Dataset for nucleotide sequence P of genotype H

[Download (right click)] [Edit] [Sequences] [Repertoires]

28 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

AY090454_P_C-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AY090457_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB059660_P_P-H      atgcccctatcctgtcaacaattccggagacttgtgttattagacaacgaggcagggccc
AB059661_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
HM066946_P_P-H      atgcccctatcctatcaacacttccggagactactgttattagacaacgaggcagggccc
MT622523_P_P-H      atgcccctatcctatcaacacttccggagactactgttattagaccacgaggcagggccc
AB064315_P_P-H      atgcccctatcctatcaacgcttcctgagtgtactgttattagacaacgaggcagggccc
AB059659_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB375163_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
HM117850_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
FJ356715_P_P-H      atgcccctatcctatcaacgcttccggagactactgttgttagacaacgaggcagggccc
AB375161_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB205010_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB353764_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB818694_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB266536_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
EU498228_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB179747_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
EF157291_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB275308_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AY090460_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
HM117851_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
FJ356716_P_C-H      atgcccctatcctatccacacttccggagactactgttgttagacaacgaggcagggccc
AB375164_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
KX264501_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB375159_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB375162_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
AB375160_P_P-H      atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcagggccc
                    ************* ** **  **** ***  *  **** ****** **************

AY090454_P_C-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AY090457_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgccgaagat
AB059660_P_P-H      ctagaggaagaactccctcgcctcgcagacgaagatctaaatcaccgcgtcgcagaagat
AB059661_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
HM066946_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
MT622523_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AB064315_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AB059659_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcagaagat
AB375163_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
HM117850_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
FJ356715_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AB375161_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AB205010_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagat
AB353764_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagat
AB818694_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagat
AB266536_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagat
EU498228_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagat
AB179747_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagat
EF157291_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagat
AB275308_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatctccgcgtcgcagaagat
AY090460_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
HM117851_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
FJ356716_P_C-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AB375164_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
KX264501_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AB375159_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AB375162_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
AB375160_P_P-H      ctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcagaagat
                    ***** ******************************** **** ********* ******

AY090454_P_C-H      ctcaatctccagcttcccaatgttagtatcccttggactcataaggtgggaaactttacc
AY090457_P_P-H      ctcaatctccagcttcccaatgttagtatcccttggactcataaggtgggaaactttacc
AB059660_P_P-H      ctccatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB059661_P_P-H      ctcaatctccagcttcccaatgttagtattccgtggactcataaggtgggaaactttacc
HM066946_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
MT622523_P_P-H      ctcaatctccatcttcccagtgttagtattccttggactcataaggtgggaaactttacc
AB064315_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB059659_P_P-H      ctcaatctccatcttccaaatgttagtattccttggactcataaggtgggaaactttacc
AB375163_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
HM117850_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaattttacc
FJ356715_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB375161_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB205010_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB353764_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB818694_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB266536_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
EU498228_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB179747_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
EF157291_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB275308_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AY090460_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
HM117851_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
FJ356716_P_C-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB375164_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
KX264501_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB375159_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB375162_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
AB375160_P_P-H      ctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaactttacc
                    *** ******* ***** * ********* ** ******************** ******

AY090454_P_C-H      ggtctttactcctctactgtacctgttttcaatcctgattggttaactccttcttttcct
AY090457_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgattggttaactccttcttttcct
AB059660_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
AB059661_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
HM066946_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
MT622523_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
AB064315_P_P-H      ggtctttactcttctactgtacctgttttcaatcctgactggttaactccttcttttcct
AB059659_P_P-H      ggtctttactcctctactgcacctgttttcaatcctgactggttaactccttcttttcct
AB375163_P_P-H      ggtctttactcctctactrtacctgttttcaatcctgactggttaactccttcttttcct
HM117850_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
FJ356715_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggctaactccttcttttcct
AB375161_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
AB205010_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
AB353764_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
AB818694_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
AB266536_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
EU498228_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
AB179747_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
EF157291_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
AB275308_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
AY090460_P_P-H      ggtctttactcctctactatacctgtttttaatcctgactggctaactccctcttttcct
HM117851_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
FJ356716_P_C-H      ggtctttactcctctactatacctgttttcaatcctgactggctaactccttcttttcct
AB375164_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
KX264501_P_P-H      ggtctttactcctctactatacctgttttcaatcctgactggttaactccttcttttcct
AB375159_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
AB375162_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
AB375160_P_P-H      ggtctttactcctctactgtacctgttttcaatcctgactggttaactccttcttttcct
                    *********** ******  ********* ******** *** ******* *********

AY090454_P_C-H      gacattcacctacatcaagatttgatacaaaaatgtgagcaatttgtgcgcccactcact
AY090457_P_P-H      gacattcacctacatcaagatttgatacaaaaatgtgaacaatttgtaggcccactcact
AB059660_P_P-H      gacattcacttgcatcaagatttgatacaaaaatgtgaacaatttgtgggcccactcact
AB059661_P_P-H      gacattcatttgcatcaagatttgatacaaaaatgtgaacaatttgtgggcccactcact
HM066946_P_P-H      gacattcatttgcatcaagatttgatacaaaaatgtgaacaatttgtgggcccactcact
MT622523_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB064315_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB059659_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB375163_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
HM117850_P_P-H      aacattcacttgcatcaagatttgatacagaaatgtgagcaatttgtaggcccactcact
FJ356715_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB375161_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB205010_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB353764_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB818694_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB266536_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
EU498228_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB179747_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
EF157291_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB275308_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AY090460_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
HM117851_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
FJ356716_P_C-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB375164_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
KX264501_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB375159_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB375162_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
AB375160_P_P-H      gacattcacttgcatcaagatctgatacaaaaatgtgaacaatttgtaggcccactcact
                     *******  * ********* ******* ******** ********  ***********

