HBVdb

Dataset for nucleotide sequence P of genotype F

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****** **** ****    ***** **         * * * *           *  * **                  
ATGCCCCTATCcTATCCACACTTCCGGAAACTACTGTTGTTAGACGA------CGAGGCAGGTCCCCTaGAAGAAGAACT
           t                 gt g     a     ga       a      annnnncnnnnnnnnnnn
                                             c                  t   n           
                                                                                
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        * *   ****** *** ***  * * *   *     **** *******   * **   *****  ** **  
CCCTCGCCTCGCaGACGAAGgTCTCAATCGCCGCGTCGCaGAAGATCTCAATCTCCAGCTTCCCAATGTTAGTATTCCTT
nnnnnnnn    ca      a        a   g     cac               t      gc              
                                                                                
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   * *       ***    *  ** ** ** ** **  ******  **    *  *** ** * **    *  **   *
GGACTCATAAGGTGGGAAAtTTTACGGGgCTcTAcTCtTCTACTGTaCCTgCTTTtAATCCTgACTGGTTaACTCCTTCT
       c    k      c     a  a  t  t         t   a    c   t  a t   gcc         
            g                                 g   r           c       g         
                                                                                
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*****  * ***** *  **  *  *  * **    *  ***** * **  ** ** **  * ** **  * **  *   
TTTCCTGAtATTCATTTaCATCAAGAtcTGATatctAAATGTGAACAATTTGTAGGCCCtCTcACaAAAAATGAATTgAG
      a c        g   g ga ct a  tcac          g      g      t  c           ac 
                                   a                        a  t              
                                                                                
                                                                                

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    ** *** *  * *****  * * * * *  ** *     ** ***** ** *     ** ** *  ** ** **  
AAGaTTaAAATTggTtATGCCAgCcAGATTtTtTCCTAAggTTACcAAATAtTTTCCTaTGGAaAAaGGaATtAAACCcT
g  g  g     aa c      t t     c      ac    t     c     cc a  g  g  c  c  g  
                                             a            t    c     g          
                                                               t                
                                                                                

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ****  **  *    *********** **  *  *    ** ****  *****  * *** *    **  *  **** 
ATTATCCTGAgcAtGcaGTTAATCATTAtTTTAAgACcAGACAtTATTTGCATACTTTATGGAAgGCgGGaATttTATAT
       a  ta cttg           c    a     c            c t     a  a   cc     
                            y      t                          r  r      y     
                                                                                
                                                                                

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *   *     *    * **  ** ** ** ** ** *  **  * ****** ** *   ****************  
AAGAGAGAATCCACACGTAGCGCCTCATTTTGTGGGTCACCATATTCcTGGGAACAAGAGCTACAGCATGGGAGCACCTC
  r r r       c a      a                       t         a                      
                                                                                
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  **  *     **** ** * * *    *****  * ** ***** ** ***** *** * **  * *****  *****
TcTCAACGACacGAAGgGGCATGGGACaGAATCTcTCTGTgCCCAATCCtCTGGGaTTCTTtCCAGAcCATCAGCTGGAT
 a        ta    a          t          a        a     c   c g   r a            
          g                                      g                              
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  * ****   ** ** *** **   * ** *****  ******    ******   *********  * ***** **
CCtCTaTTCAGaGCAAATTCCAGCAGTCCCGAcTGGGACTTCAACAaAAACAAGGACAaTTGGCCAATGGCAAACAAGGT
   t    ag                    t             c gc        c                     
                                                          g                     
                                                                                
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *    * **     *   * **  * *  ** **    ***** *** *  * ** * *** ** *  ** ** **  
AGGA---GTGGGAGGaTACGGTCCaGGGTTCACACCCCCACACGGTGGCCTGtTGGGGTGGAGcCCtCAGGCACAgGGTG
            g ct     c      t        t            c    a     t  a  a     a   a
               c                                                              
                                                                                
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *  * **   * **    * ** ***    *  *********           *   *   *   *        * *
TgcTaACAACcTTGCCAGCAGATCCGCCTCCTGCTTCCACCAATCGGCGGTCCGGGAGaAAg--CCAACCCCAGTCTCTC
 tt     a       tga    a        cc           a aa g  a  g  a                  
                                                                              
                                                                              
                                                                              

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *    * *  ** ** ** ** **             *           ** **                         
CACCTCTAAGAGACACaCATCCACAGGCcATGCAGTGGAACTCaACcCAGTTCCACCAGGCtcTGTTaGATCCgAGGGTA
                t           ag a  a     t  ct ta    t  t  aa ct    g  c  c aa   
                c                                                        a      
                                                                                
                                                                                

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                             ***   * *  * *** **
AGGGCTCTGTAttTtCCTGCTGGTGGCTCCAGTTCAGaGACaCAGAACCCTGCTCCGACTATTGCCTCTCTCACATCATC
 a     ----cc-c                      ga  g  a       t             y    t        
          g-- -                                                                 
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**  *    **  ***** * ** **     * **  ** * **     **   ** **    **  ** * *   * * 
AATCTTCTcGAAGACTGGGGGCCCTGCtAtGAACATGGAcAACATCACATCAGGACTCCTAGGACCCCTGCTCGTGTTAC
   c  t         c  t   c c         g g  ctt         a    a                  
     a              a      a                                                    
                                                                                
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * ** *  *  **  *  * **   *** ** **  ***   *  **  *** ** ***** ***** ** ****** 
AGGCGGTGTGTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTA
         t  c      t        g  a   g    g                             g       
         c                                                                      
                                                                                
