HBVdb

Dataset for nucleotide sequence PreS1 of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

31 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


JN604202_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB064315_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB059659_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AY090454_PreS1_C-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctctc
AY090457_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
JN604203_PreS1_P-H      atgggagcacctctctccacggcgagaaggggcatgggacagaatctttc
FJ356715_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaacctttc
AB375163_PreS1_P-H      atgggagcacctctctcaacggcragaaggggyatgggacagaayctttc
HM117850_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB059660_PreS1_P-H      atgggagcacctctctccacggcgagaaggggcatgggacagaatctttc
AB353764_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB266536_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
EU498228_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB818694_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB179747_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB275308_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
EF157291_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB205010_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
JN604310_PreS1_P-H      atgggagcacctctctcaacggcaagaaggggtatgggacagaatctttc
HM066946_PreS1_P-H      atgggagcacctctctccacggcgagaaggggcatgggacagaatctttc
HQ285946_PreS1_P-H      atgggagcacctctctccacggcgagaaggggcatgggacagaatctttc
FJ356716_PreS1_C-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaayctttc
HM117851_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AY090460_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaacctttc
AB375160_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB059661_PreS1_P-H      atgggagcacctctctccacggcgagaaggggcatgggacagaatctttc
AB375164_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaacctttc
AB375161_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB375159_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
AB375162_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
KX264501_PreS1_P-H      atgggagcacctctctcaacggcgagaaggggcatgggacagaatctttc
                        ***************** ***** ******** *********** ** **

JN604202_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB064315_PreS1_P-H      tgtgcccaatcctctgggattctttccggaccaccagttggatccactat
AB059659_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AY090454_PreS1_C-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AY090457_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
JN604203_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
FJ356715_PreS1_P-H      tgtgcccaatcctctgggattctttccmgaccaccagttggatccactat
AB375163_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
HM117850_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB059660_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB353764_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB266536_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
EU498228_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB818694_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB179747_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB275308_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
EF157291_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB205010_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
JN604310_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
HM066946_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
HQ285946_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
FJ356716_PreS1_C-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
HM117851_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AY090460_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB375160_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB059661_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB375164_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB375161_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB375159_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
AB375162_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
KX264501_PreS1_P-H      tgtgcccaatcctctgggattctttccagaccaccagttggatccactat
                        *************************** **********************

JN604202_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB064315_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB059659_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AY090454_PreS1_C-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AY090457_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
JN604203_PreS1_P-H      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
FJ356715_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB375163_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
HM117850_PreS1_P-H      tcagagcaaattccagcagtcccgactgggacttcaacacaaacaaggac
AB059660_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacagacaaggac
AB353764_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB266536_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
EU498228_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB818694_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB179747_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB275308_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
EF157291_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB205010_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
JN604310_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
HM066946_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
HQ285946_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
FJ356716_PreS1_C-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
HM117851_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AY090460_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB375160_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB059661_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB375164_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB375161_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB375159_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
AB375162_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
KX264501_PreS1_P-H      tcagagcaaattccagcagtcccgattgggacttcaacacaaacaaggac
                        ************************* *************** ********

JN604202_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB064315_PreS1_P-H      aattggccaacagcaaacaaggtaggagtgggaggcttcggtccagggtt
AB059659_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtcccgggtt
AY090454_PreS1_C-H      aattggccaatggcaaacaaggtaggagtgggaggctttggtccagggtt
AY090457_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggctttggtccagggtt
JN604203_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
FJ356715_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB375163_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
HM117850_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB059660_PreS1_P-H      aattggccaatggcaaacaaggtaggagcgggaggcttcggtccagggtt
AB353764_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB266536_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
EU498228_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB818694_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB179747_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB275308_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
EF157291_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB205010_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
JN604310_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
HM066946_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
HQ285946_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
FJ356716_PreS1_C-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
HM117851_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggagccttcggtccagggtt
AY090460_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB375160_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB059661_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB375164_PreS1_P-H      aattgggcaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB375161_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB375159_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
AB375162_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
KX264501_PreS1_P-H      aattggccaatggcaaacaaggtaggagtgggaggcttcggtccagggtt
                        ****** ***  **************** ***** *** ***** *****