AY090454_P_C-H      aaaaatgaagtgagacgattgaaattaattatgccagcaaggttttatcccaaagctact
AY090457_P_P-H      aaaaatgaagtgagacgattgaaattaattatgccagcaagattttatcccaaagttact
AB059660_P_P-H      acaaatgaaaggagacgattgaaaatgattatgccagctaggttttatcccaaagctacc
AB059661_P_P-H      aaaaatgaaaggagacgattgaaactgattatgccagctaggttttatcccaaagtaacc
HM066946_P_P-H      aaaaatgaaaggagacgattgaaactgattatgccagctaggttttatcccaaagttacc
MT622523_P_P-H      acaaatgaaaggagaagattgaaactaattatgccagctaggttttatcccaaagttact
AB064315_P_P-H      aaaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB059659_P_P-H      acaaatgaaaggagacgattgaaattaattatgccagctaggttttatcccaaagttact
AB375163_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
HM117850_P_P-H      aaaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
FJ356715_P_P-H      acaaatgaacggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB375161_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB205010_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB353764_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB818694_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB266536_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
EU498228_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB179747_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
EF157291_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB275308_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AY090460_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
HM117851_P_P-H      aaaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaaggtact
FJ356716_P_C-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB375164_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
KX264501_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB375159_P_P-H      accaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB375162_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
AB375160_P_P-H      acaaatgaaaggagacgattgaaactaattatgccagctaggttttatcccaaagttact
                    *  ******  **** ******** * *********** ** *************  ** 

AY090454_P_C-H      aaatacttccctttggataaaggtattaaaccatattatccagagaatgtggttaatcat
AY090457_P_P-H      aaatacttccctttggataaaggtattaaaccatattatccagagcatgtggttaatcat
AB059660_P_P-H      aaatatttccctttggataaaggtattaaaccttactatccagagaatgtggttaatcat
AB059661_P_P-H      aaatatttccctttggataaaggtattaaaccttactatccagagaatgtggttaatcat
HM066946_P_P-H      aaatatttccctttggataaaggtattaaaccttactatccagagaatgtggttaatcat
MT622523_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB064315_P_P-H      aaatactttcctttggataaaggtattaagccttactatccagagcatgtggttaatcat
AB059659_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttgatcat
AB375163_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
HM117850_P_P-H      aaatacttccctttggataaaggtattaagccgtactatccagagaatgtggttaatcat
FJ356715_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB375161_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB205010_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB353764_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB818694_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB266536_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
EU498228_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB179747_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
EF157291_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB275308_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AY090460_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
HM117851_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
FJ356716_P_C-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB375164_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
KX264501_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB375159_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB375162_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
AB375160_P_P-H      aaatacttccctttggataaaggtattaagccttactatccagagaatgtggttaatcat
                    ***** ** ******************** ** ** ********* ******** *****

AY090454_P_C-H      tacttcaaaactacacactatttacatactttgtggaaggcaagaattctatataagaga
AY090457_P_P-H      tacttcaaaactagacactatttacatactttgtggaaggcaggaattctatataagaga
AB059660_P_P-H      tacttcaaaactagacactatttacatactttgtggaaggcaggaattctatataagaga
AB059661_P_P-H      tactttaaaactagacactatttacatactttgtggaaggcaggaattctatataagaga
HM066946_P_P-H      tactttaaaactagacactatttacatactttgtggaaggcaggaattctatataagaga
MT622523_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaatcctatataagaga
AB064315_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB059659_P_P-H      tactttaaaacgagacattatttgcatactttgtggaaggcaggaattctatataagaga
AB375163_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
HM117850_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
FJ356715_P_P-H      tactttaaagctagacattatttacatactttgtggaaggcaggaattctatataagaga
AB375161_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB205010_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB353764_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB818694_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB266536_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
EU498228_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB179747_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
EF157291_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB275308_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AY090460_P_P-H      tacttcaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
HM117851_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
FJ356716_P_C-H      tactttaaaactaaacattatttacatactttgtggaaggcaggaattctatataagaga
AB375164_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
KX264501_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB375159_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB375162_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
AB375160_P_P-H      tactttaaaactagacattatttacatactttgtggaaggcaggaattctatataagaga
                    ***** *** * * *** ***** ****************** **** ************

AY090454_P_C-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagaactacag
AY090457_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB059660_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB059661_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
HM066946_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
MT622523_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB064315_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB059659_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB375163_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctkggaacaagagctacag
HM117850_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
FJ356715_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB375161_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB205010_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB353764_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB818694_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB266536_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
EU498228_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB179747_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
EF157291_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB275308_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AY090460_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
HM117851_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
FJ356716_P_C-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB375164_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
KX264501_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB375159_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB375162_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
AB375160_P_P-H      gaatccacacatagcgcctcattttgtgggtcaccatattcctgggaacaagagctacag
                    ******************************************* ********* ******

AY090454_P_C-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctctctgtgcccaa
AY090457_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB059660_P_P-H      catgggagcacctctctccacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB059661_P_P-H      catgggagcacctctctccacggcgagaaggggcatgggacagaatctttctgtgcccaa
HM066946_P_P-H      catgggagcacctctctccacggcgagaaggggcatgggacagaatctttctgtgcccaa
MT622523_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB064315_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB059659_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB375163_P_P-H      catgggagcacctctctcaacggcragaaggggyatgggacagaayctttctgtgcccaa
HM117850_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
FJ356715_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaacctttctgtgcccaa
AB375161_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB205010_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB353764_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB818694_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB266536_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
EU498228_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB179747_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
EF157291_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB275308_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AY090460_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaacctttctgtgcccaa
HM117851_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
FJ356716_P_C-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaayctttctgtgcccaa
AB375164_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaacctttctgtgcccaa
KX264501_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB375159_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB375162_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
AB375160_P_P-H      catgggagcacctctctcaacggcgagaaggggcatgggacagaatctttctgtgcccaa
                    ****************** ***** ******** *********** ** ***********