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *     * *   ***** ** ******  * * *********************** *****  *******  * ***
GGGGGActACCCGGGTGTCCTGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTTACCAACCTCCTGTCCTCCAACTTG
 a  a ac   a                                                                    
    c                                                                           
    r                                                                           
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** **  ***** * *  ** ** ** ***** ****** ******* *********** ******** ***********
TCCTGGCTATCGtTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGG
      t     c                                                                   
                                                                                
                                                                                
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
***** **** *     ***** ******** ***** *                             * *   **** *
TTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAcTTCCAGGATC------------cACGACC---ACCAGC
     g       c  g                        a                      tt a            
                                                                                
                                                                                
                                                                                

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** ***   ****   **** **  ** **** * *   ** * **** * ***** ** ** *** * * *** * ***
ACGGGACCaTGCAAAACCTGCACAACTCTTGCTCAAGGAACCTCTATGTTTCCCTCcTGtTGCTGTTCcAAACCcTCGGA
        c     g               a     c                 t  c  t   a a     t     
                                                        a           m     y     
                                                                                
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ***** ***** *********** ***** **   ** *** ***** * ********  ** * ****  ** ** **
CGGAAACTGCACtTGTATTCCCATCCCATCATCtTGGGCTTTAGGAAAATACCTATGGGAGTGGGCCTCAGCCCGTTTCT
            c                    c                                            
                                                                                
                                                                                
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * ***** ******* ***  *  ** ***** * **  * * ********* *** **** **     *    ****
CCTGGCTCAGTTTACTAGTGCAATTTGTTCAGTGGTGCGTAGGGCTTTCCCCCACTGTcTGGCTTTTAGTTATATGGATG
 t       a                              c             t   t              g      
 a       k                                                                      
                                                                                
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ************ ** *** **   *   * *  **  *  * **  *   * ** * *****  *  ****  **** 
ATCTGGTATTGGGGGCCAAATCTGTGCAGCATCTTGAGTCCCTTTATACCGCTGTTACCAATTTTCTGTTATCTGTGGGT
                         t  a                                    t        t     
                                                                                
                                                                                
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** *  * **  *  * ** ** **  * ***** **     *  * ** *****  *    ** **  ***  **  *
ATCCATTTaAATACcTCtAAAACAAAAAGATGGGGTTAcacccTAcATTTcATGGGTTATGTtATTGGcAGTTGGGGAtC
        g   g tg g     g  gc       c  ttatt ca    t         c             g 
                       t                 a                  a             a 
                                                                                
                                                                                

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** ** **  * ** ***   *  **  * *     *   *    *** * *****    ** **  * ** ***** *
aTTACCcCAAGATCAtATTGTACAcAAAATCAAAGAtTGTTTTcGtAAACTTCCTGTAAATCGtCCaATTGAtTGGAAAG
g  g  a        c   a t  a  gc   rg  a  c   a a     g           c   a  c       
      t                             c        g                 a              
                                                                                
                                                                                

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ** **  *  * ** **  *  ***  ***** ** *  *   * ***** ** ** **************  *  * 
TTTGTCAaCGcATTGTGGGtCTTTTGGGCTTTGCcGCcCCtTTtACcCAATGTGGTTATCCTGCTCTCATGCCTcTGTAT
 c  c    a                  t  t  c  c  t     c                     t  c
 a                                g           a                                 
                                  a                                             
                                                                                

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   ** ** *  ** **  * ** ***** ** ****  ** ** **  ***** *       ** ***    *******
gCCTGTATaACTGCtAAACAGGCTTTTGTCTTTTCGCCAACTTACAAGGCCTTTCTcTGTaAACAaTACATGAACCTTTA
aat     t  c  g        g     t  c        c      a       a   c    g      c       
        c              c                 a              g                       
                                                                                
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*** ***    ******** * *** * ***************** ** ** ****  ** ****** * *   * ** *
CCCCGTTGCTCGGCAACGGCCAGGCCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCTTGGCCATTGGCC
         ca          g                       t              c                   
                                                                                
                                                                                
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* ******  *** *   *****  ******  * ******* * * ** **  **   *  ** ** ** *** ** * 
ATCAGCGCATGCGTGGAACCTTTGTGGCTCCTCTGCCGATCCATACTGCGGAACTCCTTGCAGCtTGTTTCGCTCGCAGC
                                  a              a        a     c  c            
                                                                                
                                                                                
                                                                                

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *** ***  *     * *  ** ** *     ** *  *  **  *  * ** ** *  ** ** *********** **
CGGTCTGGAGCGAaacTcATCGGcACaGACAAcTCTGTTGTCCTCTCTaGGAAGTACACCTCCTTcCCATGGCTGCTCGG
a          agcta t     g  g     t     c  a     cc                t              
              cg                                m                               
                                                                                
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **  **** ** ***** **  * ** ****  ***** ***** ** ** * ********* ******** ** **  
tTGTGCTGCcAACTGGATCCTgCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCcGCGGACGAcCCCTCcC
a        a                                    a  a           a        t  t  
g                                                              t                
c                                                                               
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** **  * **  * *  ** **     * * **  * ***    ** ** ***** *    ******** ***** *
GGGGtCGCTTGGGGcTgTAcCGCCCcCTTCTcCGTCTGCcGTTCCAGCCGACgACGGGTCGCACCTCTCTTTACGCGGaC
    c  tc a  ag c tt     t     g     a t     g   a  c                         c 
                a              t                    a                         t 
                                                                                
                                                                                

      2490      2500      2510      2520      2530      2540      2550        
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:...
 * **   *** *** * *    ****   ************ ***************     **** ** *** ***
TCCCCGTCTGTTCCTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAGACCACCGTGA
           g       g        t                             a a      a          
                                                                              
                                                                              
                                                                              
© 1998-2022Legal notice