HBVdb

Dataset for nucleotide sequence P of genotype F

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** **** **** *  ***** **         * *****           *  * ** *   *  **  ******
ATGCCCCTATCcTATCCACACTTCCGGAAACTACTGTTGTTAGACGA------CGAGGCAGGTCCCCTaGAAGAAGAACT
           t    a             t g     a     g        a        a t             
                                                                                
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** *** * *   ****** *** ***  *** *   *     **** *******   * **   ***** *** **  
CCCTCGCCTCGCaGACGAAGgTCTCAATCGCCGCGTCGCaGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATTCCTT
            ca      a        a         cac              gt      gc              
                                                                                
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * *       ***    *  ** ** ** ** **  ******  **    *  *** ** * **    *  **   *
GGACTCATAAGGTGGGAAAtTTTACGGGgCTcTAtTCtTCTACTGTtCCTgCTTTtAATCCTgACTGGTTaACTCCTTCT
       c    k      c     a  a  t  c         a   a    c   t  a t   gcc     g   
            g                                 g               c       g         
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****  * ***** *  **  *  *  * **    *  ***** * **  ** ** **  * ** **  * **  *   
TTTCCTGAtATTCATTTaCATCAAGAtcTGATatctAAATGTGAACAATTTGTAGGCCCtCTcACaAAAAATGAATTgaG
      a c        g  cg ga ct a  tcac          g      g  t   t  t   c       ac 
                                   a                        a  c              
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    ** *** *  * *****  * * * * *  ** *     ** ***** ** *     ** ** *  ** ** **  
AAGaTTaAAATTggTtATGCCAgCcAGATTtTtTCCTAAggTTACcAAATAtTTTCCTaTGGAaAAaGGaATtAAACCcT
g rg  g     aa c      t t r   c      ac c  t     c  c  cc a  g  g  c  c  g  
                                             a           at    c     g          
                                                               t     t          
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ****  **  *    *********** **  *  *    ** ****  *****  * *** *    **  *  **** 
ATTATCCTGAgcAtGcaGTTAATCATTAtTTTAAgACcAGACAtTATTTGCATACTTTATGGAAgGCgGGaATttTATAT
       a  ta cttg           c  cc  a rg  c            c t     a  a   cc     
             g                     t                          r  r      y     
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *   *     *   ** **  ** ** ** ** ** *  **  * ****** ** **  ****************  
AAGAGAGAATCCACACGTAGCGCCTCATTTTGTGGGTCACCATATTCcTGGGAACAAGAGCTACAGCATGGGAGCACCTC
  r rgr       c a  s   a     c  k           ca t         a                      
                                                                                
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ** **     **** ** * * *    *****  * ** ***** ** ***** *** * **  * *****  *****
TcTCAACGACacGAAGgGGCATGGGACaGAATCTcTCTGTgCCCAATCCtCTGGGaTTCTTtCCAGACCATCAGCTGGAT
 a        ta    a          t          a        a     c   c g   r a      t     
          g                                      g                              
                                                 c                              
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * ****   ** ** *** **   * ** ****** ******    ******   ********* ** ********
CCtCTaTTCAGgGCAAATTCCAGCAGTCCCGAcTGGGACTTCAACAaAAACAAGGACAaTTGGCCAATGGCAAACAAGGT
   t    aa          a      a  t             ccgc        g                     
                                                 m        c                     
                                                 g                              
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *    * **     *  ** ** ** *  ** **    ***** *** *  * ** ***** ** ** ** ** **  
AGGA---GTGGGAGGaTACGGTCCaGGGTTCACACCCCCACACGGTGGCCTGtTGGGGTGGAGcCCtCAgGCACAgGGTG
             acc  t  c  t     t     a  t         t  c    a     t  a  a     a   a
               t        c                                                       
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  * **   * **    * ** ***    *  **********          *   *   *   *        * *
TgcTaACAACcTTGCCAGCAGATCCGCCTCCTGCTTCCACCAATCGGCGGTCCGGGAGaAAg--CCAACCCCAGTCTCTC
 tt     a c      ga    a        cc           aaaa g  a  g  a    g     ta      
        t                                               r                     
                                                                              
                                                                              

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    * *  ***** ** ** **             *           ** **                         
CACCTCTAAGAGACACaCATCCACAGGCcATGCAGTGGAACTCaACcCAGTTCCACCAGGCtCTGTTaGATCCgAGgGTA
          g     t     c     ag a  aa    ta ct ta    t  t  aa ct    g     c aa   
                            g                                            a      
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                             ***   * *  * *** **
AGGGCTCTGTAttTtCCTGCTGGTGGCTCCAGTTCAGaGACACAGAACCCTGCTCCGACTATTGCCTCTCTCACATCATC
 a   ------cc-c-                    aga  g  a       t             y             
          g--c-                       c                                         
          c                                                                     
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  *    **  ***** * ** **     * ** *** * **     **   ** ** *  **  **** *** * * 
AATCTTCTcGAAGACTGGGGGCCCTGCtAtGAACATGGAcAACATcACATCAGGACTCCTAGGACCCCTGCTCGTGTTAC
   c  t         c  t  tc c         g g  ctt         a                     
     a  y           a      a y                                                  
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ** *  *  ** **  * **   *** ** **  ***   * ***  *** ** *********** ** ****** 
AGGCGGTGTGTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTA
   g     t  c  c     t        g  a   g    g  a                          g       
         c                                                                      
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *     * *   ***** ** ********* * *********************** *****  *******  * ***
GGGGGActACCCGGGTGTCCTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTG
 a  a ac   a                                                     t              
    c                                                                           
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **  ***** * *  ** ** ** ***** ****** ******* *********** ******** ***********
TCCTGGCTATCGtTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGG
      t     c                                                                   
                                                                                