AY090454_P_C-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AY090457_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB059660_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB059661_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
HM066946_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
MT622523_P_P-H      tcctctgggattctttccagaccaccagttggatvcactattcagagcaaattccagcag
AB064315_P_P-H      tcctctgggattctttccggaccaccagttggatccactattcagagcaaattccagcag
AB059659_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB375163_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
HM117850_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
FJ356715_P_P-H      tcctctgggattctttccmgaccaccagttggatccactattcagagcaaattccagcag
AB375161_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB205010_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB353764_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB818694_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB266536_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
EU498228_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB179747_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
EF157291_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB275308_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AY090460_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
HM117851_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
FJ356716_P_C-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB375164_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
KX264501_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB375159_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB375162_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
AB375160_P_P-H      tcctctgggattctttccagaccaccagttggatccactattcagagcaaattccagcag
                    ****************** *************** *************************

AY090454_P_C-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AY090457_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB059660_P_P-H      tcccgattgggacttcaacacagacaaggacaattggccaatggcaaacaaggtaggagc
AB059661_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
HM066946_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
MT622523_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB064315_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaacagcaaacaaggtaggagt
AB059659_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB375163_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
HM117850_P_P-H      tcccgactgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
FJ356715_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB375161_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB205010_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB353764_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB818694_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB266536_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
EU498228_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB179747_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
EF157291_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB275308_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AY090460_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
HM117851_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
FJ356716_P_C-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB375164_P_P-H      tcccgattgggacttcaacacaaacaaggacaattgggcaatggcaaacaaggtaggagt
KX264501_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB375159_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB375162_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
AB375160_P_P-H      tcccgattgggacttcaacacaaacaaggacaattggccaatggcaaacaaggtaggagt
                    ****** *************** ************** ***  **************** 

AY090454_P_C-H      gggaggctttggtccagggttcacacccccacacggtggccttctggggtggagccctca
AY090457_P_P-H      gggaggctttggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB059660_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB059661_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
HM066946_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
MT622523_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB064315_P_P-H      gggaggcttcggtccagggtttacacccccacacggtggccttctggggtggagccctca
AB059659_P_P-H      gggaggcttcggtcccgggttcacacccccacacggtgggcttctggggtggagccctca
AB375163_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
HM117850_P_P-H      gggaggcttcggtccagggttcacacccccacatggtggccttctggggtggagccctca
FJ356715_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB375161_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB205010_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB353764_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB818694_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB266536_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
EU498228_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB179747_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
EF157291_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB275308_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AY090460_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
HM117851_P_P-H      gggagccttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
FJ356716_P_C-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB375164_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
KX264501_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB375159_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB375162_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
AB375160_P_P-H      gggaggcttcggtccagggttcacacccccacacggtggccttctggggtggagccctca
                    ***** *** ***** ***** *********** ***** ********************

AY090454_P_C-H      ggcacagggcattctgacaacctcgccaccagatccacctcccgcttccaccaatcggag
AY090457_P_P-H      ggcacagggcattctgacaacctcgccacccgatccacctcccgcttccaccaatcggag
AB059660_P_P-H      ggcacagggcattctgacaaccttgccaccagatccacctcctgcttccaccaatcggag
AB059661_P_P-H      ggcacagggcattctgacaaccttgccaccagatccacctcctgcttccaccaatcggag
HM066946_P_P-H      ggcacagggcattctgacaaccttgccaccagatccacctcctgcttccaccaatcggag
MT622523_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccactcggag
AB064315_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB059659_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaacaatcggag
AB375163_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
HM117850_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
FJ356715_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB375161_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB205010_P_P-H      ggcacagggcattctaacaacctcgccacccgatccacctcctgcttccaccaatcggag
AB353764_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB818694_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB266536_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
EU498228_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB179747_P_P-H      ggcacagggcattctaacaacctcgccaccagatccacctcctgcttccaccaatcggag
EF157291_P_P-H      ggcacagggcattctaacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB275308_P_P-H      ggcacagggcattctaacaacctcgccaccagatccacctcctgcttccaccaatcggag
AY090460_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
HM117851_P_P-H      agcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
FJ356716_P_C-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB375164_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
KX264501_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB375159_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB375162_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
AB375160_P_P-H      ggcacagggcattctgacaacctcgccaccagatccacctcctgcttccaccaatcggag
                     ************** ******* ****** *********** ******* ** ******

AY090454_P_C-H      gtcaggaaggaaaccaaccccagtctctccacctctaagggacacacatccacaggccat
AY090457_P_P-H      gtcaggaaggaaaccaaccccagtctctccacctctaagggacacacatccacaggccat
AB059660_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagagacacacatccacaggccat
AB059661_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
HM066946_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
MT622523_P_P-H      gtcaggaagacagccaaccccagtctcttcacctctaaggcacacacatccacannnnnn
AB064315_P_P-H      gtcaggaagaaagccaaccccaatctctccacctctaagggacacacatccacaggccat
AB059659_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB375163_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
HM117850_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
FJ356715_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggcyat
AB375161_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB205010_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB353764_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB818694_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB266536_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
EU498228_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB179747_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
EF157291_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB275308_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AY090460_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
HM117851_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
FJ356716_P_C-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB375164_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
KX264501_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB375159_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB375162_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
AB375160_P_P-H      gtcaggaagaaagccaaccccagtctctccacctctaagggacacacatccacaggccat
                    *********  * ********* ***** **********  *************      