JN604202_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaagcacagggca
AB064315_PreS1_P-H      tacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB059659_PreS1_P-H      cacacccccacacggtgggcttctggggtggagccctcaggcacagggca
AY090454_PreS1_C-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AY090457_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
JN604203_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
FJ356715_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB375163_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
HM117850_PreS1_P-H      cacacccccacatggtggccttctggggtggagccctcaggcacagggca
AB059660_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB353764_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB266536_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
EU498228_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB818694_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB179747_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB275308_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
EF157291_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB205010_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
JN604310_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
HM066946_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
HQ285946_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
FJ356716_PreS1_C-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
HM117851_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaagcacagggca
AY090460_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB375160_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB059661_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB375164_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB375161_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB375159_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
AB375162_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
KX264501_PreS1_P-H      cacacccccacacggtggccttctggggtggagccctcaggcacagggca
                         *********** ***** ******************** **********

JN604202_PreS1_P-H      ttatgacaacctcgccacctgttccacctcctgcttccaccaatcggagg
AB064315_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB059659_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaacaatcggagg
AY090454_PreS1_C-H      ttctgacaacctcgccaccagatccacctcccgcttccaccaatcggagg
AY090457_PreS1_P-H      ttctgacaacctcgccacccgatccacctcccgcttccaccaatcggagg
JN604203_PreS1_P-H      ttctgacaaccttgccaccagatccacctcctgcttccaccaatcgaagg
FJ356715_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB375163_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
HM117850_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB059660_PreS1_P-H      ttctgacaaccttgccaccagatccacctcctgcttccaccaatcggagg
AB353764_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB266536_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
EU498228_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB818694_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB179747_PreS1_P-H      ttctaacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB275308_PreS1_P-H      ttctaacaacctcgccaccagatccacctcctgcttccaccaatcggagg
EF157291_PreS1_P-H      ttctaacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB205010_PreS1_P-H      ttctaacaacctcgccacccgatccacctcctgcttccaccaatcggagg
JN604310_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
HM066946_PreS1_P-H      ttctgacaaccttgccaccagatccacctcctgcttccaccaatcggagg
HQ285946_PreS1_P-H      ttctgacaaccttgccaccagatccacctcctgcttccaccaatcggagg
FJ356716_PreS1_C-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
HM117851_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AY090460_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB375160_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB059661_PreS1_P-H      ttctgacaaccttgccaccagatccacctcctgcttccaccaatcggagg
AB375164_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB375161_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB375159_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
AB375162_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
KX264501_PreS1_P-H      ttctgacaacctcgccaccagatccacctcctgcttccaccaatcggagg
                        ** * ******* ****** * ********* ******* ****** ***

JN604202_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB064315_PreS1_P-H      tcaggaagaaagccaaccccaatctctccacctctaagggacacacatcc
AB059659_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AY090454_PreS1_C-H      tcaggaaggaaaccaaccccagtctctccacctctaagggacacacatcc
AY090457_PreS1_P-H      tcaggaaggaaaccaaccccagtctctccacctctaagggacacacatcc
JN604203_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
FJ356715_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB375163_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
HM117850_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB059660_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagagacacacatcc
AB353764_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB266536_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
EU498228_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB818694_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB179747_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB275308_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
EF157291_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB205010_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
JN604310_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
HM066946_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
HQ285946_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
FJ356716_PreS1_C-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
HM117851_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AY090460_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB375160_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB059661_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB375164_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB375161_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB375159_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
AB375162_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
KX264501_PreS1_P-H      tcaggaagaaagccaaccccagtctctccacctctaagggacacacatcc
                        ******** ** ********* **************** ***********

JN604202_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB064315_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgctggatc
AB059659_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttagatc
AY090454_PreS1_C-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AY090457_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
JN604203_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
FJ356715_PreS1_P-H      acaggcyatgcagtggaactcaatacagttccaccaagcactgttggatc
AB375163_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggacc
HM117850_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB059660_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB353764_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB266536_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
EU498228_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB818694_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB179747_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB275308_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
EF157291_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB205010_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
JN604310_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggacc
HM066946_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
HQ285946_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
FJ356716_PreS1_C-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
HM117851_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AY090460_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB375160_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB059661_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB375164_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB375161_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB375159_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
AB375162_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
KX264501_PreS1_P-H      acaggccatgcagtggaactcaacacagttccaccaagcactgttggatc
                        ****** **************** ******************* * ** *

