HBVdb

Dataset for nucleotide sequence P of genotype H

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************* ** **  **** ***  *  **** ************************** **************
ATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTTgTTAGACAACGAGGCAGGGCCCCTAGAAGAAGAACTCCCTCG
             g  c  ga    t   tg tg    a                          g              
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****************** **** ********* ********* ******* ***** *********** ** *******
CCTCGCAGACGAAGATCTCAATCaCCGCGTCGCAGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATTCCTTGGACTC
                  a    t         c         c       t     a           c  g       
                       g                                                        
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************* ***************** ******  ********* ******** *** ******* *********
ATAAGGTGGGAAACTTTACCGGTCTTTACTCCTCTACTgTACCTGTTTTCAATCCTGACTGGtTAACTCCTTCTTTTCCT
             t                 t      ac         t        t   c       c         
                                                                              
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *******  * ********* ******* ******** ********  ************  ******  *********
GACATTCACTTGCATCAAGATcTGATACAAAAATGTGAACAATTTGTaGGCCCACTCACTAcAAATGAAaGGAGACGATT
a       tc a         t       g        g        gc            ac      gt         
                                                                              
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** * *********** ** *************  ** ***** ** ******************** ** ** ****
GAAAcTaATTATGCCAGCTAGGTTTTATCCCAAAGtTACtAAATAcTTCCCTTTGGATAAAGGTATTAAgCCtTACTATC
    t g           a  a             ca  c     t  t                    a  a  t    
    a                                                                 g       
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** ******** ********** *** * * *** ***** ****************** *****************
CAGAGAATGTGGTTAATCATTACTTtAAAACTAGACAtTATTTACATACTTTGTGGAAGGCAGGAATTCTATATAAGAGA
     c        g          c   g g c   c     g                  a                 
                                 a                                              
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******************************************* ********* ************************ *
GAATCCACACATAGCGCCTCATTTTGTGGGTCACCATATTCCTGGGAACAAGAGCTACAGCATGGGAGCACCTCTCTCaA
                                           k         a                        c 
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ******** *********** ** ***************************** *********************
CGGCGAGAAGGGGCATGGGACAGAAtCTTTCTGTGCCCAATCCTCTGGGATTCTTTCCAGACCACCAGTTGGATCCACTA
    r        y           c  c                             m                     
                         y                                g                     
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************************** *************** ************** ***  **************** 
TTCAGAGCAAATTCCAGCAGTCCCGATTGGGACTTCAACACAAACAAGGACAATTGGCCAATGGCAAACAAGGTAGGAGT
                          c               g              g   ca                c
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** *** ***** ***** *********** ***** ******************** ************** ****
GGGAGGCTTCGGTCCAGGGTTCACACCCCCACACGGTGGCCTTCTGGGGTGGAGCCCTCAGGCACAGGGCATTCTgACAA
     c   t     c     t           t     g                    a              a    
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ****** *********** ******* ****************** ** ********* **************** 
CCTcGCCACCAGATCCACCTCCTGCTTCCACCAATCGGAGGTCAGGAAGAAAGCCAACCCCAGTCTCTCCACCTCTAAGG
   t      c           c       a                  g  a         a                a
                                                                                
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************** **************** ******************* * ** ******** *****      
GACACACATCCACAGGCCATGCAGTGGAACTCAACACAGTTCCACCAAGCACTGTTGGATCCGAGAGTAAGGGGtCTGTA
                 y                t                   c a  c        g     g-----
                                                                    c     -     
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   ****************************** *******  ********** **************************
TtTTCCTGCTGGTGGCTCCAGTTCAGAAACACAGAACCCTGCTCCGACTATTGCCTCTCTCACATCATCAATCTTCTCGA
-c-                              a       tg          t                          
 -                                                                              
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*************** ********************************** ********* *********** ***** *
AGACTGGGGACCCTGcTATGAACATGGAGAACATCACATCAGGACTCCTAGGACCCCTTCTCGTGTTACAGGCGGTGTGT
               t                                  a         c           g     t 
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ********** *** **********  ************************************** *********
TTCTTGTTGACAAAAATCCTCACAATACCAcAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGTACCACC
    c          g   g          ag                                      a         
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************************************************************************
CGGGTGTCCTGGCCAAAATTCGCAGTCCCCAATCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTGTCCTGGCTATC
                                                                                