AY090454_P_C-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtcaggggtctgta
AY090457_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
AB059660_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
AB059661_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
HM066946_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtgaggggtctgta
MT622523_P_P-H      nnnnnnnnnnnnnctaaggcacacacatccacagttggattcgagagtaaggggtctgtg
AB064315_P_P-H      gcagtggaactcaacacagttccaccaagcactgctggatccgagagtaagggg------
AB059659_P_P-H      gcagtggaactcaacacagttccaccaagcactgttagatccgagagtaaggggtctgta
AB375163_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggacccgagagtaaggggtctgta
HM117850_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
FJ356715_P_P-H      gcagtggaactcaatacagttccaccaagcactgttggatccgagagtaaggggtctgta
AB375161_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
AB205010_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgta
AB353764_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgta
AB818694_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgta
AB266536_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgta
EU498228_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgta
AB179747_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgta
EF157291_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgta
AB275308_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaagggggctgta
AY090460_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
HM117851_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
FJ356716_P_C-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
AB375164_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
KX264501_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
AB375159_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
AB375162_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
AB375160_P_P-H      gcagtggaactcaacacagttccaccaagcactgttggatccgagagtaaggggtctgta
                                   *  *  *   **  *** * * **  ******* *****      

AY090454_P_C-H      ttttcctgctggtggctccagttcagaaacacagaaccctgttccgactattgcctctct
AY090457_P_P-H      tcttcctgctggtggctccagttcagaaacacagaaccctgttccgactattgcctctct
AB059660_P_P-H      tcttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB059661_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
HM066946_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
MT622523_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB064315_P_P-H      ---tcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB059659_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB375163_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgtctctct
HM117850_P_P-H      ttttcctgctggtggctccagttcagaaacacaaaaccctgctccgactattgcctctct
FJ356715_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB375161_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgtctctct
AB205010_P_P-H      tcttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB353764_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB818694_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgcgccgactattgcctctct
AB266536_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
EU498228_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB179747_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
EF157291_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB275308_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AY090460_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
HM117851_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
FJ356716_P_C-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB375164_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
KX264501_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB375159_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB375162_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
AB375160_P_P-H      ttttcctgctggtggctccagttcagaaacacagaaccctgctccgactattgcctctct
                       ****************************** *******  ********** ******

AY090454_P_C-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AY090457_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB059660_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB059661_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
HM066946_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
MT622523_P_P-H      cacatcgtcaaccttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB064315_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB059659_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB375163_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
HM117850_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
FJ356715_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB375161_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB205010_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB353764_P_P-H      cacatcatcaatcttctcgaagactggggaccctgttatgaacatggagaacatcacatc
AB818694_P_P-H      cacatcatcaatcttctcgaagactggggaccctgttatgaacatggagaacatcacatc
AB266536_P_P-H      cacatcatcaatcttctcgaagactggggaccctgttatgaacatggagaacatcacatc
EU498228_P_P-H      cacatcatcaatcttctcgaagactggggaccctgttatgaacatggagaacatcacatc
AB179747_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
EF157291_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB275308_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AY090460_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
HM117851_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
FJ356716_P_C-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB375164_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
KX264501_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB375159_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB375162_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
AB375160_P_P-H      cacatcatcaatcttctcgaagactggggaccctgctatgaacatggagaacatcacatc
                    ****** **** *********************** ************************

AY090454_P_C-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AY090457_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB059660_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB059661_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
HM066946_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
MT622523_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB064315_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB059659_P_P-H      aggactcctaggaccccttcccgtgttacagggggtgtttttctcgttgacaaaaatcct
AB375163_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
HM117850_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
FJ356715_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaaaagtcct
AB375161_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB205010_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB353764_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB818694_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB266536_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
EU498228_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB179747_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
EF157291_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB275308_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AY090460_P_P-H      aggactcctaagaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
HM117851_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
FJ356716_P_C-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatccg
AB375164_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
KX264501_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB375159_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB375162_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
AB375160_P_P-H      aggactcctaggaccccttctcgtgttacaggcggtgtgtttcttgttgacaaaaatcct
                    ********** ********* *********** ***** ***** ********** *** 

AY090454_P_C-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AY090457_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB059660_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB059661_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
HM066946_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
MT622523_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB064315_P_P-H      cacaataccacggagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB059659_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctagaggtaccacc
AB375163_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
HM117850_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
FJ356715_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB375161_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB205010_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB353764_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB818694_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB266536_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
EU498228_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB179747_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
EF157291_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB275308_P_P-H      cacaataccaaagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AY090460_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
HM117851_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
FJ356716_P_C-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB375164_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
KX264501_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB375159_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB375162_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
AB375160_P_P-H      cacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaccacc
                    **********  ************************************** *********

AY090454_P_C-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AY090457_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB059660_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB059661_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
HM066946_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
MT622523_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB064315_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB059659_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB375163_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
HM117850_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
FJ356715_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB375161_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB205010_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB353764_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB818694_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB266536_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
EU498228_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB179747_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
EF157291_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB275308_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AY090460_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
HM117851_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
FJ356716_P_C-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB375164_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
KX264501_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB375159_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB375162_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc
AB375160_P_P-H      cgggtgtcctggccaaaattcgcagtccccaatctccaatcacttaccaacctcctgtcc

AY090454_P_C-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AY090457_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB059660_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB059661_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
HM066946_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
MT622523_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB064315_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB059659_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB375163_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
HM117850_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
FJ356715_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB375161_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB205010_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB353764_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB818694_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB266536_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
EU498228_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB179747_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
EF157291_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB275308_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AY090460_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
HM117851_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
FJ356716_P_C-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB375164_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
KX264501_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB375159_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB375162_P_P-H      tccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcatcttcctcttcat
AB375160_P_P-H      tccaacttgtcctggctatcgtcggatgtgtctgcggcgttttatcatcttcctcttcat
                    ********************** *************************************

