Dataset for nucleotide sequence C of genotype G

[Download (right click)] [Edit] [Sequences] [Repertoires]

90 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

KF779267_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439797_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KY004111_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JX899374_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KF767451_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB056515_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
HE981171_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
HE981172_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB056513_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439780_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439785_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439788_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439779_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439781_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439782_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439786_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439787_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439789_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439791_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439784_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KF779235_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KF779233_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KF767450_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707673_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707671_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707436_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439799_C_P-G      atggatagaataactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439796_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
GU563556_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
DQ207798_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB064312_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JX899375_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KM998716_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439792_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439793_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439801_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707657_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
HE981174_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
HE981175_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
HE981176_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439803_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439804_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439805_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439806_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439807_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439808_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439809_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439810_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439811_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439812_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439813_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439814_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439815_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439816_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439817_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439818_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KJ194508_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
M74502_C_P-G        atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB056514_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB064311_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AF160501_C_C-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AF405706_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
EF464097_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
EF464098_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
EF634480_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439794_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439795_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439800_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JF439802_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707660_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707666_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707668_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707677_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707678_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707679_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
JQ707680_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KF414679_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KR230749_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KX264500_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB064310_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB064313_C_C-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB375165_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB375166_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB375167_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB375168_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB375169_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
AB375170_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KF767452_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
KF779357_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
GU565217_C_P-G      atggatagaacaactttgccatatggcctttttggcttagacattgacccttataaagaa
                    ********** *************************************************

KF779267_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439797_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KY004111_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JX899374_C_P-G      tttggagctactgtggagttgcyctcgtttttgccttctgactttttcccgtctgttcgt
KF767451_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB056515_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
HE981171_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
HE981172_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB056513_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439780_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439785_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439788_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439779_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439781_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439782_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439786_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439787_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439789_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439791_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
JF439784_C_P-G      tttggagctactgtggagttactctcgtttttgccttctgactttttcccgtctgttcgt
KF779235_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KF779233_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KF767450_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707673_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707671_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707436_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439799_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439796_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
GU563556_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
DQ207798_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB064312_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JX899375_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KM998716_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439792_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439793_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439801_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707657_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
HE981174_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
HE981175_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
HE981176_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439803_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439804_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439805_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439806_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439807_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439808_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439809_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439810_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439811_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439812_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439813_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439814_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439815_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439816_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439817_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439818_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KJ194508_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
M74502_C_P-G        tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB056514_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB064311_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AF160501_C_C-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AF405706_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
EF464097_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
EF464098_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
EF634480_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439794_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439795_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439800_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JF439802_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707660_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707666_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707668_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707677_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707678_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707679_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
JQ707680_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KF414679_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KR230749_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KX264500_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB064310_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB064313_C_C-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB375165_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB375166_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB375167_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB375168_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB375169_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
AB375170_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KF767452_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
KF779357_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
GU565217_C_P-G      tttggagctactgtggagttgctctcgtttttgccttctgactttttcccgtctgttcgt
                    ******************** * *************************************

KF779267_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439797_C_P-G      gatcttctcgacaccacttcagctttgtaccgggaatccttagagtcctctgatcattgt
KY004111_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaagccttagagtcctttgatcattgt
JX899374_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KF767451_C_P-G      gatcttctcgacaccgcttcasctttgtaccgggaatccttagagtcctctgatcattgt
AB056515_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgttcattgt
HE981171_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
HE981172_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB056513_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439780_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439785_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439788_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439779_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatctttagagtcctctgatcattgt
JF439781_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatctttagagtcctctgatcattgt
JF439782_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatctttagagtcctctgatcattgt
JF439786_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatctttagagtcctctgatcattgt
JF439787_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatctttagagtcctctgatcattgt
JF439789_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatctttagagtcctctgatcattgt
JF439791_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatctttagagtcctctgatcattgt
JF439784_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KF779235_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KF779233_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KF767450_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattct
JQ707673_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707671_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707436_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439799_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439796_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
GU563556_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgagcattgt
DQ207798_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB064312_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JX899375_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KM998716_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439792_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439793_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439801_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707657_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
HE981174_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
HE981175_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
HE981176_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439803_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439804_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439805_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439806_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439807_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439808_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439809_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439810_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439811_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439812_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439813_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439814_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439815_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439816_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439817_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439818_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KJ194508_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
M74502_C_P-G        gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB056514_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB064311_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AF160501_C_C-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AF405706_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
EF464097_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
EF464098_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
EF634480_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439794_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439795_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439800_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JF439802_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707660_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707666_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707668_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707677_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707678_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707679_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
JQ707680_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KF414679_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KR230749_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KX264500_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB064310_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB064313_C_C-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB375165_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB375166_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB375167_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB375168_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB375169_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
AB375170_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KF767452_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
KF779357_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
GU565217_C_P-G      gatcttctcgacaccgcttcagctttgtaccgggaatccttagagtcctctgatcattgt
                    *************** ***** ************** * ********** **  **** *

