HBVdb

Dataset for nucleotide sequence C of genotype G

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********** *********************************************************************
ATGGATAGAACAACTTTGCCATATGGCCTTTTTGGCTTAGACATTGACCCTTATAAAGAATTTGGAGCTACTGTGGAGTT
          t                                                                     
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * **************************************************** ***** ************** * *
gCTCTCGTTTTTGCCTTCTGACTTTTTCCCGTCTGTTCGTGATCTTCTCGACACCGCTTCAGCTTTGTACCGGGAATCCT
a y                                                    a     s              g t 
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********* **  **** ****** ****** ********** ******** ***************************
TAGAGTCCTCTGATCATTGTTCGCCTCACCATACAGCACTCAGGCAAGCAATcCTGTGCTGGGGTGAGTTGATGACTCTA
         t  tg    c      y      g          c        t                           
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **********************************************  ********************* ***** *
GCtACCTGGGTGGGTAATAATTTGGAAGATCCAGCATCCAGAGATTTGGTGGTCAATTATGTTAATACTAATATGGGTTT
  c                                              ca                     t     c 
                                                                        c       

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************ ***************************** ***** *******************************
AAAAATCAGGCAACTATTGTGGTTTCACATTTCCTGTCTTACTTTTGGGAGAGAAACCGTTCTTGAGTATTTGGTGTCTT
            g                             g     a                               
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
********************** * ************************************************* *****
TTGGAGTGTGGATTCGCACTCCTCCTGCTTATAGACCACCAAATGCCCCTATCCTATCAACACTTCCGGAGACTACTGTT
                      g t                                                 g     
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
************* ****** ******************************      ** **** **********  ***
GTTAGACGAAGAGGCAGGTCCCCTCGAAGAAGAACTCCCTCGCCTCGCAGACGAAGATCTCAATCGCCGCGTCGCAGAAG
             a      t                              gccttc  c    a          ca   
                                                    a                         

       570       580        
....:....|....:....|....:...
**** *****  ************ ***
ATCTGCATCTCCAGCTTCCCAATGTTAG
    a     ta            a   
                            
© 1998-2020Legal notice