AY090454_P_C-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AY090457_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB059660_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB059661_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
HM066946_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
MT622523_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB064315_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB059659_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB375163_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
HM117850_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
FJ356715_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB375161_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB205010_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB353764_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB818694_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB266536_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
EU498228_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB179747_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
EF157291_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB275308_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AY090460_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
HM117851_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
FJ356716_P_C-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB375164_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
KX264501_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB375159_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB375162_P_P-H      cctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
AB375160_P_P-H      cctgctgctaggcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgt
                    ********** *************************************************

AY090454_P_C-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AY090457_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggtccctgcaaaacctgcaccac
AB059660_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB059661_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
HM066946_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaagacctgcaccac
MT622523_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB064315_P_P-H      gtgtcctctacttccaggatcttcaaccaccagcacgggaccctgcaaaacctgcaccac
AB059659_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB375163_P_P-H      gtgtcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccac
HM117850_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
FJ356715_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB375161_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB205010_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB353764_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB818694_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB266536_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
EU498228_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB179747_P_P-H      gtgtcctctacttccaggatcwacaaccaccagcacgggaccctgcaaaacctgcaccac
EF157291_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB275308_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AY090460_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
HM117851_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
FJ356716_P_C-H      gtgtcctctacttccaggatcaacaaccaccagcacgggaccctgcaaaacctgcaccac
AB375164_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
KX264501_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB375159_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB375162_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
AB375160_P_P-H      gtgtcctctacttccaggatctacaaccaccagcacgggaccctgcaaaacctgcaccac
                    *********************  **************** ******** ***********

AY090454_P_C-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AY090457_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB059660_P_P-H      tcttgctcaaggaacctctatgtttccctcctgttgctgtaccaaaccttcggacggaaa
AB059661_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
HM066946_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
MT622523_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB064315_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB059659_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB375163_P_P-H      tcytgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
HM117850_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
FJ356715_P_P-H      tcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacggaaa
AB375161_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB205010_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB353764_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB818694_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgttgtaccaaaccttcggacggaaa
AB266536_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
EU498228_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB179747_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
EF157291_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB275308_P_P-H      tcttgctcaaggaccctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AY090460_P_P-H      tcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacggaaa
HM117851_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtataaaaccttcggacggaaa
FJ356716_P_C-H      tcttgctcaaggaacctctatgtttccctcttgctgctgtaccaaaccttcggacggaaa
AB375164_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
KX264501_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB375159_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB375162_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
AB375160_P_P-H      tcttgctcaaggaacctctatgtttccctcctgctgctgtaccaaaccttcggacggaaa
                    ** ********** **************** ** ** ****  *****************

AY090454_P_C-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AY090457_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB059660_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB059661_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
HM066946_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
MT622523_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB064315_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB059659_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB375163_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
HM117850_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggactgggc
FJ356715_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB375161_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB205010_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB353764_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggattgggc
AB818694_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB266536_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
EU498228_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB179747_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
EF157291_P_P-H      ttgcacctgtattcccatcccatcgtcttgggctttcggaaaatacctatgggagtgggc
AB275308_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AY090460_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
HM117851_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
FJ356716_P_C-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB375164_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
KX264501_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB375159_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB375162_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
AB375160_P_P-H      ttgcacctgtattcccatcccatcatcttgggctttcggaaaatacctatgggagtgggc
                    ************************ ***************************** *****

AY090454_P_C-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AY090457_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB059660_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB059661_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
HM066946_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
MT622523_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggct
AB064315_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB059659_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB375163_P_P-H      ctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtagggct
HM117850_P_P-H      ctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggct
FJ356715_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB375161_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB205010_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB353764_P_P-H      ctcagcccgtttctcatggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB818694_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB266536_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
EU498228_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB179747_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
EF157291_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB275308_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AY090460_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
HM117851_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
FJ356716_P_C-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB375164_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
KX264501_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgttcagtggtgcgtagggct
AB375159_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggct
AB375162_P_P-H      ctcagcccgtttctcttggctcagtttactagtgcaatttgctcagtggtgcgtagggct
AB375160_P_P-H      ctcagcccgtttctcttggctcagtttactagcgcaatttgctcagtggtgcgtagggct
                    *************** **************** ** ***** ******************

AY090454_P_C-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AY090457_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB059660_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB059661_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
HM066946_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
MT622523_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgta
AB064315_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB059659_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB375163_P_P-H      ttcccccactgtctggctttcagctatatggatgatgtggtattgggggccaaatctgtg
HM117850_P_P-H      ttcccccactgtctggcttttagttatgtggatgatttggtattgggggccaaatctgtg
FJ356715_P_P-H      ttcccccactgtttggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB375161_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB205010_P_P-H      ttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtg
AB353764_P_P-H      ttcccccactgtctggcttttggttatgtggatgatctggtattgggggccaaatctgtg
AB818694_P_P-H      ttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtg
AB266536_P_P-H      ttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtg
EU498228_P_P-H      ttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtg
AB179747_P_P-H      ttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtg
EF157291_P_P-H      ttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtg
AB275308_P_P-H      ttcccccactgtctggcttttagttatatggatgatctggtattgggggccaaatctgtg
AY090460_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
HM117851_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
FJ356716_P_C-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB375164_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
KX264501_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB375159_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB375162_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
AB375160_P_P-H      ttcccccactgtctggcttttagttatatggatgatttggtattgggggccaaatctgtg
                    ************ *******  * *** ******** ********************** 