KF779267_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439797_C_P-G      tcgcctcaccatacagcactcagccaagcaatcctgtgctggggtgagttgatgactcta
KY004111_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JX899374_C_P-G      tcgccycaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KF767451_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB056515_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
HE981171_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
HE981172_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB056513_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439780_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439785_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439788_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439779_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439781_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439782_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439786_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439787_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439789_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439791_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439784_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KF779235_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KF779233_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KF767450_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707673_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707671_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707436_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439799_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439796_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
GU563556_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
DQ207798_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB064312_C_P-G      tcgcctcaccatgcagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JX899375_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KM998716_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439792_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439793_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439801_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707657_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
HE981174_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
HE981175_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
HE981176_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439803_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439804_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439805_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439806_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439807_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439808_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439809_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439810_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439811_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439812_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439813_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439814_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439815_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439816_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439817_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
JF439818_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
KJ194508_C_P-G      tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
M74502_C_P-G        tcgcctcaccatacagcactcaggcaagcaattctgtgctggggtgagttgatgactcta
AB056514_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB064311_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AF160501_C_C-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AF405706_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
EF464097_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
EF464098_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
EF634480_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439794_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439795_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439800_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JF439802_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707660_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707666_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707668_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707677_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707678_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707679_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
JQ707680_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KF414679_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KR230749_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KX264500_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB064310_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB064313_C_C-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB375165_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB375166_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB375167_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB375168_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB375169_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
AB375170_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KF767452_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
KF779357_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
GU565217_C_P-G      tcgcctcaccatacagcactcaggcaagcaatcctgtgctggggtgagttgatgactcta
                    ***** ****** ********** ******** ***************************

KF779267_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439797_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KY004111_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JX899374_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KF767451_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB056515_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
HE981171_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggcggtcaattat
HE981172_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB056513_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439780_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439785_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439788_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439779_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439781_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439782_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439786_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439787_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439789_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439791_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439784_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KF779235_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtagtcaattat
KF779233_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtagtcaattat
KF767450_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707673_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707671_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707436_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439799_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439796_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
GU563556_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
DQ207798_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB064312_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JX899375_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KM998716_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439792_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439793_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439801_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707657_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
HE981174_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
HE981175_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
HE981176_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439803_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439804_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439805_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439806_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439807_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439808_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439809_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439810_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439811_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439812_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439813_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439814_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439815_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439816_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439817_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439818_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KJ194508_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
M74502_C_P-G        gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB056514_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB064311_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AF160501_C_C-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AF405706_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
EF464097_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
EF464098_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
EF634480_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439794_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439795_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439800_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JF439802_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707660_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707666_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707668_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707677_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707678_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707679_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
JQ707680_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KF414679_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KR230749_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KX264500_C_P-G      gctacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB064310_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB064313_C_C-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375165_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375166_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375167_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375168_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375169_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
AB375170_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KF767452_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
KF779357_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
GU565217_C_P-G      gccacctgggtgggtaataatttggaagatccagcatccagagatttggtggtcaattat
                    ** **********************************************  *********