JN604202_PreS1_P-H      cgaaagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB064315_PreS1_P-H      cgagagtaagggg---------tcctgctggtggctccagttcagaaaca
AB059659_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AY090454_PreS1_C-H      cgagagtcaggggtctgtattttcctgctggtggctccagttcagaaaca
AY090457_PreS1_P-H      cgagagtaaggggtctgtatcttcctgctggtggctccagttcagaaaca
JN604203_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
FJ356715_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB375163_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
HM117850_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB059660_PreS1_P-H      cgagagtaaggggtctgtatcttcctgctggtggctccagttcagaaaca
AB353764_PreS1_P-H      cgagagtaagggggctgtattttcctgctggtggctccagttcagaaaca
AB266536_PreS1_P-H      cgagagtaagggggctgtattttcctgctggtggctccagttcagaaaca
EU498228_PreS1_P-H      cgagagtaagggggctgtattttcctgctggtggctccagttcagaaaca
AB818694_PreS1_P-H      cgagagtaagggggctgtattttcctgctggtggctccagttcagaaaca
AB179747_PreS1_P-H      cgagagtaagggggctgtattttcctgctggtggctccagttcagaaaca
AB275308_PreS1_P-H      cgagagtaagggggctgtattttcctgctggtggctccagttcagaaaca
EF157291_PreS1_P-H      cgagagtaagggggctgtattttcctgctggtggctccagttcagaaaca
AB205010_PreS1_P-H      cgagagtaagggggctgtatcttcctgctggtggctccagttcagaaaca
JN604310_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
HM066946_PreS1_P-H      cgagagtgaggggtctgtattttcctgctggtggctccagttcagaaaca
HQ285946_PreS1_P-H      cgagagtgaggggtctgtattttcctgctggtggctccagttcagaaaca
FJ356716_PreS1_C-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
HM117851_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AY090460_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB375160_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB059661_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB375164_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB375161_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB375159_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
AB375162_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
KX264501_PreS1_P-H      cgagagtaaggggtctgtattttcctgctggtggctccagttcagaaaca
                        *** *** *****         ****************************

JN604202_PreS1_P-H      cagaaccctgctccgactattgtctctctcacatcgtcaatcttctcgaa
AB064315_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB059659_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AY090454_PreS1_C-H      cagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaa
AY090457_PreS1_P-H      cagaaccctgttccgactattgcctctctcacatcatcaatcttctcgaa
JN604203_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
FJ356715_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB375163_PreS1_P-H      cagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaa
HM117850_PreS1_P-H      caaaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB059660_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB353764_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB266536_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
EU498228_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB818694_PreS1_P-H      cagaaccctgcgccgactattgcctctctcacatcatcaatcttctcgaa
AB179747_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB275308_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
EF157291_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB205010_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
JN604310_PreS1_P-H      cagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaa
HM066946_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
HQ285946_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
FJ356716_PreS1_C-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
HM117851_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AY090460_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB375160_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB059661_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB375164_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB375161_PreS1_P-H      cagaaccctgctccgactattgtctctctcacatcatcaatcttctcgaa
AB375159_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
AB375162_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
KX264501_PreS1_P-H      cagaaccctgctccgactattgcctctctcacatcatcaatcttctcgaa
                        ** *******  ********** ************ **************

JN604202_PreS1_P-H      gactggggatcctgctatgaacatgaagaacatcacatcaggactcctag
AB064315_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB059659_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AY090454_PreS1_C-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AY090457_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
JN604203_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
FJ356715_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB375163_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
HM117850_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB059660_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB353764_PreS1_P-H      gactggggaccctgttatgaacatggagaacatcacatcaggactcctag
AB266536_PreS1_P-H      gactggggaccctgttatgaacatggagaacatcacatcaggactcctag
EU498228_PreS1_P-H      gactggggaccctgttatgaacatggagaacatcacatcaggactcctag
AB818694_PreS1_P-H      gactggggaccctgttatgaacatggagaacatcacatcaggactcctag
AB179747_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB275308_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
EF157291_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB205010_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
JN604310_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
HM066946_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
HQ285946_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
FJ356716_PreS1_C-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
HM117851_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AY090460_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctaa
AB375160_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB059661_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB375164_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB375161_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB375159_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
AB375162_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
KX264501_PreS1_P-H      gactggggaccctgctatgaacatggagaacatcacatcaggactcctag
                        ********* **** ********** *********************** 