AY090454_P_C-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AY090457_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB059660_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB059661_P_P-H      cagcatcttgaggccctttataccgctgttaccaattttttgttatctgtgggcatccat
HM066946_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
MT622523_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB064315_P_P-H      caacatcttgagtccatttataccgctgttaccaattttttgttatctgtgggcatccat
AB059659_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB375163_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
HM117850_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
FJ356715_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB375161_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB205010_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB353764_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB818694_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB266536_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
EU498228_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB179747_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
EF157291_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB275308_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AY090460_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
HM117851_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
FJ356716_P_C-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB375164_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
KX264501_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB375159_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB375162_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
AB375160_P_P-H      cagcatcttgagtccctttataccgctgttaccaattttttgttatctgtgggcatccat
                    ** ********* ** ********************************************

AY090454_P_C-H      ttaaacacagctaaaacaaaatggtggggttattccttacactttatgggttatatcatt
AY090457_P_P-H      ttaaacacagctaaaacaaaatggtggggttattccttacactttatgggttatatcatt
AB059660_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatatcatt
AB059661_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatatcatt
HM066946_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatatcatt
MT622523_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatataatt
AB064315_P_P-H      ttgaacacagctaaaacaaaatggtggggttataccttacactttatgggttatagaatt
AB059659_P_P-H      ttgaacacagctaaaacaaaaaggtggggttattccttacactttatgggttatataatt
AB375163_P_P-H      ttaaacacagctaaaacaaaatggtggggttattccttacactttatgggttatatcatt
HM117850_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatataatt
FJ356715_P_P-H      ttgaacacagctaaaacaaaawggtggggttataccttacactttatgggttatagaatt
AB375161_P_P-H      ttraacacagctaaaacaaaatggtggggttattccttacactttatgggttatatcatt
AB205010_P_P-H      ttgaacacagctaaaacaaaatggtggggttatacccttcactttatgggttatagaatt
AB353764_P_P-H      ttgaacacagctaaaacaaaatggtggggttattcccttcactttatgggttatataatt
AB818694_P_P-H      ttgaacacagctaaaacaaaatggtggggttattcccttcactttatgggttatataatt
AB266536_P_P-H      ttgaacacagctaaaacaaaatggtggggctattcccttcactttatgggttatataatt
EU498228_P_P-H      ttgaacacagctaaaacaaaatggtggggttattcccttcactttatgggttatataatt
AB179747_P_P-H      ttgaacacagctaaaacaaaatggtggggttattcccttcactttatgggttatataatt
EF157291_P_P-H      ttgaacacagctaaaacaaaatggtggggttattcccttcactttatgggttatataatt
AB275308_P_P-H      ttgaacacagctaaaacaaaatggtggggttattcccttcactttatgggttatataatt
AY090460_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatataatt
HM117851_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatgtaatt
FJ356716_P_C-H      ttgaacacagctaaaacaaaaaggtggggttattccttacactttatgggttatataatt
AB375164_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatataatt
KX264501_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatataatt
AB375159_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatataatt
AB375162_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatataatt
AB375160_P_P-H      ttgaacacagctaaaacaaaatggtggggttattccttacactttatgggttatataatt
                    ** ****************** ******* *** ** * ***************   ***

AY090454_P_C-H      gggagttgggggacattgcctcaggaacatattgtgcaaaaaatcaaaaattgctttcgc
AY090457_P_P-H      gggagttgggggacattgcctcaggaacatattgtgcaaaaaatcaaagattgctttcgc
AB059660_P_P-H      gggagttgggggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB059661_P_P-H      gggagttgggggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
HM066946_P_P-H      gggagttgggggacattgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
MT622523_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB064315_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB059659_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB375163_P_P-H      gggagttgggggacgttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
HM117850_P_P-H      gggagctgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
FJ356715_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttygc
AB375161_P_P-H      gggagttgggggacsttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB205010_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB353764_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB818694_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagagtgctttcgc
AB266536_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
EU498228_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB179747_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
EF157291_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB275308_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AY090460_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
HM117851_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
FJ356716_P_C-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB375164_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
KX264501_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB375159_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB375162_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
AB375160_P_P-H      gggagttgggggaccttgcctcaggaacatattgtgcataaaatcaaagattgctttcgc
                    ***** ******** *********************** ********* * ****** **

AY090454_P_C-H      aaacttcccgttaatcgacccattgattggaaagtctgtcaacgaattgtgggtcttttg
AY090457_P_P-H      aaacttcctgttaatcgacccattgattggaaagtctgtcaacgaattgtgggtcttttg
AB059660_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgaattgtgggtcttttg
AB059661_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgaattgtgggtcttttg
HM066946_P_P-H      aaacttcccgtgaatagacctattgattggaaggtttgtcaacgaattgtgggtcttttg
MT622523_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB064315_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB059659_P_P-H      aaacttcctgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB375163_P_P-H      aaacttcccgtaaatagacccattgattggaaggtctgtcaacgaattgtgggtcttttg
HM117850_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
FJ356715_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB375161_P_P-H      aaacttcccgtraatagacccattgattggaaggtttgtcaacgaattgtgggtcttttg
AB205010_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB353764_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB818694_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB266536_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
EU498228_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB179747_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
EF157291_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB275308_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AY090460_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
HM117851_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
FJ356716_P_C-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB375164_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
KX264501_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB375159_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB375162_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
AB375160_P_P-H      aaacttcccgtgaatagacccattgattggaaggtttgtcaacgcattgtgggtcttttg
                    ******** ** *** **** *********** ** ******** ***************

AY090454_P_C-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttatatgcctgt
AY090457_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttatatgcctgt
AB059660_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB059661_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgc
HM066946_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
MT622523_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB064315_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB059659_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB375163_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
HM117850_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
FJ356715_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB375161_P_P-H      ggctttgcagccccttttactcaatgtggttaccctgctctcatgcccttgtatgcctgt
AB205010_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB353764_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB818694_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB266536_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
EU498228_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB179747_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
EF157291_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB275308_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AY090460_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
HM117851_P_P-H      ggctttgcagcccctttcactcaatgtggttatcctgctctcatgcccttgtatgcctgt
FJ356716_P_C-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB375164_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
KX264501_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB375159_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB375162_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
AB375160_P_P-H      ggctttgcagccccttttactcaatgtggttatcctgctctcatgcccttgtatgcctgt
                    ***************** ************** ***************** ******** 