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** **** *     ***** ******** ***** *                             * *   **** *
TTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAcTTCCAGGATC------------cACGACC---ACCAGC
     g       c  g                        a----------            t  a a ggg      
                                         -                      -               
                                                                a               
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ****  ****   **** **  ** **** * *   ** * **** * ***** ** ** *** * * *** * ***
ACGGGACCaTGCAAAACCTGCACAACTCTTGCtCAAGGAACCTCTATGTTTCCCTCcTGtTGCTGTTCcAAACCcTCGGA
        c    gg               a     c                 t  c  t   a a     t     
                                                                    m     y     
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ***** ***** *********** ***** **   ** *** ***** * ********  ** * ****  ** ** **
CGGAAACTGCACtTGTATTCCCATCCCATCATCtTGGGCTTTAGGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCT
            c                 g  c                                            
                                                                                
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * ***** ***********  *  ** ***** ****  * * ********* *** *********   **   ****
CCTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGGTGCGTAGGGCTTTCCCCCACTGTcTGGCTTTTAGTTATATGGATG
 a       a                              c             t   t              g      
 t       k                                                                      
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ************ ** *** **   *   * *  **  *  * **  *   * ** * *****  *  ****  **** 
ATCTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATACCGCTGTTACCAATTTTCTGTTATCTGTGGGT
                            a  c                                 t        t    g
                                                                                
                                                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** *  * **  *  * ***** **  * ***** **     *  * ** *****  *    ** **  ***  **  *
ATCCATTTaAATACcTCtAAAACaAAAAGATGGGGTTAcacccTAcATTTcATGGGTTATGTtATTGGcAGTTGGGGAtC
        g   g tg g     g  gc       c  ttatt ca c  t       a c             g 
                 c     t                 a                  a             a 
                                                                              y 
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** **  * ** ***   *  **  * *     *   *    *** * *****    ** **  * ** ***** *
aTTACCcCAAGATCAcATTGTACAcAAAaTCAAAGAtTGtTTTcGtAAACTtCCTGTAAATCGtCCaATTGAtTGGAAAG
g  g  a     c  t   a t  a  gc   rg  a  c   a g     g           c   a  c       
      t                 t           c        a                 a              
                                                                              
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** **  *  * ** **  *  ***  ***** ** *  *   * ***** ** ** **************  *  * 
TTTGTCAaCGcATTGTGGGtCTTTTGGGCTTTGCcGCcCCtTTtACcCAATGTGGTTATCCTGCTCTCATGCCTcTGTAT
 c       a       c          t  t  c  c  t     c                     t  c
 a                                g           a                                 
                                  a                                             
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   ** ** *  ** **  * ** ***** ** ****  ** ** **  ***** *       ** ***    *******
gCCTGTATaACTGCtAAACAGGCTTTTGTCTTTTCGCCAACTTACAAGGCCTTTCTaTGTaAACAaTACATGAACCTTTA
aat     t  c  g        g     t  c        c              c   c    g   gctc       
r       c     a        c                 a              g                       
                                                                                
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ***    ******** * *** ******************* ** ** ****  ** ****** * *   * ** *
CCCCGTTGCTCGGCAACGGCCAGGCCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCTTGGCCATTGGCC
         ca        t g                       t     t        c                   
                     t                                                          
                                                                                
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ******  *** *   *****  ******  * ******* * * ** **  **   *  ** ** ** *** ** * 
ATCAGCGCATGCGTGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACTCCTTGCAGCtTGTTTCGCTCGCAGC
                                  a              a        a     c  c            
                                                                                
                                                                                
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** ***  *     * *  ** ** *     ** *  *  **  *  * ** ** *  ** ** *********** **
cGGTCTGGAGCGAaacTcATCGGCACaGACAAcTCTGTTGTCCTCTCTaGGAAGTACACCTCCTTcCCATGGCTGCTCGG
a          accta t     g  g     t     c        cc a  a  t  a     t           a  
             gcg          t           g         m                               
                                                g                               
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  **** ** ***** **  * ** ****  ***** ***** ** ** * ********* ******** ** **  
tTGTGCTGCcAACTGGATCCTgCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCcGCGGACGAcCCCTCtC
a        a                                    a  a           a        t  t  
g                                               c              t                
c                                                                               
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** **  * **  * *  ** **     * * **  * ****   ** ** ***** *    ******** ***** *
GGGGtCGCTTGGGGcTgTAcCGCCCcCTTCTcCGTCTGCcGTTCCAGCCGACgACGGGTCGCACCTCTCTTTACGCGGaC
    c  tc a  ag c tt     t     g     a t     g   a  c        t                c 
                a              t                    a                         t 
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550        
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:...
 * **   *** *** * *    ****   ************ ***************     **** ** *** ***
TCCCCGTCTGTTCCTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAGACCACCGTGA
           g       g        t                               a      a          
                                                                              
                                                                              
                                                                              
© 1998-2020Legal notice