KF779267_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439797_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KY004111_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JX899374_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KF767451_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB056515_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
HE981171_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
HE981172_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB056513_C_P-G      gttaatactaatttgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439780_C_P-G      gttaatactaatatgggtctaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439785_C_P-G      gttaatactaatatgggtctaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439788_C_P-G      gttaatactaatatgggtctaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439779_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439781_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439782_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439786_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439787_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439789_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439791_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439784_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KF779235_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KF779233_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KF767450_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707673_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707671_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707436_C_P-G      gttaatactaatctgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439799_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439796_C_P-G      gttaatactaatatgggtttaaaaatcaggcagctattgtggtttcacatttcctgtctt
GU563556_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
DQ207798_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB064312_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JX899375_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KM998716_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439792_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439793_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439801_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707657_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
HE981174_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
HE981175_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
HE981176_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439803_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439804_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439805_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439806_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439807_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439808_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439809_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439810_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439811_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439812_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439813_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439814_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439815_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439816_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439817_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439818_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KJ194508_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
M74502_C_P-G        gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB056514_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB064311_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AF160501_C_C-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AF405706_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
EF464097_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
EF464098_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
EF634480_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439794_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439795_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439800_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JF439802_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707660_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707666_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707668_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707677_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707678_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707679_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
JQ707680_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KF414679_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KR230749_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KX264500_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB064310_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB064313_C_C-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB375165_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB375166_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB375167_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB375168_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB375169_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
AB375170_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KF767452_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
KF779357_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
GU565217_C_P-G      gttaatactaatatgggtttaaaaatcaggcaactattgtggtttcacatttcctgtctt
                    ************ ***** ************* ***************************

KF779267_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439797_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KY004111_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JX899374_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KF767451_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB056515_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
HE981171_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
HE981172_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB056513_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439780_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439785_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439788_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439779_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439781_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439782_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439786_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439787_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439789_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439791_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439784_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KF779235_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KF779233_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KF767450_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707673_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707671_C_P-G      acttttggaagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707436_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439799_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439796_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
GU563556_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
DQ207798_C_P-G      acgtttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB064312_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JX899375_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KM998716_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439792_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439793_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439801_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707657_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
HE981174_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
HE981175_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
HE981176_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439803_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439804_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439805_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439806_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439807_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439808_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439809_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439810_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439811_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439812_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439813_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439814_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439815_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439816_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439817_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439818_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KJ194508_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
M74502_C_P-G        acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB056514_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB064311_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AF160501_C_C-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AF405706_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
EF464097_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
EF464098_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
EF634480_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439794_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439795_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439800_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JF439802_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707660_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707666_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707668_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707677_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707678_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707679_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
JQ707680_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KF414679_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KR230749_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KX264500_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB064310_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB064313_C_C-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB375165_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB375166_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB375167_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB375168_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB375169_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
AB375170_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KF767452_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
KF779357_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
GU565217_C_P-G      acttttgggagagaaaccgttcttgagtatttggtgtcttttggagtgtggattcgcact
                    ** ***** ***************************************************

KF779267_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439797_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KY004111_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JX899374_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactgctgtt
KF767451_C_P-G      ccgcttgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB056515_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
HE981171_C_P-G      cctcttgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
HE981172_C_P-G      cctcttgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB056513_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439780_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439785_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439788_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439779_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439781_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439782_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439786_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439787_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439789_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439791_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439784_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KF779235_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KF779233_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KF767450_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707673_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707671_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707436_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439799_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439796_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
GU563556_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
DQ207798_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB064312_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JX899375_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KM998716_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439792_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439793_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439801_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707657_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
HE981174_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
HE981175_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
HE981176_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439803_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439804_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439805_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439806_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439807_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439808_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439809_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439810_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439811_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439812_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439813_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439814_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439815_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439816_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439817_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439818_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KJ194508_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
M74502_C_P-G        cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB056514_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB064311_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AF160501_C_C-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AF405706_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
EF464097_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
EF464098_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
EF634480_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439794_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439795_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439800_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JF439802_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707660_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707666_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707668_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707677_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707678_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707679_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
JQ707680_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KF414679_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KR230749_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KX264500_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB064310_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB064313_C_C-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB375165_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB375166_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB375167_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB375168_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB375169_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
AB375170_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KF767452_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
KF779357_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
GU565217_C_P-G      cctcctgcttatagaccaccaaatgcccctatcctatcaacacttccggagactactgtt
                    ** * ************************************************* *****