AY090454_P_C-H      attaccgctaaacaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AY090457_P_P-H      attaccgctaaacaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB059660_P_P-H      attactgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB059661_P_P-H      attactgctaaccaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
HM066946_P_P-H      attactgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
MT622523_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaccaa
AB064315_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB059659_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctccgtcaacaa
AB375163_P_P-H      atcaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
HM117850_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctatgtaaacaa
FJ356715_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB375161_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB205010_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB353764_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB818694_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB266536_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
EU498228_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB179747_P_P-H      attrccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
EF157291_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB275308_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AY090460_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
HM117851_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctgtgtaaacaa
FJ356716_P_C-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB375164_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
KX264501_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB375159_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB375162_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
AB375160_P_P-H      attaccgctaagcaggcttttgttttctcgccaacttacaaggcctttctctgtaaacaa
                    **  * ***** **************************************  ** * ***

AY090454_P_C-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AY090457_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB059660_P_P-H      tacctgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB059661_P_P-H      tacctgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
HM066946_P_P-H      tacctgaacctttaccccgttgctcggcaacggccgggcctttgccaagtgtttgctgac
MT622523_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB064315_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB059659_P_P-H      tacatgaccctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB375163_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
HM117850_P_P-H      tacctgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
FJ356715_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB375161_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB205010_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB353764_P_P-H      tacatgaacctttaccccgttgctcggcaacgaccaggcctttgccaagtgtttgctgac
AB818694_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB266536_P_P-H      tacatgaacctttaccccgttgctcggcaacgaccaggcctttgccaagtgtttgctgac
EU498228_P_P-H      tacatgaacctttaccccgttgctcggcaacgaccaggcctttgccaagtgtttgctgac
AB179747_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
EF157291_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB275308_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AY090460_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
HM117851_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
FJ356716_P_C-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB375164_P_P-H      tacctgaacctttaccccgttgctcggcaacggccgggcctttgccaagtgtttgctgac
KX264501_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB375159_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB375162_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
AB375160_P_P-H      tacatgaacctttaccccgttgctcggcaacggccaggcctttgccaagtgtttgctgac
                    *** *** ************************ ** ************************

AY090454_P_C-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AY090457_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB059660_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB059661_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcctgcgcggaacctttgag
HM066946_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
MT622523_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB064315_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgag
AB059659_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB375163_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
HM117850_P_P-H      gcaacccccactggctggggcttggcaattggccatcagcgcatgcgcggaacctttgtg
FJ356715_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB375161_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB205010_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggcacctttgtg
AB353764_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB818694_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB266536_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
EU498228_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB179747_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
EF157291_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB275308_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AY090460_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
HM117851_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
FJ356716_P_C-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB375164_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
KX264501_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB375159_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB375162_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
AB375160_P_P-H      gcaacccccactggctggggcttggcgattggccatcagcgcatgcgcggaacctttgtg
                    ************************** *************** ******* ******* *

AY090454_P_C-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtct
AY090457_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtct
AB059660_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtct
AB059661_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtct
HM066946_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtct
MT622523_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcctgtttcgctcgcagcaggtct
AB064315_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagcaggtct
AB059659_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagccggtct
AB375163_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagcaggtct
HM117850_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagcaggtct
FJ356715_P_P-H      gctcctctgccgatccatactgcggaactcctcgcagcttgtttcgctcgcagcaggtct
AB375161_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagcaggtct
AB205010_P_P-H      gctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtct
AB353764_P_P-H      gctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtct
AB818694_P_P-H      gctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtct
AB266536_P_P-H      gctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtct
EU498228_P_P-H      gctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtct
AB179747_P_P-H      gctcctctgcccatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtct
EF157291_P_P-H      gctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtct
AB275308_P_P-H      gctcctctgcccatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtct
AY090460_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagcaggtct
HM117851_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagcaggtct
FJ356716_P_C-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagcaggtct
AB375164_P_P-H      gctcctctgccgatccatactgcagaactcctagcagcttgtttcgctcgcagcaggtct
KX264501_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcttgtttcgctcgcagcaggtct
AB375159_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcctgtttcgctcgcagcaggtct
AB375162_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcctgtttcgctcgcagcaggtct
AB375160_P_P-H      gctcctctgccgatccatactgcggaactcctagcagcctgtttcgctcgcagcaggtct
                    *********** *********** ******** ** ** *************** *****

AY090454_P_C-H      ggagcggacattatcggcactgacaactccgttgtcctgtctcggaagtacacctccttc
AY090457_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctgtctcggaagtacacctccttc
AB059660_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB059661_P_P-H      ggagcggacgttatcggcactgacaactctgttgtcctttctcggaagtacacctccttc
HM066946_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
MT622523_P_P-H      ggagcggacgttatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB064315_P_P-H      ggagcggacattatcggcaccgacaactccgttgtcctttctcggaagtacacctccttc
AB059659_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB375163_P_P-H      ggagcggacattatcggaactgacaactccgttgtcctttctcggaagtacacctccttc
HM117850_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
FJ356715_P_P-H      ggagcggacattatcggcactgacaactctgttgtcctttctcggaagtacacctccttc
AB375161_P_P-H      ggagcggacrttatcggaactgacaactccgttgtcctttctcggaagtacacctccttc
AB205010_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB353764_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB818694_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB266536_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
EU498228_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB179747_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
EF157291_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB275308_P_P-H      ggagcggacattatcggcaccgacaactccgttgtcctttctcggaagtacacctccttc
AY090460_P_P-H      ggagcggacattatcggcactgacaactctgttgtcctttctcggaagtacacctccttc
HM117851_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
FJ356716_P_C-H      ggagcggacattatcggcactgacaactctgttgtcctttctcggaagtacacctccttc
AB375164_P_P-H      ggagcggacattatcggcactgacaactctgttgtcctttctcggaagtacacctccttc
KX264501_P_P-H      ggagcggacattatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB375159_P_P-H      ggagcggacgttatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB375162_P_P-H      ggagcggacgttatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
AB375160_P_P-H      ggagcggacgttatcggcactgacaactccgttgtcctttctcggaagtacacctccttc
                    ********* ******* ** ******** ******** *********************

