HBVdb

Dataset for nucleotide sequence PreS1 of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************** ***** ******** *********** ** ***************************** **
ATGGGAGCACCTCTCTCaACGGCGAGAAGGGGCATGGGACAGAAtCTTTCTGTGCCCAATCCTCTGGGATTCTTTCCAGA
                 c     r        y           c  c                             m  
                       a        t           y                                g  

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************************************* *************** ************** ***
CCACCAGTTGGATCCACTATTCAGAGCAAATTCCAGCAGTCCCGATTGGGACTTCAACACAAACAAGGACAATTGGCCAA
                                             c               g              g   
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **************** ***** *** ***** ***** *********** ***** ******************** 
TGGCAAACAAGGTAGGAGTGGGAGGCTTCGGTCCAGGGTTCACACCCCCACACGGTGGCCTTCTGGGGTGGAGCCCTCAG
ca                c     c   t     c     t           t     g                    a
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************ * ******* ****** * ********* ******* ****** *********** ** ********
GCACAGGGCATTCTgACAACCTcGCCACCAGATCCACCTCCTGCTTCCACCAATCGGAGGTCAGGAAGAAAGCCAACCCC
            a a       t      c t         c       a      a           g  a        
                             t                                                  

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **************** ***************** **************** ******************* * ** *
AGTCTCTCCACCTCTAAGGGACACACATCCACAGGCCATGCAGTGGAACTCAACACAGTTCCACCAAGCACTGTTGGATC
 a                a                 y                t                   c a  c 
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** *** *****         ****************************** *******  ********** *******
CGAGAGTAAGGGGtCTGTATtTTCCTGCTGGTGGCTCCAGTTCAGAAACACAGAACCCTGCTCCGACTATTGcCTCTCTC
   a   g     g------c-                              a       tg          t       
       c     -      -                                                           

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** *********************** **** ********** *********************** ********* 
ACATCATCAATCTTCTCGAAGACTGGGGACCCTGcTATGAACATGGAGAACATCACATCAGGACTCCTAGGACCCCTTCT
     g                       t    t          a                       a         c
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** ***** ***** ********** *** *********   *****************************
CGTGTTACAGGCGGTGTGTTTCTTGTTGACAAAAATCCTCACAATACCAcAGAGTCTAGACTCGTGGTGGACTTCTCTCA
           g     t     c          g   k         cag                             
                                      g                                         

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********* ***************************** ************************** ** *** ******
ATTTTCTAGGGGTACCACCCGGGTGTCCTGGCCAAAATTCGCAGTCCCCAATCTCCAATCACTTACCAACCTCCTGTCCT
         a                             y                          a  t   t      
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************* *********************************************** **********
CCAACTTGTCCTGGCTATCGTTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTT
                     c                                               g          
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************************************************************  **************** *
CTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTGTGTCCTCTACTTCCAGGATCtACAACCACCAGCACGGGAC
                                                            at                t 
                                                                              

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******* ************* ********** **************** ** ** ****  ******************
CCTGCAAAACCTGCACCACTCTTGCTCAAGGAACCTCTATGTTTCCCTCCTGCTGCTGTACCAAACCTTCGGACGGAAAT
       g             y          c                t  t  t    ta                  
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********************** *********** ***** *********** ******************** *****
TGCACCTGTATTCCCATCCCATCATCTTGGGCTTTCGGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCTCTTGGCT
                       g           a     t           t                    a     
                                                     c                          

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** ** ***** ************************** *** **** **  * *** ******** ****
CAGTTTACTAGTGCAATTTGTTCAGTGGTGCGTAGGGCTTTCCCCCACTGTCTGGCTTTTAGTTATATGGATGATtTGGT
           c  c     c                          t   t    c  cg c   g        c    
                                                                           g    

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****************** ** ********* ** *********************************************
ATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATACCGCTGTTACCAATTTTTTGTTATCTGTGGGCATCCATT
                  a  a         g  a                                             
                                                                                

   
...
* *
TgA
 a 
 r 
© 1998-2020Legal notice