KF779267_C_P-G      gttagacgaagaggcaggtctcctcgaagaagaactccctcgcctcgcagagccttctcc
JF439797_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacaaagatct
KY004111_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JX899374_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KF767451_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB056515_C_P-G      gttagacgaagagacaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
HE981171_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
HE981172_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB056513_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439780_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439785_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439788_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439779_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439781_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439782_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439786_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439787_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439789_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439791_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439784_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KF779235_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KF779233_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KF767450_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707673_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707671_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707436_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439799_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439796_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
GU563556_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
DQ207798_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB064312_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JX899375_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KM998716_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439792_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439793_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439801_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707657_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
HE981174_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
HE981175_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
HE981176_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439803_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439804_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439805_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439806_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439807_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439808_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439809_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439810_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439811_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439812_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439813_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439814_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439815_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439816_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439817_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439818_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KJ194508_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
M74502_C_P-G        gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB056514_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB064311_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AF160501_C_C-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AF405706_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
EF464097_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
EF464098_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
EF634480_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439794_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439795_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439800_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JF439802_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707660_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707666_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707668_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707677_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707678_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707679_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
JQ707680_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KF414679_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KR230749_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KX264500_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB064310_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB064313_C_C-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB375165_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB375166_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB375167_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB375168_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB375169_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
AB375170_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KF767452_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
KF779357_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
GU565217_C_P-G      gttagacgaagaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaagatct
                    ************* ****** ******************************      ** 

KF779267_C_P-G      caatagccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439797_C_P-G      caatcgccgcgtcgcaaaagatctgcatctccagcttcccaatgttag
KY004111_C_P-G      caatcgccgcgtcgcagaagatctacatctccagcttcccaatgttag
JX899374_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KF767451_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB056515_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
HE981171_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
HE981172_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB056513_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439780_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439785_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439788_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439779_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439781_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439782_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439786_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439787_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439789_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439791_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439784_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KF779235_C_P-G      caatcgccgcgtcgcagaagatctgcatcttcagcttcccaatgttag
KF779233_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KF767450_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707673_C_P-G      caatcgccgcgtcgcggaagatctgcatctccagcttcccaatgttag
JQ707671_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707436_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439799_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439796_C_P-G      caatcgccgcgtcgcagaagatctgcatctcaagcttcccaatgttag
GU563556_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
DQ207798_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB064312_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JX899375_C_P-G      caatcgccgcgtcgccgaagatctgcatctccagcttcccaatgttag
KM998716_C_P-G      caatcgccgcgtcgccgaagatctgcatctccagcttcccaatgttag
JF439792_C_P-G      caatcgccgcgtcgcagaagatctgcatctcaagcttcccaatgttag
JF439793_C_P-G      caatcgccgcgtcgcagaagatctgcatctcaagcttcccaatgttag
JF439801_C_P-G      caatcgccgcgtcgcagaagatctgcatctcaagcttcccaatgttag
JQ707657_C_P-G      caatcgccgcgtcgcagaagatctgcatctcaagcttcccaatgttag
HE981174_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
HE981175_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
HE981176_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439803_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439804_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439805_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439806_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439807_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439808_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439809_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439810_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439811_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439812_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439813_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439814_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439815_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439816_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439817_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439818_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KJ194508_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
M74502_C_P-G        caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB056514_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB064311_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AF160501_C_C-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AF405706_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
EF464097_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
EF464098_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
EF634480_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439794_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439795_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439800_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JF439802_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707660_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707666_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707668_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707677_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707678_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707679_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
JQ707680_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KF414679_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KR230749_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KX264500_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB064310_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB064313_C_C-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB375165_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB375166_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB375167_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB375168_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB375169_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
AB375170_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KF767452_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
KF779357_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgttag
GU565217_C_P-G      caatcgccgcgtcgcagaagatctgcatctccagcttcccaatgatag
                    **** **********  ******* *****  ************ ***

© 1998-2021Legal notice