JN604202_PreS1_P-H      gaccccttctcgtgttacaggcggtgtttttctcgttgacaaaaatcctc
AB064315_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB059659_PreS1_P-H      gaccccttcccgtgttacagggggtgtttttctcgttgacaaaaatcctc
AY090454_PreS1_C-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AY090457_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
JN604203_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcckc
FJ356715_PreS1_P-H      gaccccttctcgtgttacaggcggtgtttttcttgttgacaaaagtcctc
AB375163_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
HM117850_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB059660_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB353764_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB266536_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
EU498228_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB818694_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB179747_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB275308_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
EF157291_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB205010_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
JN604310_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
HM066946_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
HQ285946_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
FJ356716_PreS1_C-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatccgc
HM117851_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AY090460_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB375160_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB059661_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB375164_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB375161_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB375159_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
AB375162_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
KX264501_PreS1_P-H      gaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcctc
                        ********* *********** ***** ***** ********** *** *

JN604202_PreS1_P-H      acaataccccagagtctagactcgtggtggacttctctcaattttctagg
AB064315_PreS1_P-H      acaataccacggagtctagactcgtggtggacttctctcaattttctagg
AB059659_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctaga
AY090454_PreS1_C-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AY090457_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
JN604203_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
FJ356715_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
AB375163_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
HM117850_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AB059660_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AB353764_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
AB266536_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
EU498228_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
AB818694_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
AB179747_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
AB275308_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
EF157291_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
AB205010_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
JN604310_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
HM066946_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
HQ285946_PreS1_P-H      acaataccaaagagtctagactcgtggtggacttctctcaattttctagg
FJ356716_PreS1_C-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
HM117851_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AY090460_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AB375160_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AB059661_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AB375164_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AB375161_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AB375159_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
AB375162_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
KX264501_PreS1_P-H      acaataccacagagtctagactcgtggtggacttctctcaattttctagg
                        ********   ************************************** 

JN604202_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattygcagtccccaatctccaatc
AB064315_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB059659_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AY090454_PreS1_C-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AY090457_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
JN604203_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
FJ356715_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB375163_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
HM117850_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB059660_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB353764_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB266536_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
EU498228_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB818694_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB179747_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB275308_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
EF157291_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB205010_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
JN604310_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
HM066946_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
HQ285946_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
FJ356716_PreS1_C-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
HM117851_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AY090460_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB375160_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB059661_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB375164_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB375161_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB375159_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
AB375162_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
KX264501_PreS1_P-H      ggtaccacccgggtgtcctggccaaaattcgcagtccccaatctccaatc
                        ***************************** ********************

JN604202_PreS1_P-H      acttaccaatctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB064315_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB059659_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AY090454_PreS1_C-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AY090457_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
JN604203_PreS1_P-H      acttacaaacctcttgtcctccaacttgtcctggctatcgttggatgtgt
FJ356715_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB375163_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
HM117850_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB059660_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB353764_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB266536_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
EU498228_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB818694_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB179747_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB275308_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
EF157291_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB205010_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
JN604310_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
HM066946_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
HQ285946_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
FJ356716_PreS1_C-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
HM117851_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AY090460_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB375160_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgtcggatgtgt
AB059661_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB375164_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB375161_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB375159_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
AB375162_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
KX264501_PreS1_P-H      acttaccaacctcctgtcctccaacttgtcctggctatcgttggatgtgt
                        ****** ** *** *************************** ********

JN604202_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB064315_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB059659_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AY090454_PreS1_C-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AY090457_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
JN604203_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
FJ356715_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB375163_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
HM117850_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB059660_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB353764_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB266536_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
EU498228_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB818694_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB179747_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB275308_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
EF157291_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB205010_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
JN604310_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
HM066946_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
HQ285946_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
FJ356716_PreS1_C-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
HM117851_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AY090460_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB375160_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctaggcctcatctt
AB059661_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB375164_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB375161_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB375159_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
AB375162_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
KX264501_PreS1_P-H      ctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatctt
                        *************************************** **********

JN604202_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB064315_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB059659_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AY090454_PreS1_C-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AY090457_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
JN604203_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
FJ356715_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB375163_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
HM117850_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB059660_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB353764_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB266536_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
EU498228_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB818694_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB179747_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB275308_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
EF157291_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB205010_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
JN604310_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
HM066946_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
HQ285946_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
FJ356716_PreS1_C-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
HM117851_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AY090460_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB375160_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB059661_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB375164_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB375161_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB375159_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
AB375162_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
KX264501_PreS1_P-H      cttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctac
                        **************************************************