AY090454_P_C-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtc
AY090457_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtc
AB059660_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB059661_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
HM066946_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
MT622523_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB064315_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB059659_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB375163_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
HM117850_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
FJ356715_P_P-H      ccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB375161_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB205010_P_P-H      ccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB353764_P_P-H      ccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB818694_P_P-H      ccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB266536_P_P-H      ccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
EU498228_P_P-H      ccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB179747_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
EF157291_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB275308_P_P-H      ccatggctgataggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AY090460_P_P-H      ccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
HM117851_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
FJ356716_P_C-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB375164_P_P-H      ccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
KX264501_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB375159_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB375162_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
AB375160_P_P-H      ccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtc
                    ********* * ** ************************************** ******

AY090454_P_C-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcctggggctctgccgcccc
AY090457_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcctggggctctgccgcccc
AB059660_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccct
AB059661_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
HM066946_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccct
MT622523_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB064315_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB059659_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctaccgccct
AB375163_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgcccc
HM117850_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgtttggggctctgccgccct
FJ356715_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB375161_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgcccc
AB205010_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB353764_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcggggtcgcttggggctctgccgccct
AB818694_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB266536_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
EU498228_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB179747_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
EF157291_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB275308_P_P-H      ccgtcggcgcagaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AY090460_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
HM117851_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
FJ356716_P_C-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB375164_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
KX264501_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB375159_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB375162_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
AB375160_P_P-H      ccgtcggcgctgaatcctgcggacgacccctctcgtggtcgcttggggctctgccgccct
                    ********** ************************ *****  ********* ****** 

AY090454_P_C-H      cttctccgccttccgttccggccgacgacagggcgcacctctctttacgcggactccccg
AY090457_P_P-H      cttctccgccttccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB059660_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB059661_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
HM066946_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
MT622523_P_P-H      cttctccgcctaccgttccggccaacaacgggtcgcacctctctttacgcggactccccg
AB064315_P_P-H      cttctccgcctgccgttccggccaacgacgggtcgcacctctctttacgcggactccccg
AB059659_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB375163_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
HM117850_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
FJ356715_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB375161_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB205010_P_P-H      cttctccgcctgccgttccggccgtcgacgggtcgcacctctctttacgcggactccccg
AB353764_P_P-H      cttctccgcctgtcgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB818694_P_P-H      cttctccgcctgtcgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB266536_P_P-H      cttctccgcctgtcgttccggccgacgacgggtcgcacctctctttacgcggactccccg
EU498228_P_P-H      cttctccgcctgtcgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB179747_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
EF157291_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB275308_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AY090460_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
HM117851_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
FJ356716_P_C-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB375164_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
KX264501_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB375159_P_P-H      cttctccgcctaccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB375162_P_P-H      cttctccgcctgccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
AB375160_P_P-H      cttctccgcctaccgttccggccgacgacgggtcgcacctctctttacgcggactccccg
                    ***********  **********  * ** ** ***************************

AY090454_P_C-H      cctgtgccttttcatcagccggcccgtgtgcacttcggttcacctctgcacgtcgcatgg
AY090457_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB059660_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB059661_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
HM066946_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
MT622523_P_P-H      cctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatgg
AB064315_P_P-H      cctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcacatgg
AB059659_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcacatgg
AB375163_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
HM117850_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
FJ356715_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB375161_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB205010_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB353764_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB818694_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB266536_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
EU498228_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB179747_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
EF157291_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB275308_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AY090460_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
HM117851_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
FJ356716_P_C-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB375164_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
KX264501_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB375159_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB375162_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
AB375160_P_P-H      cctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatgg
                    ********** ***** ***** ************** **************** *****

AY090454_P_C-H      agaccaccgtga
AY090457_P_P-H      agaccaccgtga
AB059660_P_P-H      agaccaccgtga
AB059661_P_P-H      agaccaccgtga
HM066946_P_P-H      agaccaccgtga
MT622523_P_P-H      agaccaccgtga
AB064315_P_P-H      agaccaccgtga
AB059659_P_P-H      agaccaccgtga
AB375163_P_P-H      agaccaccgtga
HM117850_P_P-H      agaccaccgtga
FJ356715_P_P-H      agaccaccgtga
AB375161_P_P-H      agaccaccgtga
AB205010_P_P-H      agaccaccgtga
AB353764_P_P-H      agaccaccgtga
AB818694_P_P-H      agaccaccgtga
AB266536_P_P-H      agaccaccgtga
EU498228_P_P-H      agaccaccgtga
AB179747_P_P-H      agaccaccgtga
EF157291_P_P-H      agaccaccgtga
AB275308_P_P-H      agaccaccgtga
AY090460_P_P-H      agaccaccgtga
HM117851_P_P-H      agaccaccgtga
FJ356716_P_C-H      agaccaccgtga
AB375164_P_P-H      agaccmccgtga
KX264501_P_P-H      agaccaccgtga
AB375159_P_P-H      agaccaccgtga
AB375162_P_P-H      agaccaccgtga
AB375160_P_P-H      agaccaccgtga
                    ***** ******

© 1998-2022Legal notice