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *********************************************** *****************************
GTTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGAC
  c                                               g                             
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****************************************  **************** ******** ***********
TATCAAGGTATGTTGCCCGTGTGTCCTCTACTTCCAGGATCtACAACCACCAGCACGGGACCCTGCAAAACCTGCACCAC
                                         at                t        g           
                                                                              
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ********** **************** ** ** ****  *************************************
TCTTGCTCAAGGAACCTCTATGTTTCCCTCcTGCTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCATCC
  y          c                t  t  t    ta                                     
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ***************************** ******************** **************** ** ****
CATCATCTTGGGCTTTCGGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCTCTTGGCTCAGTTTACTAGTGCAATTT
    g                             t                    a                c  c    
                                  c                                             
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ****************************** *******  * *** ******** ***********************
GtTCAGTGGTGCGTAGGGCTTTCCCCCACTGTCTGGCTTTTAGTTATATGGATGATtTGGTATTGGGGGCCAAATCTGTG
 c                              t       cg c   g        c                       
                                                        g                       
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ********* ** ********************************************** *****************
CAGCATCTTGAGTCCCTTTATACCGCTGTTACCAATTTTTTGTTATCTGTGGGCATCCATTTgAACACAGCTAAAACAAA
  a         g  a                                              a                 
                                                              r                 
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ******* *** ** * ***************   ******** ******** *********************** *
AtGGTGGGGTTATtCCtTaCACTTTATGGGTTATAtaATTGGGAGTTGGGGGACcTTGCCTCAGGAACATATTGTGCATA
 a       c   a  c t               ggc        c        a                       a 
 w                                                    s                         
                                                      g                         

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******** * ****** ********** ** *** **** *********** ** ******** ***************
AAATCAAAGATTGCTTTCGCAAACTTCCCGTgAATAGACCCATTGATTGGAAGGTtTGTCAACGcATTGTGGGTCTTTTG
        a g      y          t  t   c    t           a  c        a               
                               r                                                
                               a                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***************** ************** ***************** ******** **  * ***** ********
GGCTTTGCAGCCCCTTTTACTCAATGTGGTTATCCTGCTCTCATGCCCTTGTATGCCTGTATTACcGCTAAgCAGGCTTT
                 c              c                 a        c  cr t     a        
                                                                       c        
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
******************************  ** ******** *** ************************ ** ****
TGTTTTCTCGCCAACTTACAAGGCCTTTCTCTGTAAACAATACaTGAACCTTTACCCCGTTGCTCGGCAACGgCCAGGCC
                              gc  c        c   c                        a  g    
                                                                              
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************************************** *************** ******* ******* *
TTTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCTTGGCGATTGGCCATCAGCGCATGCGCGGAACCTTTGTG
                                              a               c       c       a 
                                                                                
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*********** *********** ******** ** ** *************** ************** ******* **
GCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCaGCtTGTTTCGCTCGCAGCaGGTCTGGAGCGGACaTTATCGGCAC
           c           a        c  c  c               c              g       a  
                                                                     r          
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ******** ******** ****************************** * ** *************************
TGACAACTCcGTTGTCCTTTCTCGGAAGTACACCTCCTTCCCATGGCTGCTaGGcTGTGCTGCCAACTGGATCCTGCGCG
c        t        g                              a c  t                         
                                                      a                         
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************* **************** ************************ *****  ********* ****** 
GGACGTCCTTTGTCTACGTCCCGTCGGCGCTGAATCCTGCGGACGACCCCTCTCGTGGTCGCTTGGGGCTCTgCCGCCCt
             t                a                        g     tc         a      c
                                                                                
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***********  **********  **** ** ************************************* ***** ***
CTTCTCCGCCTgcCGTTCCGGCCGACGACGGGTCGCACCTCTCTTTACGCGGACTCCCCGCCTGTGCCTTCTCATCTGCC
           tt          at    a  g                                     t     a   
                                                                              
                                                                                

      2490      2500      2510      2520      2530  
....:....|....:....|....:....|....:....|....:....|..
** ************** **************** ********** ******
GGCCCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAGACCACCGTGA
  a              g                a          m      
                                                    
                                                    
© 1998-2020Legal notice