JN604202_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB064315_PreS1_P-H      ttccaggatcttcaaccaccagcacgggaccctgcaaaacctgcaccact
AB059659_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AY090454_PreS1_C-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AY090457_PreS1_P-H      ttccaggatctacaaccaccagcacgggtccctgcaaaacctgcaccact
JN604203_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
FJ356715_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB375163_PreS1_P-H      ttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccact
HM117850_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB059660_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB353764_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB266536_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
EU498228_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB818694_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB179747_PreS1_P-H      ttccaggatcwacaaccaccagcacgggaccctgcaaaacctgcaccact
AB275308_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
EF157291_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB205010_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
JN604310_PreS1_P-H      ttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccact
HM066946_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaagacctgcaccact
HQ285946_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaagacctgcaccact
FJ356716_PreS1_C-H      ttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccact
HM117851_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AY090460_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB375160_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB059661_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB375164_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB375161_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB375159_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
AB375162_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
KX264501_PreS1_P-H      ttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccact
                        **********  **************** ******** ************

JN604202_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB064315_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB059659_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AY090454_PreS1_C-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AY090457_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
JN604203_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
FJ356715_PreS1_P-H      cttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttc
AB375163_PreS1_P-H      cytgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
HM117850_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB059660_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttc
AB353764_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB266536_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
EU498228_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB818694_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgttgtaccaaaccttc
AB179747_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB275308_PreS1_P-H      cttgctcaaggaccctctatgtttccctcctgctgctgtaccaaaccttc
EF157291_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB205010_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
JN604310_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
HM066946_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
HQ285946_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
FJ356716_PreS1_C-H      cttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttc
HM117851_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtataaaaccttc
AY090460_PreS1_P-H      cttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttc
AB375160_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB059661_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB375164_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB375161_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB375159_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
AB375162_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
KX264501_PreS1_P-H      cttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttc
                        * ********** **************** ** ** ****  ********

JN604202_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttaggaa
AB064315_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB059659_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AY090454_PreS1_C-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AY090457_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
JN604203_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
FJ356715_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB375163_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
HM117850_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB059660_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB353764_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB266536_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
EU498228_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB818694_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB179747_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB275308_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
EF157291_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcgtcttgggctttcggaa
AB205010_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
JN604310_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
HM066946_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
HQ285946_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
FJ356716_PreS1_C-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
HM117851_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AY090460_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB375160_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB059661_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB375164_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB375161_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB375159_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
AB375162_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
KX264501_PreS1_P-H      ggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaa
                        ********************************* *********** ****

JN604202_PreS1_P-H      attacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB064315_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB059659_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AY090454_PreS1_C-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AY090457_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
JN604203_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
FJ356715_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB375163_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
HM117850_PreS1_P-H      aatacctatgggactgggcctcagcccgtttctcatggctcagtttacta
AB059660_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB353764_PreS1_P-H      aatacctatgggattgggcctcagcccgtttctcatggctcagtttacta
AB266536_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
EU498228_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB818694_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB179747_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB275308_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
EF157291_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB205010_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
JN604310_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
HM066946_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
HQ285946_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
FJ356716_PreS1_C-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
HM117851_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AY090460_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB375160_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB059661_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB375164_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB375161_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB375159_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
AB375162_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
KX264501_PreS1_P-H      aatacctatgggagtgggcctcagcccgtttctcttggctcagtttacta
                        * *********** ******************** ***************

JN604202_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccattgtctggccttt
AB064315_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB059659_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AY090454_PreS1_C-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AY090457_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
JN604203_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
FJ356715_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtttggctttt
AB375163_PreS1_P-H      gtgccatttgttcagtggtgcgtagggctttcccccactgtctggctttc
HM117850_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB059660_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB353764_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB266536_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
EU498228_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB818694_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB179747_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB275308_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
EF157291_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB205010_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
JN604310_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
HM066946_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
HQ285946_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
FJ356716_PreS1_C-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
HM117851_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AY090460_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB375160_PreS1_P-H      gcgcaatttgctcagtggtgcgtagggctttcccccactgtctggctttt
AB059661_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB375164_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB375161_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
AB375159_PreS1_P-H      gtgcaatttgctcagtggtgcgtagggctttcccccactgtctggctttt
AB375162_PreS1_P-H      gtgcaatttgctcagtggtgcgtagggctttcccccactgtctggctttt
KX264501_PreS1_P-H      gtgcaatttgttcagtggtgcgtagggctttcccccactgtctggctttt
                        * ** ***** ************************** *** **** ** 

JN604202_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcaacatcttga
AB064315_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcaacatcttga
AB059659_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AY090454_PreS1_C-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AY090457_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
JN604203_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtacagcatcttga
FJ356715_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AB375163_PreS1_P-H      agctatatggatgatgtggtattgggggccaaatctgtgcagcatcttga
HM117850_PreS1_P-H      agttatgtggatgatttggtattgggggccaaatctgtgcagcatcttga
AB059660_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AB353764_PreS1_P-H      ggttatgtggatgatctggtattgggggccaaatctgtgcagcatcttga
AB266536_PreS1_P-H      agttatatggatgatctggtattgggggccaaatctgtgcagcatcttga
EU498228_PreS1_P-H      agttatatggatgatctggtattgggggccaaatctgtgcagcatcttga
AB818694_PreS1_P-H      agttatatggatgatctggtattgggggccaaatctgtgcagcatcttga
AB179747_PreS1_P-H      agttatatggatgatctggtattgggggccaaatctgtgcagcatcttga
AB275308_PreS1_P-H      agttatatggatgatctggtattgggggccaaatctgtgcagcatcttga
EF157291_PreS1_P-H      agttatatggatgatctggtattgggggccaaatctgtgcagcatcttga
AB205010_PreS1_P-H      agttatatggatgatctggtattgggggccaaatctgtgcagcatcttga
JN604310_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
HM066946_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
HQ285946_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
FJ356716_PreS1_C-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
HM117851_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AY090460_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AB375160_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AB059661_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AB375164_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AB375161_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AB375159_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
AB375162_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
KX264501_PreS1_P-H      agttatatggatgatttggtattgggggccaaatctgtgcagcatcttga
                         * *** ******** ********************** ** ********

JN604202_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB064315_PreS1_P-H      gtccatttataccgctgttaccaattttttgttatctgtgggcatccatt
AB059659_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AY090454_PreS1_C-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AY090457_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
JN604203_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
FJ356715_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB375163_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
HM117850_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB059660_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB353764_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB266536_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
EU498228_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB818694_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB179747_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB275308_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
EF157291_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB205010_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
JN604310_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
HM066946_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
HQ285946_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
FJ356716_PreS1_C-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
HM117851_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AY090460_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB375160_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB059661_PreS1_P-H      ggccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB375164_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB375161_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB375159_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
AB375162_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
KX264501_PreS1_P-H      gtccctttataccgctgttaccaattttttgttatctgtgggcatccatt
                        * ** *********************************************

JN604202_PreS1_P-H      taa
AB064315_PreS1_P-H      tga
AB059659_PreS1_P-H      tga
AY090454_PreS1_C-H      taa
AY090457_PreS1_P-H      taa
JN604203_PreS1_P-H      tga
FJ356715_PreS1_P-H      tga
AB375163_PreS1_P-H      taa
HM117850_PreS1_P-H      tga
AB059660_PreS1_P-H      tga
AB353764_PreS1_P-H      tga
AB266536_PreS1_P-H      tga
EU498228_PreS1_P-H      tga
AB818694_PreS1_P-H      tga
AB179747_PreS1_P-H      tga
AB275308_PreS1_P-H      tga
EF157291_PreS1_P-H      tga
AB205010_PreS1_P-H      tga
JN604310_PreS1_P-H      taa
HM066946_PreS1_P-H      tga
HQ285946_PreS1_P-H      tga
FJ356716_PreS1_C-H      tga
HM117851_PreS1_P-H      tga
AY090460_PreS1_P-H      tga
AB375160_PreS1_P-H      tga
AB059661_PreS1_P-H      tga
AB375164_PreS1_P-H      tga
AB375161_PreS1_P-H      tra
AB375159_PreS1_P-H      tga
AB375162_PreS1_P-H      tga
KX264501_PreS1_P-H      tga
                        * *

© 1998-2020Legal notice