagtaaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacagggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggtaccgacaactctgtcgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctttcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggactgtgtgcgcttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaatgagtgggaggagttaggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccccctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccctaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttcaaaactagacactatttacatactctgtggaaggctggtattctatataaaagagagtccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggactctttcccgatcaccagttggacccagcgttcggagccaactc
aaacaatctagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggaacgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|JF828934_FT00000_P-RF-CB Feature FT:source JF828934_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate ES72-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggttttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgaaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacacccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcagacaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgctttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JN400086_FT00000_P-RF-CB Feature FT:source JN400086_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate HBV-75-Baby). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccccgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgcacctttaccccgttgcccggcaacggcctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcatcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgcaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcaagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagayccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040174_FT00000_P-RF-CB Feature FT:source JQ040174_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate G246). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcaggaa
cagtgagccctgttcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggamcctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcytgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcyttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcgrcaacggtcaggtctytgccaagtgtttgctgacgcaaccccc
actggmtggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctrgcagcttgttttgctcgcagccggtctggagcraaacttatcggmaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcrgacgacccgtctcggggccgtttgggmctctaccgtccccttcttcrtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctyggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaaatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgatattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactgaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ732168_FT00000_P-RF-CB Feature FT:source JQ732168_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate DT2007). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtacggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccctaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgttctaaaactcaagcaatgttttcgaaccctgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcttttc
tacgtcaccaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcttctgccgttccggcctgccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggcccccttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacacactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagctttcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661485_FT00000_P-RF-CB Feature FT:source JX661485_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1201-C1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctggtggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcactggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaacccgaataaaaccaagcgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaaggcctccagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccatctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaaa
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagtg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661487_FT00000_P-RF-CB Feature FT:source JX661487_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SH1207-C3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccgtcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgttcaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcccgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagctccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatctagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagagactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagctgca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC315400_FT00000_P-RF-CB Feature FT:source KC315400_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate M0914). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctcaagttccggaa
cagtaaaccctgctccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgtaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcaccggaccatgcaaaacctgcacaactactgctcaagggacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttatctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcactttgcctcaggaacatattgtacaaaaaatcaagcaatgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacraattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggaggttaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaattctg
tgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcatattcacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774186_FT00000_P-RF-CB Feature FT:source KC774186_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz1026). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgggagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtcaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcccttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattggtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774193_FT00000_P-RF-CB Feature FT:source KC774193_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz1035). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtacttaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccttttacacaatgtgg
ttatcctgccttaatgccgttgtatgcctgtatacagtctaggcaggcttttactttctcaccaacatacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcaggcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggtcctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatccggaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774198_FT00000_P-RF-CB Feature FT:source KC774198_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate clz2039). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatcgaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccgtaggccatcagcgcatacgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggtactgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttgggactctaccgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcatttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactataccggtctttaatcctgagtggcaaactccctcctttccttacattcatttgca
ggaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgctaggttttatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctcctcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774246_FT00000_P-RF-CB Feature FT:source KC774246_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cww1014). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtattcaagctaagcaagcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggctggcccataggccatcagcgcatgcgtggaaccttggaggctccttggctcctccatagttccgtact
tcgagcagtttggcaggcttgcagccggtcaggagctaaggagctaggaacggacaaatccgtaatcctctcttggaatt
tcacatcctctccatggttgcaagggtgtgctgccaagtggaccattggagggacgtcgggagtttacgtgccgtcggcc
cggaatcccgcggacgaccggtctcgccgccgtggggccgtttgcggtccccttgttcctttgccgttccggcggaccac
ggggcgcacgggcgcacccgcggtctccccgtccgtcccttggcatctgccggactccctgcccttcggctcacctctgc
accttgcatggaaaccaccgtgaagaccccccgagcccccccccaagccccacgtaagaggactagtggactcttagcag
ggtcaaagagttgtcgacaggcatacttccaagcttcaaagattaaagaatgggaggagttgggggaggagattaggtta
aggatctgtgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtgttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774291_FT00000_P-RF-CB Feature FT:source KC774291_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa1194). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccacttttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcggaaacttcct
gtaaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgccattgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacacactttgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccacctcacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774305_FT00000_P-RF-CB Feature FT:source KC774305_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa1672). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgcggggcctatattttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccagatcttgcccaaggtcttacataagaggactcttggactctcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagaccctgcttcccgggaattagtagtcgg
ctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctgtcttacgtttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcccgaaaatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774322_FT00000_P-RF-CB Feature FT:source KC774322_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxa2053). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactacct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggatcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774344_FT00000_P-RF-CB Feature FT:source KC774344_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate cxn1049). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcggaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaaggctgcattctatataagagagaaactacacgcag
cgcctctttttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacagcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873513_FT00000_P-RF-CB Feature FT:source KF873513_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 024_K_Kal). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattygcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctgggggagcttaccacaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaacgaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactttcagcra
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccmttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ccgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcrg
ttatgtcaatgttaacatgggcctaaaaattagacaactattgtggtttcacatttcctgcctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatcttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacccctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873518_FT00000_P-RF-CB Feature FT:source KF873518_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 016_EA_Gap). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagygccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggttttgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctggggaagcttaccgcaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaacgaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
ccttgcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagaktaggtta
awgrtytttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacaccg
ctgccgctctgtatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtctgacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcmmgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttactattaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagyagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873533_FT00000_P-RF-CB Feature FT:source KF873533_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 028_TI_Ngu). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagccctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgattactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtcccttttttccgctat
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacgaaaagatggggttattccctcaacttcatgg
gatatgtgattggcagctggggaagcttaccacaagatcatattgtgcaaaaaatcaaacactgttttagaaaactccct
gttaataggcctattgattggaaagtgtgccaacgaattgtgggtctattgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttggggatataccgtccccttcttcgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactatcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttrgggcatggacattgaccmttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttttttccgtctattcgagatcttctcgacactg
catccgctctatatcgggaggccttagagtytccggaacattgttcacctcaccatacagcactcaggcaagctattytg
kgttggggtgagttaatgaatcttgctacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaca
tgaagatattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctaggttctatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactagacattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggaggtcttttggggtggagcccacaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatttctccaccactaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873538_FT00000_P-RF-CB Feature FT:source KF873538_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 059_DR_Wad). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctatacaacatcttgagtcccttttttccgctgt
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacaaaacgatggggttattccctcaacttcatgg
gatatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacacagttttagaaaacttccc
gttaataggcctattgattggaaagtatgtcaacgaattgtaggtctcttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactccgttgtcctttctcggaaat
acacctcctttccatggctgctcggttgtgctgcgaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaaccccgcggacgacccgtctcgcggccgcttggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
atgtcgcatggcgaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctccttgacactg
cctccgctctatatcgggatgccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggcccccttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggtattctatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcactcccccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173322_FT00000_P-RF-CB Feature FT:source KJ173322_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate NH30M(e41)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacacatatcatcaatcttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggccttcc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccgcttctccgcctgttgtaccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagaacttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaaa
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatactatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatactcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagta
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173325_FT00000_P-RF-CB Feature FT:source KJ173325_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate P004-C(012)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcaagggaccatgcaagacctgcacgattcctgctcaaggaacctatatgtttccct
cttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagccattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173326_FT00000_P-RF-CB Feature FT:source KJ173326_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate P004-M(014)). Complete genome. [Hepadnaviridae] (length=3215 residues).
cctcacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctstcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagccattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173349_FT00000_P-RF-CB Feature FT:source KJ173349_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX017C(e226)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaaccaaaagatggggatattcccttaacttcatgg
gatatgttattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaaacttatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgtaccgaccgaccac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagaggactcttggactttcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaatgactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactaytgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaaccctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgagaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtctacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173350_FT00000_P-RF-CB Feature FT:source KJ173350_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate CX017M(e227)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaaccagcacgggaccatgcaaaacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttggggtttgccgccccttttacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctcaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgcccgcagcaggtctggggcaaaactcatcgggactgacaactctgtcgtgctctcccgcaagt
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgttgttccgaccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410520_FT00000_P-RF-CB Feature FT:source KJ410520_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate Occult_HK4869). Complete genome. [Hepadnaviridae] (length=3236 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcacgattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cgtgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gttatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaaacaatgttttcgtaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggccttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcacttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctcggcataatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctccagtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacc
tctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ598675_FT00000_P-RF-CB Feature FT:source KJ598675_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate SHB3B2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtattgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
atatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgtcttacttttggaagagcaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggacctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgtccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KJ803753_FT00000_P-RF-CB Feature FT:source KJ803753_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY515920). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcactaacctcttgtcctcaaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggatttagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgca
ggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagactaaaattaattatgc
ctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatccagagcatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaggccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagctctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803791_FT00000_P-RF-CB Feature FT:source KJ803791_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY824318). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccaccttccaccaaactctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttccagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcatggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccgtgcaagacctgcacgactcctgctcaagggacctctatgtttccct
catgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacaacatcttgagtccctttatgccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattctcttaacttcatgg
gatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttaggaaacttcct
gtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgtgg
atatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaaggcctttc
taagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggactgacaattctgtcgtgctctcccgcaagt
atacatcatttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgcttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgctgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacaggaacctgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactgagtgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgttcgggatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcaatcaggcaagctattctg
tgttgggttgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcatatagaccccaaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcttggcagaagatctcaatcttggcaatctcaatgttagtattccttggacacacaaggtgggaaac
tatacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcctgacattcatttgca
ggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagactaaaattaattatgc
ctgctaggttttatcccaatggtactaaatatttgcccttagataaagggatcaaaccgtattatccagagtatgtagtt
aatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaagagagtccacacgtag
cgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactc
agaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggc
cagggttcacccctccccatgggggactgttggggtggagcccgcaggctcagggcctagaaacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcctgtatctccacctctaagggacactcatcctca
ggctatgcagtggaa
>gnl|hbvnuc|KJ803804_FT00000_P-RF-CB Feature FT:source KJ803804_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY590465). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtataaaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctaaacctttaccccgttgctcggcaacggtcaggcctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccatcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggagggaagtatgtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacatcaccatacagcactacggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaagacccagcatccagggaagcagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcctgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcaaagccaattc
agaaaatccagattgggacctcaacccgcacaaggacaaatggccggacgccaacaaggtgggagtgggagcagtcgggc
cagggttcacccctccccatgggggactgttgggatggagccctcaggctcagggcctactcacaactgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggatactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803822_FT00000_P-RF-CB Feature FT:source KJ803822_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate MY091938). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccgaaa
cagtaaaccttgttccgaatacagcctctcccatctcgtcaatcttctggaggattgggggccctgcaccgaacatggag
aacacaacatcaggattcctaggacccccgatcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaatgcc
acagagtggagacagttgcaggaattctttcaattttctagggggagcacccacgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcgccaacctgttgtcctccaacttgtcctggctatcattggaggtgtctgcggggatttatcata
ttcctgctcatcccggtaacatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccggttgtcatgt
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaagataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaaacgttggggctactcccttaactttatgg
gatatgtgattgggagttggggtactttaccacaggaacacattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctcaacctctaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaccttatcgggactgacaactctgttgtcctctctcagaaat
acacctccttcccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggcgaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctcctcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcgctcaggcaagccattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttagaagatccagcatccagggaattagtagtcag
ttatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttctggaatatttggtgtcttttggagtgtggattcgcactcctcccaactatagaccaccaaatgcccctatctta
tcaatgcttccggaaactgctgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttactatccggaacatgcagtt
aatcattacttcaagactaggcattatttgcatactctgtggaaggctggtattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtattccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679941_FT00000_P-RF-CB Feature FT:source KU679941_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 087_WA_Jab). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccagcaagcgctgctcgatccgagagtaaggggtctgtatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggggaccctgcaacgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgactaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccccacaaaacgaaaagatggggwtattccctcaacttcatgg
gctatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacattgttttaggaaacttcct
gttaataggcctattgattggaaagtgtgccaaaggattgtgggtctattgggctttgctgctccattcacacaatgtgg
atatcctgccttgatgcctttgtatgcatgtatacattctaaacaagctttcaccttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcggggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcctgtttcgctcgcagccggtctggagcgaaccttctcggcaccgacaactcagttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctgtaccgtccccttcttcgtctaccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccatgaacgcccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagmttaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
catccgctctgtatcgggaggctttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattttg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctacccttaccaaatatttgcctttagacaaaggcattaaaccttattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaacyccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcggtctgttggggtggaacccgcaggcccagggcatattgacaacggtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacaacccactcccatctcaccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU679955_FT00000_P-RF-CB Feature FT:source KU679955_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 120_K_Ngk). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagtttcgggg
cagtaaaccctgttccgaatactgtctctcccatctcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaatccacacaaaacgaaaagatggggttattcccttcacttcatgg
gatatataattgggagctgggggaccttaccgcaagatcatattgtccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacagtctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatcagaacctttaccccgttgccaggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttyttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgcctwctgatttctttccgtctattcgcgatctcctcgacaccg
ccgccgctctgtatcgagaggccttagagtctccggaacattgctcagctcaccatacagcactcaggcaagccattctg
tgttggggsgagttaatgaayctggccacctgggtgggaagtaatttggaagaccmagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctgaaacttagacaactattgtggtttcacatttcctgtctaacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgagtggcaaactccttcttttcctgacattcacttacg
ggaggacattatcaatcggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcggaaaggc
atggggacgaatctttckgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaacccgaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggttcaccccaccacacggcgrtcttktggggtggagcccgcaggcccagggcatrttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatcacaccacctctaagagacacgcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU695743_FT00000_P-RF-CB Feature FT:source KU695743_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5073). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtccatcttctcgaggactggggaccctgcaccgaacatggag
aataccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagagatggggctattcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgcccacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaactccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaacattctcggaaccgacaactctgtcatcctctctcggaaat
acacctcatttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtcttgcccaaggtcttgcataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtacttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtccctgtctttaatcctgagtggcaaaccccctcttttcctgacattcatttacg
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttagataaaggcattaaaccttattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagcgagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaagtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963856_FT00000_P-RF-CB Feature FT:source KU963856_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963860_FT00000_P-RF-CB Feature FT:source KU963860_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaagactggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963861_FT00000_P-RF-CB Feature FT:source KU963861_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963868_FT00000_P-RF-CB Feature FT:source KU963868_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 5_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcccgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtattgaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcctcttcttcttctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggagcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963995_FT00000_P-RF-CB Feature FT:source KU963995_FT00000_P-RF-CB of [Viruses] Hepatitis B Virus recombinant form CB (isolate 14_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgca