HBVdb

Dataset for nucleotide sequence P of genotype F

[Download (right click)] [Edit] [Sequences] [Repertoires]

277 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


JN792921_P_P-F      atgcccctatcytatccacacttccggaaactactattattagacga------cgaggca
KJ638660_P_P-F      atgcccctatcctatccacacttccggaaactgctgttgttagacga------cgaggca
KJ638662_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ638663_P_P-F      atgcccctatcttatccacacttccggaaactgctgttgttagacga------cgagtca
KJ638664_P_P-F      atgcccctatcttatccacacttccggaaacaagggttattagacga------cgaggca
KX757665_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AY090461_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AY090459_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KP718104_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KP718113_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AY090456_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AY090458_P_C-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------agaggca
KP718107_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ638657_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ638656_P_P-F      atgcccctatcttatccacacttccggaaacgactgttgttagacga------cgaggca
AB116654_P_P-F      atgcccctatcttatccacacttccggagactactgttgttagagga------cgacgca
KP718110_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY476324_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------agaggca
KY476329_P_P-F      atgcccctatcttatccacacttccggaagctactgttgttagacga------cgaggca
KY476327_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------agaggca
KY382415_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY382417_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY382416_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ657525_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagagga------cgaggca
AB086397_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgc------cgaggca
KY476330_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ586807_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KP995116_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY476325_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY476328_P_P-F      atgcccctatcttatccacacttccggaaactactgttrttagacga------cgaggca
HM590474_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585186_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM590471_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM590472_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KM233681_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
EU670262_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JX079936_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843177_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843178_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KC494400_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KF779236_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacgacgggaccgaggca
FJ709462_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AB064316_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KF199901_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ709457_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
MK058437_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM622135_P_P-F      atgcccctatcttatccacacttccggaaattactgttgttagacga------cgaggca
KJ843202_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KC494404_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585192_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
EU366133_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843169_P_P-F      atgcccctatcttatccacacttccggaaactgctgttgttagacga------cgaggca
FJ709465_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585198_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585195_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ709459_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ709458_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585191_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HE981182_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HE981183_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843171_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585196_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585189_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585187_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ709494_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585190_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585199_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585188_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM590473_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
DQ823091_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AF223963_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843168_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843170_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN688691_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN688699_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN688703_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY458062_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KP995098_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843194_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843193_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ586808_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ709463_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585193_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AB116552_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AF223964_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843197_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843205_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843204_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843203_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843180_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843174_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843164_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
AY179735_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843181_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843179_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ709460_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843167_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843196_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843199_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843195_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843200_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KM998715_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY458061_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843163_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585197_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
DQ823094_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
DQ823095_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
DQ823092_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
EU366118_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ657529_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843198_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843201_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843206_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843176_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
DQ823093_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
FJ709464_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HQ378247_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KJ843190_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KX264496_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM627320_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585194_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
HM585200_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY476331_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------agaggca
KY476323_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN792916_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN792922_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN792919_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY476322_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KY476332_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN792918_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN792920_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN792914_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
JN792917_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
X75663_P_P-F        atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995118_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995111_P_P-F      atgcccctatcctatcaacacttccggaaactactgttgttagacga------cgaggca
KP995101_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagagga------cgaggca
KP718106_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995105_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
FJ589067_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
FJ589066_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacca------cgaggca
KP995117_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
KP718103_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AB036908_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036913_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036915_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036914_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036906_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036907_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036920_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036919_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036916_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036917_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036918_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036911_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036905_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036909_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
AB036912_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
KX264498_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
KP995106_P_P-F      atgcccctatcctatccacacttccggaaactactgttattagacga------cgaggca
DQ899150_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995123_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995125_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP718111_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995119_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ899148_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AB116550_P_P-F      atgcccctatcctatccacacttccggaaactactgttattagacga------cgaggca
AY311370_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995124_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995126_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AB116549_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ638659_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ899149_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MH051986_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
MH051987_P_P-F      atgcccctatcttatccacacttccggaaactactgttgttagacga------cgaggca
KP995109_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AB036910_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AB116551_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP718109_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP718112_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ899147_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ899146_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ899144_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ899145_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995114_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995097_P_P-F      atgcccctatcctatcaatgcttccggaagttgctgttgttagacga------cgaggca
KP995115_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ899142_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ899143_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995113_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995104_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494399_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AY311369_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995107_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AY090455_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494396_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KT896494_P_P-F      atgcccctatcctatccacacttccggaaactactattgttagacga------cgaggca
KP995110_P_P-F      atgcccctatcctatcaacacttccggaaactactgttgttagacga------cgaggca
KJ843191_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KP995120_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494397_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494401_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------ccaggca
KC494394_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
X69798_P_P-F        atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494402_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KX264497_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494395_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494403_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494405_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
JQ272888_P_P-F      atgcccctatcctatccacacttccggaaactgctgttattagacga------cgaggca
MG098578_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagagga------cgaggca
KY476326_P_P-F      atgcccctatcctatccacacttccggaaactgctgttgttagagga------cgaggcr
JN688720_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MG098579_P_P-F      atgcccctatcctatccacacttccggaarttactgttgttagacga------cgaggca
MG098577_P_P-F      atgcccctatcctatccacacttccggaaactactgttattagacga------cgaggca
KJ843225_P_P-F      atgcccctatcctatccacacttccggaaattactgttgttagacaa------cgacgca
MG098582_P_P-F      atgcccttatcctatccacacttccggaaactactgttgttagacga------cgaggca
EF576808_P_P-F      atgcccctatcctatccacacttccggaaactactgttattagacga------cgaggca
X75658_P_C-F        atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MG098570_P_P-F      atgcccctatcctatccacacttccggaaactactggtgttagacga------cgaggca
AB365453_P_P-F      atgcccctatcctatccacacttcctgaaactactgttgttagacca------cgaggca
JN688709_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AB166850_P_P-F      atgcccctatcctatccatacttccggaaactactgttgttagacga------cgaggca
AB214516_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MG098565_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MG098583_P_P-F      atgcccctatcctatccacacttccggaaacttctgttattagacga------cgaggca
MG098569_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MG098575_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacat------cgaggca
MG098574_P_P-F      atgcccctatcctatccacacttccggaaactactgttattagacga------cgaggca
MG098573_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MG098566_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
EU366132_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AB365449_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843185_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MG098580_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843226_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AB365450_P_P-F      atgcccctatcctatccacacttccggaaactactgttrttagacga------cgaggca
AB365446_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ823086_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843223_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843209_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AF223965_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
EF576812_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843175_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843189_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ823089_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
JN811655_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
MG098564_P_P-F      atgcccttatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ823088_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
JN688701_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843211_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
FJ657528_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843224_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843212_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843219_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843221_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843222_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KY382411_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843207_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
AF223962_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ823087_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
JN811656_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
JX079937_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843220_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ823090_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
FJ657522_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843213_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
FJ657519_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
DQ776247_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843208_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ843210_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
EU366116_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KX264499_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
HE981181_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KC494398_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------cgaggca
KJ676694_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
MG098584_P_P-F      atgcccctatcctatccacacttccggaaactactgttgttagacga------agaggca
                    ****** **** **** *  ***** **         * *****           *  * 

JN792921_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ638660_P_P-F      ggtcccctagaagtagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcc
KJ638662_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcc
KJ638663_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ638664_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KX757665_P_P-F      ggtcccctmgaagaagaactccctcgcctcgcmgacgaaggtctcaatcgccgcgtcgca
AY090461_P_P-F      ggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AY090459_P_P-F      ggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KP718104_P_P-F      ggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KP718113_P_P-F      ggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AY090456_P_P-F      ggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AY090458_P_C-F      ggtctcctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KP718107_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcaccgcgtcgca
KJ638657_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ638656_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AB116654_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KP718110_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476324_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476329_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476327_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY382415_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY382417_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY382416_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ657525_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AB086397_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctaaatcgccgcgtcgca
KY476330_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ586807_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KP995116_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476325_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476328_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM590474_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585186_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM590471_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM590472_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KM233681_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
EU670262_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JX079936_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843177_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843178_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KC494400_P_P-F      ggtctcctcgaagaagaactccctcgcctcgcagacgaagttctcaatcgccgcgtcgca
KF779236_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709462_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AB064316_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KF199901_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709457_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MK058437_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM622135_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843202_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KC494404_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585192_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
EU366133_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843169_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709465_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585198_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585195_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709459_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709458_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585191_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HE981182_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HE981183_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843171_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585196_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585189_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585187_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709494_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585190_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585199_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585188_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM590473_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823091_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AF223963_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843168_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843170_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN688691_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN688699_P_P-F      ggtcccctngaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN688703_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY458062_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KP995098_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843194_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843193_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ586808_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709463_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585193_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AB116552_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AF223964_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843197_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843205_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843204_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843203_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843180_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843174_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843164_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AY179735_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843181_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843179_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709460_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843167_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843196_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843199_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843195_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843200_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KM998715_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY458061_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843163_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585197_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823094_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823095_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823092_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
EU366118_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ657529_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843198_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843201_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843206_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843176_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823093_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ709464_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HQ378247_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843190_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KX264496_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM627320_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585194_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HM585200_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476331_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476323_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN792916_P_P-F      ggtcccctcgaagaagaactcccacgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN792922_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN792919_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476322_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476332_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN792918_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN792920_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN792914_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN792917_P_P-F      ggtcccctcgaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
X75663_P_P-F        ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
KP995118_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
KP995111_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
KP995101_P_P-F      gggcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtggca
KP718106_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
KP995105_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
FJ589067_P_P-F      ggtcccctggaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
FJ589066_P_P-F      ggacccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgggtcgca
KP995117_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
KP718103_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
AB036908_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036913_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036915_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036914_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036906_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036907_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036920_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036919_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036916_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036917_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036918_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036911_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036905_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036909_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AB036912_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
KX264498_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
KP995106_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
DQ899150_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaattgccgcgtcgca
KP995123_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
KP995125_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
KP718111_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
KP995119_P_P-F      ggacccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
DQ899148_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
AB116550_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
AY311370_P_P-F      ggtcccctagaagaagaactccctcgcgtcgccgacgaaggtctcaatcgccgcgtcgca
KP995124_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
KP995126_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
AB116549_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
KJ638659_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaagatctcaatcgccgcgtcgca
DQ899149_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatggccgcgtcgca
MH051986_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
MH051987_P_P-F      ggtcccctagaagaagaactccctcgcctggcggacgaaggtctcaatcgccgcgtcgca
KP995109_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
AB036910_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
AB116551_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
KP718109_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
KP718112_P_P-F      ggtcccctagaagaagaactccctcgcctcgccgacgaaggtctcaatcgccgcgtcgca
DQ899147_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
DQ899146_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
DQ899144_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
DQ899145_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KP995114_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KP995097_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KP995115_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
DQ899142_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
DQ899143_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KP995113_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KP995104_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KC494399_P_P-F      ggacccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
AY311369_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KP995107_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
AY090455_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KC494396_P_P-F      ggacccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KT896494_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KP995110_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KJ843191_P_P-F      ggtcccctagaagaagaactccctcgcctcgcaracgaagatctcaatcgccgcgtcgcc
KP995120_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KC494397_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcc
KC494401_P_P-F      ggtcccctagaaaaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KC494394_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcc
X69798_P_P-F        ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KC494402_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KX264497_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgcc
KC494395_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcc
KC494403_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcc
KC494405_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcaccgcgtcgcc
JQ272888_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098578_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KY476326_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN688720_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098579_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098577_P_P-F      ggtcccctagaagaagaactccctcgcctcgaaaacgaaggtctcaatcgccgcgtcgca
KJ843225_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098582_P_P-F      ggtcccctagaagaagaactccctcgcctcggaaacgaaggtctcaatcgccgcgtcgca
EF576808_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
X75658_P_C-F        ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098570_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AB365453_P_P-F      ggacccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
JN688709_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AB166850_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AB214516_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098565_P_P-F      ggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgca
MG098583_P_P-F      ggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgca
MG098569_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098575_P_P-F      ggtccactagaagaagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtctca
MG098574_P_P-F      ggtcccctagaagaagaactccctcgcctcgcaaacgaaggtctcaatcgccgcgtcgca
MG098573_P_P-F      ggtcccctagaagaagaactccctcgcctcgaagacgaaggtctcaatcgccgcgtcgca
MG098566_P_P-F      ggtcccctagaagaagaactccctcgcctcgcacacgaaggtctcaatcgccgcgtcgca
EU366132_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
AB365449_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843185_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098580_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843226_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AB365450_P_P-F      ggtcccctagaagaagaactccctcgcctcgcmgacgaaggtctcaatcgccgcgtcgca
AB365446_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823086_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843223_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843209_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AF223965_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
EF576812_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843175_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843189_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823089_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN811655_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
MG098564_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
DQ823088_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
JN688701_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KJ843211_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
FJ657528_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KJ843224_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KJ843212_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KJ843219_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KJ843221_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KJ843222_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KY382411_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
KJ843207_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
AF223962_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823087_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
JN811656_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaagatctcaatcgccgcgtcgca
JX079937_P_P-F      ggtcccstagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843220_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ823090_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ657522_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843213_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
FJ657519_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
DQ776247_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843208_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ843210_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
EU366116_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KX264499_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
HE981181_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KC494398_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
KJ676694_P_P-F      ggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca
MG098584_P_P-F      ggtcccctaaaacaagaactccctcgcctcgcaracgaaggtctcaatcgccgcgccgca
                    ** *   *  **  ********* *** * *   ****** *** ***  *** *   * 

JN792921_P_P-F      gaagatctcaatctccggcttcccgatgttagtattccttggactcatarggtgggraac
KJ638660_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ638662_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ638663_P_P-F      gaagatctcaatctccagattcccgatgttagtattccttggactcataaggtgggaaac
KJ638664_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggacacataaggtgggaaac
KX757665_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
AY090461_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
AY090459_P_P-F      gaagatctcaatctccagcttccccatgttagtattccttggactcataaggtgggaaac
KP718104_P_P-F      gaagatctcaatctccagctccccaatgttagtattccttggactcataaggtgggaaac
KP718113_P_P-F      gaagatctcaatctccagctccccaatgttagtattccttggactcataaggtgggaaac
AY090456_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
AY090458_P_C-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KP718107_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KJ638657_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KJ638656_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccgaggactcataaggtgggaaac
AB116654_P_P-F      gaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaac
KP718110_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KY476324_P_P-F      gaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaac
KY476329_P_P-F      gaagatctcaatctccagcttccaaatgttagtattccttggactcataaggtgggaaac
KY476327_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KY382415_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
KY382417_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
KY382416_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
FJ657525_P_P-F      gaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaat
AB086397_P_P-F      gaagatctcaatctccatcttcccaatgttagtattccttggactcataaggtgggaaac
KY476330_P_P-F      gaagatctcaatctccaggttcccgatgttagtattccttggactcataaggtgggaaac
KJ586807_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995116_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KY476325_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KY476328_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
HM590474_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
HM585186_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
HM590471_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
HM590472_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KM233681_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
EU670262_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JX079936_P_P-F      gaagatctcaatctccaccttcccactgttagtattccttggactcataaggagggaaas
KJ843177_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KJ843178_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KC494400_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KF779236_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709462_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB064316_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KF199901_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709457_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MK058437_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM622135_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843202_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KC494404_P_P-F      aaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585192_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
EU366133_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843169_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709465_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585198_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585195_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709459_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709458_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585191_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HE981182_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HE981183_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843171_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585196_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585189_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585187_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709494_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585190_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585199_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585188_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM590473_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ823091_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AF223963_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843168_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843170_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
JN688691_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
JN688699_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
JN688703_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KY458062_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995098_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843194_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843193_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ586808_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709463_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585193_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB116552_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AF223964_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843197_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843205_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843204_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843203_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843180_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843174_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843164_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AY179735_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843181_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843179_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709460_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843167_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
KJ843196_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843199_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843195_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843200_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KM998715_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KY458061_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcayaaggtgggaaat
KJ843163_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM585197_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ823094_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ823095_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ823092_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
EU366118_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ657529_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843198_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843201_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843206_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843176_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ823093_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ709464_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HQ378247_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843190_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KX264496_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HM627320_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
HM585194_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
HM585200_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KY476331_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KY476323_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JN792916_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JN792922_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JN792919_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggacacataaggtgggaaac
KY476322_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KY476332_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JN792918_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JN792920_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JN792914_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JN792917_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
X75663_P_P-F        gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995118_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995111_P_P-F      gaagatctcaatctccagcttcccgatgttaatattccttggactcataaggtgggaaat
KP995101_P_P-F      gaagatctcaatctccgtcttcccgatgttagtattccttggactcataaggtgggaaat
KP718106_P_P-F      gaagatctcaatctccagcttcccratgttagtattccttggactcataaggtgggaaat
KP995105_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ589067_P_P-F      gaagatctcaatctccagcttcccgatgttagtattccttatcctcntctcatgggcmmt
FJ589066_P_P-F      gaagatctcaatctccatcttcccaatgttagtattccttggactcataaggtgggaaat
KP995117_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP718103_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036908_P_P-F      gaagatctcaatctccagcttccaaatgttagtattccttggactcataaggtgggaaat
AB036913_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036915_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036914_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036906_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036907_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036920_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036919_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036916_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036917_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036918_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036911_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036905_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036909_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036912_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KX264498_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995106_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ899150_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995123_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995125_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP718111_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995119_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ899148_P_P-F      gaagatctcaatctccagcttcccaatgttagtatcccttggactcataaggtgggaaat
AB116550_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AY311370_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995124_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccgtggactcataaggtgggaaat
KP995126_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB116549_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ638659_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ899149_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MH051986_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MH051987_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995109_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB036910_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB116551_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP718109_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP718112_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ899147_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ899146_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ899144_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ899145_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KP995114_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KP995097_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaagt
KP995115_P_P-F      gcagatctcaatctccatcttcccgatgttagtattccttggactcataaggtgggaaac
DQ899142_P_P-F      gccgatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
DQ899143_P_P-F      gccgatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KP995113_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KP995104_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KC494399_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
AY311369_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KP995107_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
AY090455_P_P-F      gcagatctcaatctccaggttcccaatgttagtattccttggactcataaggtgggaaac
KC494396_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcacaaggtgggaaac
KT896494_P_P-F      gaagatctaaatctccatcttcccaatgttagtattccttggactcataaggtgggaaac
KP995110_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KJ843191_P_P-F      gcaratctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaac
KP995120_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KC494397_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KC494401_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KC494394_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
X69798_P_P-F        gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KC494402_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KX264497_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KC494395_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KC494403_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
KC494405_P_P-F      gcagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JQ272888_P_P-F      gaagatctcaatctccatcttcccgatgttagtattccttggactcataaggtgggaaat
MG098578_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KY476326_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
JN688720_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MG098579_P_P-F      aaagatctcaatctccagcttcccactgttagtattccttggactcataaggtgggaaat
MG098577_P_P-F      aaaaatctcaatctccagcttcccaatgttagtattccttggactcataaggggggaaat
KJ843225_P_P-F      gaagatctcaatctccatcttcccaatgttagtattccttggactcataaggtgggagat
MG098582_P_P-F      aaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
EF576808_P_P-F      gaagatctcaatctccggcttcccaatgttagtattccttggactcatagggtgggaaat
X75658_P_C-F        gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MG098570_P_P-F      aaagatctcaatctccagcttcccactgttagtattccttggactcataaggtgggaaat
AB365453_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaac
JN688709_P_P-F      gaagatctcaatctccatcttcccaatgttagtattccttggactcataaggtgggaaat
AB166850_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB214516_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MG098565_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggggggaaat
MG098583_P_P-F      gaagatctcaatctccagcttcccgatgttagtattccttggacgcataaggtgggaaat
MG098569_P_P-F      gaagatctcaatctccatcttcccgatgttagtattccttggactcataaggtgggaaat
MG098575_P_P-F      aaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MG098574_P_P-F      aaagatctcaatctccagcttcccaatgttagtattccttggactcataaggggggaaat
MG098573_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggggggaaat
MG098566_P_P-F      gaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaat
EU366132_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB365449_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843185_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MG098580_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843226_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB365450_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AB365446_P_P-F      gaagatctcaatctccagcttcccactgttagtattccttggactcataaggtgggaaat
DQ823086_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843223_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843209_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
AF223965_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
EF576812_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843175_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843189_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ823089_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
JN811655_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
MG098564_P_P-F      aaagatctcaatctccagcttcccaatgttagtattccttggactcataaggggggaaat
DQ823088_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
JN688701_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843211_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ657528_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843224_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843212_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843219_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843221_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843222_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KY382411_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843207_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
AF223962_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ823087_P_P-F      gaagatctcaatctccagcttcccgatgttagtattccttggactcataaggtgggaaat
JN811656_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
JX079937_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843220_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggkgggaaat
DQ823090_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ657522_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843213_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
FJ657519_P_P-F      aaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
DQ776247_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843208_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ843210_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
EU366116_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KX264499_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
HE981181_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KC494398_P_P-F      gaagatctcaatctccagcttcccaatgttagtattccttggactcataaggtgggaaat
KJ676694_P_P-F      gaagatctcaatctccagcttcccgatgttagtattccttggactcacaaggtgggaaat
MG098584_P_P-F      aaagatctcaatctccagcttcccactgttagtattccttggactcacaaggtgggaaat
                        **** *******   * **   ***** *** **     * *       ***    

JN792921_P_P-F      tttackggrctytaytcytctactgtkcctrcttttaatcctractggtymactccttct
KJ638660_P_P-F      tttacggggctctattctgctactgtacctactttcaatcctaactggttgactccgtct
KJ638662_P_P-F      tttacggggctctattctgctactgtacctactttcaatcctaactggttgactccgtct
KJ638663_P_P-F      tttacaggactctattcctctactgttcctacttttaattctgactggttaaccccttct
KJ638664_P_P-F      tttacgggactctattcctctactgttcctacttttaatgctgactggttaactccttct
KX757665_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
AY090461_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
AY090459_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctaactggttaactccttct
KP718104_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactgtttaactccttct
KP718113_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
AY090456_P_P-F      tttacgggactttattcctctactgttcctacttttaatcctgactggttaactccttct
AY090458_P_C-F      tttacgggactttattcctctactgttcctacttttaatcctgactggttaactccttct
KP718107_P_P-F      tttacgggactttattcctctactgttcctacttttaattctgactgggtaactccttct
KJ638657_P_P-F      tttacgggactctattcctctactgttcctacttttaattctgactggttaactccttct
KJ638656_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
AB116654_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KP718110_P_P-F      tttacgggactctattcctctactgttcctacttttaattctgactggttaactccttct
KY476324_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgaatggttaactccttct
KY476329_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgaatggttaactccttct
KY476327_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgattggttaactccttct
KY382415_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY382417_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY382416_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ657525_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgattggttaactccttct
AB086397_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY476330_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ586807_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KP995116_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY476325_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY476328_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM590474_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585186_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM590471_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM590472_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KM233681_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
EU670262_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JX079936_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843177_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843178_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KC494400_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KF779236_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709462_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
AB064316_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KF199901_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709457_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
MK058437_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM622135_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843202_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KC494404_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585192_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
EU366133_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843169_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709465_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585198_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585195_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709459_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709458_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585191_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HE981182_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HE981183_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843171_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585196_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585189_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585187_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709494_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctaactggttaactccttct
HM585190_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctaactggttaactccttct
HM585199_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctaactggttaactccttct
HM585188_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM590473_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
DQ823091_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
AF223963_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843168_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843170_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN688691_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN688699_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN688703_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY458062_P_P-F      tttacgggactctattcctctactgttcctactttcaatcctgactggttaactccttct
KP995098_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843194_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843193_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ586808_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709463_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585193_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
AB116552_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
AF223964_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843197_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843205_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843204_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843203_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843180_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccgtct
KJ843174_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843164_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactcctgct
AY179735_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843181_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843179_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709460_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactgggtaactccttct
KJ843167_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843196_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843199_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843195_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843200_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KM998715_P_P-F      tttacgggactctattcctctactgttcctactttcaatcctgactggttaactccttct
KY458061_P_P-F      tttacgggactctattcctctactgttcctactttcaatcctgactggttaactccttct
KJ843163_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585197_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
DQ823094_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
DQ823095_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
DQ823092_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
EU366118_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ657529_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843198_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843201_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843206_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843176_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
DQ823093_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
FJ709464_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HQ378247_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KJ843190_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KX264496_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM627320_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585194_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
HM585200_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY476331_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY476323_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN792916_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN792922_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN792919_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY476322_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
KY476332_P_P-F      tttacgggactctattcctctactgttcctaccttcaatcctgactggttaactccttct
JN792918_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN792920_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN792914_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
JN792917_P_P-F      tttacgggactctattcctctactgttcctacttttaatcctgactggttaactccttct
X75663_P_P-F        tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995118_P_P-F      tttacggggctctactcttctactgtacctgcttttaatcctaactggttaactccttct
KP995111_P_P-F      tttacggggctctactcttctactgtaccggttttcaatcctaactgggtaactccttgt
KP995101_P_P-F      tttacggggctctactcttctactgtacctgcttttaatcctaactgggtaactccttct
KP718106_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995105_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactgggtgactccttct
FJ589067_P_P-F      tgtacgggcctgtactcttctactgtacctgctttcaatcctaactggttaactccttct
FJ589066_P_P-F      tttacggggctctactcttctactgtacctactttcaatcctaactggttaactccttct
KP995117_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP718103_P_P-F      tttacgggactctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036908_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036913_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036915_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036914_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036906_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036907_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036920_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036919_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036916_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036917_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036918_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036911_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036905_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036909_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036912_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KX264498_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995106_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
DQ899150_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995123_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995125_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP718111_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995119_P_P-F      tttacggggctctactcttctactgtacctgcgttcaatcctaactggttaactccttct
DQ899148_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB116550_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AY311370_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995124_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995126_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB116549_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KJ638659_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
DQ899149_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
MH051986_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
MH051987_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP995109_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB036910_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
AB116551_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP718109_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KP718112_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
DQ899147_P_P-F      tttacggggctttattcttctactgtgcctgcttttaatcctaactggttaactccttct
DQ899146_P_P-F      tttacggggctttattcttctactgtgcctgcttttaatcctaactggttaactccttct
DQ899144_P_P-F      tttacggggctttattcttctactgtgcctgcttttaatcctaactggttaactccttct
DQ899145_P_P-F      tttacggggctttattcttctactgtgcctgcttttaatcctaactggttaactccttct
KP995114_P_P-F      tttacggggctttactcttctactgttcctgcttttaatcctaactgggccactccttct
KP995097_P_P-F      tttacggggctttactcttctactgtgcctgcctttaatcctgactggtccattccttct
KP995115_P_P-F      tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttct
DQ899142_P_P-F      tttacggggctttactcttctactgggcctgctttcaatcctaactggtccactccttct
DQ899143_P_P-F      tttacggggctttactcttctactgtgcctgctttcaatcctaactggtccactccttct
KP995113_P_P-F      tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttct
KP995104_P_P-F      tttacggggctttactcttctactgttcctgcttttaatcctaactggtctactccttct
KC494399_P_P-F      tttacggggctttactcttctactgtgcctgtttttaatcctaattggtccactccttct
AY311369_P_P-F      tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttct
KP995107_P_P-F      tttacggggctttactcttctactgttcctacttttaatcctaactggtccactccttct
AY090455_P_P-F      tttacggggctttactcctctactgttcctgcttttaatcctaactggtccactccttct
KC494396_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttct
KT896494_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttct
KP995110_P_P-F      tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttct
KJ843191_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaattggtccactccttct
KP995120_P_P-F      tttacggggctttactcttctactgttcctgcttttaatcctaactggtccactccttct
KC494397_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttct
KC494401_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttct
KC494394_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactcccttt
X69798_P_P-F        tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttct
KC494402_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttct
KX264497_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttct
KC494395_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccactccttct
KC494403_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtctactccttct
KC494405_P_P-F      tttacggggctttactcttctactgtgcctgcttttaatcctaactggtccacgccttct
JQ272888_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098578_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KY476326_P_P-F      tttacggggctctactcttctactgtacctgcttttaatcctaactggttaactccttct
JN688720_P_P-F      tttacggggctttactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098579_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098577_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843225_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098582_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
EF576808_P_P-F      tttacggggctctactcttctactgtacctactttcaatcctcactggttaactccttct
X75658_P_C-F        tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098570_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
AB365453_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
JN688709_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactgggaaactccttct
AB166850_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
AB214516_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098565_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098583_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098569_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098575_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098574_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098573_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctgactggttaactccttct
MG098566_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
EU366132_P_P-F      tttacggggctctactcttctactgtaccttctttcaatcctcattggttaactcctcat
AB365449_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843185_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
MG098580_P_P-F      tttacggggctttactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843226_P_P-F      ttcacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
AB365450_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
AB365446_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
DQ823086_P_P-F      tttacagggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843223_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843209_P_P-F      tttacagggctctactcttctactgtacctgctttcaatcctcactgggtaactccttct
AF223965_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
EF576812_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843175_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
KJ843189_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctaactggttaactccttct
DQ823089_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactgggtaactccttct
JN811655_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
MG098564_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
DQ823088_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
JN688701_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843211_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
FJ657528_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttgactccttct
KJ843224_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttgactccttct
KJ843212_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843219_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843221_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843222_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KY382411_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843207_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
AF223962_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
DQ823087_P_P-F      tttacggggctctactcttctactgtacctgcttacaatcctcactggttaactccttct
JN811656_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
JX079937_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843220_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
DQ823090_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactgggtaactccttct
FJ657522_P_P-F      tttacggggctytactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843213_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
FJ657519_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
DQ776247_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843208_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ843210_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
EU366116_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KX264499_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
HE981181_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KC494398_P_P-F      tttacggggctctactcttctactgtacctgctttcaatcctcactggttaactccttct
KJ676694_P_P-F      tttacgggactctattcttctactgtacctgctttcaatcctaactggttaactccttct
MG098584_P_P-F      tttacgggactctattcttctactgtacctgctttcaatcctaactggttaactccttct
                    *  ** ** ** ** **  ******  **    *  *** ** * **    *  **   *

JN792921_P_P-F      tttcctgayattcatttrcatcaagayytgatwymyaaatgtgaacaatttgtaggcccw
KJ638660_P_P-F      tttcctgatattcacttgcatcaagaccttatatctaagtgtgaacaatttgtgggtcca
KJ638662_P_P-F      tttcctgatattcacttgcatcaagaccttatatctaaatgtgaacaatttgtgggtcca
KJ638663_P_P-F      tttcctgacattcatttacatgaagatttgatacacaaatgtgaacaatttgtaggccct
KJ638664_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatgtgtaggccct
KX757665_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
AY090461_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
AY090459_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KP718104_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaattcgtaggccct
KP718113_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaattcgtaggccct
AY090456_P_P-F      tttcctgatattcatttacatcaagatttaatacacaaatgtgaacaatttgtaggccct
AY090458_P_C-F      tttcctaatattcatttacatcaagatttgataaacaaatgtgaacaatttgtaggccct
KP718107_P_P-F      tttcctgacattcatttacatgaagatttgatacacaaatgtgaacaatttgtaggccct
KJ638657_P_P-F      tttcctgacattcatttacatsaagatttgatacacaaatgtgaacaatttgtaggccct
KJ638656_P_P-F      tttcctgacattcatttacatcaggatttgatacacaaatgtgaacaatttgtaggccct
AB116654_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KP718110_P_P-F      tttcctgacattcatttacatgaagatttgatacagaaatgtgaacaatttgtaggccct
KY476324_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY476329_P_P-F      tttcctgacattcatttacatgaagatttgatacacaaatgtgaacaatttgtaggccct
KY476327_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY382415_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY382417_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY382416_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ657525_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
AB086397_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY476330_P_P-F      tttcctgacattcatttacatcaagatttgatacataaatgtgaacaatttgtaggccct
KJ586807_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KP995116_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY476325_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY476328_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM590474_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggcccg
HM585186_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggcccg
HM590471_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggcccg
HM590472_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggcccg
KM233681_P_P-F      tttcctgatattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggcccg
EU670262_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
JX079936_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843177_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843178_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KC494400_P_P-F      tttcctgacattcatttacatcaagatttgatacaaaaatgtgaacaatttgtaggccct
KF779236_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709462_P_P-F      tttcctgacattcatttacatsaagatttgatacacaaatgtgaacaatttgtaggccct
AB064316_P_P-F      tttcctgacattcatttacatgaagatttgatacacaaatgtgaacaatttgtagggcct
KF199901_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709457_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
MK058437_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM622135_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843202_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KC494404_P_P-F      tttcctgacattcatttacatcaaaatttgatacaaaaatgtgaacaatttgtaggccct
HM585192_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
EU366133_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843169_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709465_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585198_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585195_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709459_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709458_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585191_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HE981182_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HE981183_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843171_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585196_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585189_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585187_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709494_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585190_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585199_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585188_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM590473_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
DQ823091_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
AF223963_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843168_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843170_P_P-F      tttcctgacattcatttacatcaagatttgatacaaaaatgtgaacaatttgtaggccct
JN688691_P_P-F      tttcctgacattcatttacatcaagatttgatacaaaaatgtgaacaatttgtaggccct
JN688699_P_P-F      tttcctgacattcatttacatcaagatttgatacaaaaatgtgaacaatttgtaggccct
JN688703_P_P-F      tttcctgacattcatttacatcaagatttgatacaaaaatgtgaacaatttgtaggccct
KY458062_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KP995098_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843194_P_P-F      tttcctgacattcatttacatcaagatttgatacaaaaatgtgaacaatttgtaggccct
KJ843193_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ586808_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709463_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585193_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
AB116552_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
AF223964_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843197_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843205_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843204_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843203_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843180_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843174_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843164_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
AY179735_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843181_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843179_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709460_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843167_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843196_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843199_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843195_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843200_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KM998715_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY458061_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843163_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585197_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
DQ823094_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
DQ823095_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
DQ823092_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
EU366118_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ657529_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843198_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843201_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843206_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843176_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
DQ823093_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
FJ709464_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HQ378247_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KJ843190_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KX264496_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM627320_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585194_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
HM585200_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY476331_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY476323_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggtcct
JN792916_P_P-F      tttcctgacattcatttacatgaagatttgatacacaaatgtgaacaatttgtaggccct
JN792922_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
JN792919_P_P-F      tttcctgacattcatttacatcaagatttaatacacaaatgtgaacaatttgtaggccct
KY476322_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
KY476332_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
JN792918_P_P-F      tttcctgacattcatttacatgaagatttgatacacaaatgtgaacaatttgtaggccct
JN792920_P_P-F      tttcctgacattcatttacatcaagatttgatacacaaatgtgaacaatttgtaggccct
JN792914_P_P-F      tttcctgacattcatttacatgaagatttgatacacaaatgtgaacaatttgtaggccct
JN792917_P_P-F      tttcctgacattcatttacatgaagatttgatacacaaatgtgaacaatttgtaggccct
X75663_P_P-F        tttcctgatattcatttacatcaggatatgatatctaaatgtgaacaatttgtaggcccg
KP995118_P_P-F      tttcctgatattcatttacaccaagatctgatatctaaatgtgaacaatttgtaggcccg
KP995111_P_P-F      tttcctaatattcatttacaccaagatctgatatctaaatgtgaacaatttgtaggcccg
KP995101_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KP718106_P_P-F      tttcctgatattcatttacatcaagagctgatatctaaatgtgaacaatttgtaggcccg
KP995105_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
FJ589067_P_P-F      tttcctgatattcatttacatcaggatatgatatctaaatgtgaacaatttgtaggcccg
FJ589066_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggccca
KP995117_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KP718103_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036908_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036913_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036915_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036914_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036906_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036907_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036920_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036919_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036916_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036917_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036918_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036911_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036905_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036909_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB036912_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KX264498_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KP995106_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
DQ899150_P_P-F      tttcctaatattcatttacatcaagatctgatatctaaatgtgaacaattggtaggcccg
KP995123_P_P-F      tttcctaatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KP995125_P_P-F      tttcctaatattcatttacatcaagatctgatatctaaatgtgaacaatttgtagggccg
KP718111_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KP995119_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
DQ899148_P_P-F      tttcctgatattcatttacatcaagatctgatatctagatgtgaacaatttgtaggcccg
AB116550_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AY311370_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KP995124_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KP995126_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
AB116549_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KJ638659_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
DQ899149_P_P-F      tttcctgatattcatttacatcaggatctgatatctaaatgtgaacaatttgtaggcccg
MH051986_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
MH051987_P_P-F      tttcctgatattcatttacatcaagatctgatatctaaatgtgaacaatttgtaggcccg
KP995109_P_P-F      tttcctgatattcatttacatcaggatctgatagctaaatgtgaacaatttgtaggcccg
AB036910_P_P-F      tttcctgatattcatttacaccaggatctgatatctaaatgtgaacaatttgtaggcccg
AB116551_P_P-F      tttcctgatattcatttacatcaggatctgatatctaaatgtgaacaatttgtaggcccg
KP718109_P_P-F      tttcctgatattcatttacatcaggatctgatatctaaatgtgaacaatttgtaggcccg
KP718112_P_P-F      tttcctgatattcatttacatcaggatctgatatctaaatgtgaacaatttgtaggcccg
DQ899147_P_P-F      tttcctgatattcatttacatcaagacctaatttctaaatgtgaacaatttgtaggccca
DQ899146_P_P-F      tttcctgatattcatttacatcaagacctaatttctaaatgtgaacaatttgtaggccca
DQ899144_P_P-F      tttcctgatattcatttacatcaagacctaatttctaaatgtgaacaatttgtaggccca
DQ899145_P_P-F      tttcctgatattcatttacatcaagacctaatttctaaatgtgaacaatttgtaggccca
KP995114_P_P-F      tttcctgatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
KP995097_P_P-F      tttcctaatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
KP995115_P_P-F      tttcctgatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
DQ899142_P_P-F      tttcctgatattcattggcatcagaacctgatttctaaatgtgaacaatttgtaggccca
DQ899143_P_P-F      tttcctgatattcatttgcatcagaacctgatttctaaatgtgaacaatttgtaggccca
KP995113_P_P-F      tttcctgatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
KP995104_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KC494399_P_P-F      tttcctgatattcatttgcatcaagatctgatttctaaatgtgaacaatttgtaggccca
AY311369_P_P-F      tttcctgatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
KP995107_P_P-F      tttcctgatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
AY090455_P_P-F      tttcctgatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
KC494396_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KT896494_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KP995110_P_P-F      tttcctgatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
KJ843191_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KP995120_P_P-F      tttcctgatattcatttgcatcaaaacctgatttctaaatgtgaacaatttgtaggccca
KC494397_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KC494401_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KC494394_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaattgtgaacaatttgtaggccca
X69798_P_P-F        tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KC494402_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KX264497_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KC494395_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KC494403_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
KC494405_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
JQ272888_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098578_P_P-F      tttcctgatattcatttgcatcaagatctgatatctaaatgtgaacaatttgtaggccca
KY476326_P_P-F      tttcctgatattcatttgcatcaagacctgatttctaaatgtgaacaatttgtaggccca
JN688720_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098579_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098577_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843225_P_P-F      tttcctgatattcatttgcatcaagatctgatatctaaatgtgaacaatttgtaggccca
MG098582_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
EF576808_P_P-F      tttcccgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
X75658_P_C-F        tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098570_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
AB365453_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
JN688709_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
AB166850_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
AB214516_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098565_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098583_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098569_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098575_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098574_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098573_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098566_P_P-F      tttcctgatattcatttgcatgaagacctgatatctaaatgtgaacaatttgtaggccca
EU366132_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
AB365449_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843185_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098580_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843226_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
AB365450_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
AB365446_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
DQ823086_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843223_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843209_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
AF223965_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
EF576812_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843175_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843189_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
DQ823089_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacgatttgtaggccca
JN811655_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
MG098564_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
DQ823088_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
JN688701_P_P-F      tttcctgatattcatttgcatcaagacctgatatcnaaatgtgaacaatttgtaggccca
KJ843211_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
FJ657528_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843224_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843212_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843219_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843221_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843222_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KY382411_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843207_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacgatttgtaggccca
AF223962_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgagcaatttgtaggccca
DQ823087_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
JN811656_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
JX079937_P_P-F      tttcctaatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843220_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
DQ823090_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
FJ657522_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacgatttgtaggccca
KJ843213_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacgatttgtaggccca
FJ657519_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
DQ776247_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843208_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ843210_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
EU366116_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KX264499_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
HE981181_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KC494398_P_P-F      tttcctgatattcatttgcatcaagacctgatatctaaatgtgaacaatttgtaggccca
KJ676694_P_P-F      tttcctgatattcatttacatcaagacctgatatctaaatgtgaacaatttgtgggccca
MG098584_P_P-F      tttcctgatattcatttacatcaagacctgatatctaaatgtgaacaatttgtgggccca
                    *****  * ***** *  **  *  *  * **    *  ***** * **  ** ** ** 

JN792921_P_P-F      ctyacwaaaaatgaattrmgaagattaaaattggtyatgccakcyagattttwtcctaag
KJ638660_P_P-F      ctcactaaaaatgaattacggagattgaaattggttatgcctgctagattttttcctaag
KJ638662_P_P-F      ctcactaamaatgaattacgaagattgaaattggttatgcctgctagattttttcctaag
KJ638663_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KJ638664_P_P-F      ctcacaaaaaatgaaatgagaagattaaaattggttatgccagccagattttttcctaag
KX757665_P_P-F      ctaacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
AY090461_P_P-F      ctaacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
AY090459_P_P-F      ctaacaaaaaatgaattaagaagattaaaattggttatgccatccagattttttcctaag
KP718104_P_P-F      ctaacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KP718113_P_P-F      ctaacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
AY090456_P_P-F      ctaacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
AY090458_P_C-F      ctaacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KP718107_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KJ638657_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggtyatgccatccagattttttcctaag
KJ638656_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
AB116654_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KP718110_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KY476324_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KY476329_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KY476327_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KY382415_P_P-F      ctcacaaaaaatgaattgaraarattaaaattagttatgccatccarattttttcctaag
KY382417_P_P-F      ctcacaaaaaatgaattgaraarattaaaattagttatgccatccarattttttcctaag
KY382416_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccarattttttcctaag
FJ657525_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctagg
AB086397_P_P-F      ctcacaaaacatgaattgagaagattaaaattggttatgccctccagattttttcctaag
KY476330_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KJ586807_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KP995116_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KY476325_P_P-F      ctcacaaaaaatgaaatgagaagattaaaattggttatgccatccagattttttcctaag
KY476328_P_P-F      ctcacaaaamatgaattgagaagattaaaattggttatgccatccagattttttcctaag
HM590474_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatctagattttttcctaag
HM585186_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatctagattttttcctaag
HM590471_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatctagattttttcctaag
HM590472_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatctagattttttcctaag
KM233681_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatctagattttttcctaag
EU670262_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccagccagatttttccctaag
JX079936_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KJ843177_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatcaagattttttcctaag
KJ843178_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KC494400_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KF779236_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709462_P_P-F      ctcacgaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
AB064316_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KF199901_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709457_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
MK058437_P_P-F      ctcacaaaaaacgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM622135_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843202_P_P-F      ctcacaaaaaatgaattgagaagattaaaattaattatgccatccagattttttcctaag
KC494404_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585192_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
EU366133_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843169_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709465_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585198_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585195_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709459_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709458_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585191_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HE981182_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HE981183_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843171_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585196_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585189_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585187_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709494_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585190_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585199_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585188_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM590473_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
DQ823091_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
AF223963_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843168_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843170_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
JN688691_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
JN688699_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
JN688703_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KY458062_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KP995098_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843194_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843193_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ586808_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709463_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585193_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
AB116552_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
AF223964_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843197_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843205_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843204_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843203_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843180_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843174_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843164_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
AY179735_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843181_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843179_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709460_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843167_P_P-F      ctcacaaaaaatgaattgagaagattgaaattagttatgccatccagattttttcctaag
KJ843196_P_P-F      ctcacaaaaaatgaattgagaagattgaaattagttatgccatccagattttttcctaag
KJ843199_P_P-F      ctcacaaaaaatgaattgagaagattgaaattagttatgccatccagattttttcctaag
KJ843195_P_P-F      ctcacaaaaaatgaattgagaagattgaaattagttatgccatccagattttttcctaag
KJ843200_P_P-F      ctcacaaaaaatgaattgagaagattgaaattagttatgccatccagattttttcctaag
KM998715_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KY458061_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843163_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM585197_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
DQ823094_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
DQ823095_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
DQ823092_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
EU366118_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ657529_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843198_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843201_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843206_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843176_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
DQ823093_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
FJ709464_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HQ378247_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KJ843190_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
KX264496_P_P-F      ctcacaaaaaatgaattgagaagattaaaattagttatgccatccagattttttcctaag
HM627320_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttwtcctaag
HM585194_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
HM585200_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KY476331_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KY476323_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
JN792916_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
JN792922_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggtcatgccatccagattttttcctaag
JN792919_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KY476322_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
KY476332_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
JN792918_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
JN792920_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
JN792914_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
JN792917_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggttatgccatccagattttttcctaag
X75663_P_P-F        ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995118_P_P-F      ctcacaaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995111_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995101_P_P-F      ctcactaaaaatgaattgagaaaattcaaattgatcatgccagctagattttatcctaag
KP718106_P_P-F      ctcactaaaaatgagttgagaagattaaaattggtcatgccagctagattttatcctaaa
KP995105_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
FJ589067_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
FJ589066_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995117_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP718103_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036908_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036913_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036915_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036914_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036906_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036907_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036920_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagccagattttatcctaag
AB036919_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036916_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036917_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036918_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036911_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036905_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036909_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036912_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KX264498_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995106_P_P-F      ctcactaaaaatgaattgagaagattaaaactggtcatgccagctagattttatcctaag
DQ899150_P_P-F      ttcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995123_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995125_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP718111_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcccaag
KP995119_P_P-F      ctcactaaaaatgaattgagaagattaaaactggtcatgccagctagattttatcctaag
DQ899148_P_P-F      ctcactaaaaatgaattgagaagattaaaattgatcatgccagctagattttatcctaag
AB116550_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AY311370_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995124_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995126_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB116549_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KJ638659_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
DQ899149_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
MH051986_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
MH051987_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP995109_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB036910_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
AB116551_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP718109_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
KP718112_P_P-F      ctcactaaaaatgaattgagaagattaaaattggtcatgccagctagattttatcctaag
DQ899147_P_P-F      ctcactaaaaatgaattaaggaggttaaaattggttatgccagctagattttatcctaag
DQ899146_P_P-F      ctcactaaaaatgaattaaggaggttaaaattggttatgccagctagattttatcctaag
DQ899144_P_P-F      ctcactaaaaatgaattaaggaggttaaaattggttatgccagctagattttatcctaag
DQ899145_P_P-F      ctcactaaaaatgaattaaggaggttaaaattggttatgccagctagattttatcctaag
KP995114_P_P-F      ctcactaaaaatgaattacgacgattaaaattggttatgccagccagattttatcctaag
KP995097_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagccagattttatcctaag
KP995115_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagccagattttatcctaag
DQ899142_P_P-F      ctcactaaaaatgaattacgaagattgaaattggttatgccagccagattttatcctaag
DQ899143_P_P-F      ctcactaaaaatgaattacgaagattgaaattggttatgccagccagattttatcctaag
KP995113_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagccagattttatcctaag
KP995104_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagccagattttatcctaag
KC494399_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
AY311369_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagccagattttatcctaag
KP995107_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
AY090455_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagccagattttatcctaag
KC494396_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
KT896494_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccatctagattttatcctaag
KP995110_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagccagattttatcctaag
KJ843191_P_P-F      cttactaaaaatgaattacgaarattaaaattggttatgccagctagattttatcctaag
KP995120_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagccagattttatcctaag
KC494397_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
KC494401_P_P-F      cttactaaaaatgaattgcgaagattaaaattggttatgccagctagattttatcctaag
KC494394_P_P-F      cttactaaaaatgaattacaaagattaaaattggttatgccagctagattttatcctaag
X69798_P_P-F        cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
KC494402_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
KX264497_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
KC494395_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
KC494403_P_P-F      cttactaaaaatgaattacgaagattaaaattggttatgccagctagattttatcctaag
KC494405_P_P-F      cttactaaaaatgaagtacgaagattaaaattggttatgccagctagattgtatcctaag
JQ272888_P_P-F      cttaccaaaaatgaattaagaaggttgaaattgattatgccagccagattctttcctaaa
MG098578_P_P-F      cttactaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KY476326_P_P-F      cttactaaaaatgaattgagaaggttgaaattgrttatgccagccagattctttcctaaa
JN688720_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
MG098579_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
MG098577_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843225_P_P-F      ctcaccaaaaatgaactgagaaggttgaaattggttatgccagccagattctttcctaaa
MG098582_P_P-F      cttactaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
EF576808_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
X75658_P_C-F        cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
MG098570_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
AB365453_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
JN688709_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
AB166850_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
AB214516_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagaatctttcctaaa
MG098565_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
MG098583_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
MG098569_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattttttcctaaa
MG098575_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
MG098574_P_P-F      cttaccaaacatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
MG098573_P_P-F      cttaccaaacatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
MG098566_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
EU366132_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
AB365449_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843185_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
MG098580_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843226_P_P-F      cttaccaaaaatgaattcagaaggttgaaattgattatgccagccagattctttcctaaa
AB365450_P_P-F      ctyaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
AB365446_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
DQ823086_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843223_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843209_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
AF223965_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
EF576812_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843175_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843189_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
DQ823089_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
JN811655_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
MG098564_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
DQ823088_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
JN688701_P_P-F      cttaccaaaaatgaattgagaaggttaaaattggttatgccagccagattctttcctaaa
KJ843211_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
FJ657528_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
KJ843224_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
KJ843212_P_P-F      cttacyaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
KJ843219_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
KJ843221_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
KJ843222_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
KY382411_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
KJ843207_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
AF223962_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccatccagattctttcctaaa
DQ823087_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
JN811656_P_P-F      cttaccaaaaatgaattgagaaggttgaaattggttatgccagccagattctttcctaaa
JX079937_P_P-F      cttaccaaaaatgaattgagaaggttgaaattaattatgccagccagattctttcctaaa
KJ843220_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
DQ823090_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
FJ657522_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccacccaaattctttcctaaa
KJ843213_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
FJ657519_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
DQ776247_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843208_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ843210_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
EU366116_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KX264499_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
HE981181_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KC494398_P_P-F      cttaccaaaaatgaattgagaaggttgaaattgattatgccagccagattctttcctaaa
KJ676694_P_P-F      cttactaaaaatgaattaagragrttgaaattggttatgccagctagattctttcctaaa
MG098584_P_P-F      cttactaaaaatgaattaagaagattgaaattggttatgccagctagattctttcctaaa
                     * ** **  * **  *       ** *** *  * *****  * * * * *  ** *  

JN792921_P_P-F      gttaccaaatattttccyatggawaarggmatyaaaccctattatcctgakmacgyrgtt
KJ638660_P_P-F      gttaccaaatattttccactggaaaaaggtattaaaccttactatcctgagcatgcagtt
KJ638662_P_P-F      gttaccaaatattttcctatggaaaaaggtattaaaccttactatcctgagcattcagtt
KJ638663_P_P-F      gttaccaaatattttcctttggaaaagggaattaaaccctattatcctgataacgtggtt
KJ638664_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatccagataacgtggtt
KX757665_P_P-F      gttacaaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
AY090461_P_P-F      gttaccaaatattttcctatggaaaagggaatcaaaccctattatcctgataacgtggtt
AY090459_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KP718104_P_P-F      gttaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
KP718113_P_P-F      gttaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
AY090456_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
AY090458_P_C-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KP718107_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ638657_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ638656_P_P-F      gttaccaaatattttcctctggaaaagggaattaaaccctattatcctgataacgtggtt
AB116654_P_P-F      gttactaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KP718110_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY476324_P_P-F      gttaccaaatattttcctatggaaaagggaatyaaaccctattatcctgataacgtggtt
KY476329_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY476327_P_P-F      gctaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY382415_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY382417_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY382416_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
FJ657525_P_P-F      gttaccaaatattttcctttggaaaagggaattaaaccctattatcctgacaacgtagtt
AB086397_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatccggataacgtggtt
KY476330_P_P-F      gttaccaaatattttcctttggaaaagggaattaaaccctattatcctgataacgtggtt
KJ586807_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KP995116_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY476325_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY476328_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM590474_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM585186_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM590471_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM590472_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KM233681_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
EU670262_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtagtt
JX079936_P_P-F      gtcaccaaatattttcctatagaaaagggaattaaaccctattatcctgataacgtggtt
KJ843177_P_P-F      gtcaccaaatattttcctatagaaaagggaattaaaccctattatcctgataacgtggtt
KJ843178_P_P-F      gtcaccaaatattttcctatagaaaagggaattaaaccctattatcctgataacgtggtt
KC494400_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KF779236_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
FJ709462_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
AB064316_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KF199901_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
FJ709457_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
MK058437_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM622135_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843202_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KC494404_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM585192_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
EU366133_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843169_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
FJ709465_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585198_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585195_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
FJ709459_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
FJ709458_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585191_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HE981182_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HE981183_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
KJ843171_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585196_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585189_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585187_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
FJ709494_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585190_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585199_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM585188_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
HM590473_P_P-F      gttaccaaatattttcctatggacaagggaattaaaccctattatcctgataacgtggtt
DQ823091_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
AF223963_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843168_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843170_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN688691_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN688699_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN688703_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY458062_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KP995098_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843194_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843193_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ586808_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
FJ709463_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM585193_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
AB116552_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
AF223964_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843197_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843205_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843204_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843203_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843180_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843174_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843164_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
AY179735_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843181_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843179_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
FJ709460_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843167_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843196_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843199_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843195_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843200_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KM998715_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY458061_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843163_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM585197_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
DQ823094_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
DQ823095_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
DQ823092_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
EU366118_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
FJ657529_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843198_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843201_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843206_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843176_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
DQ823093_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
FJ709464_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HQ378247_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KJ843190_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KX264496_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
HM627320_P_P-F      gytaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
HM585194_P_P-F      gttaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
HM585200_P_P-F      gttaccaaatattttcctatggaaaaggggattaaaccctattatcctgataacgtggtt
KY476331_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY476323_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN792916_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN792922_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN792919_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY476322_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
KY476332_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN792918_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN792920_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN792914_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
JN792917_P_P-F      gttaccaaatattttcctatggaaaagggaattaaaccctattatcctgataacgtggtt
X75663_P_P-F        cataccaaatatttcctattggagaaagggattaaaccctattatccagatcaggcagtt
KP995118_P_P-F      gttaccaaatactttcctatggaaaaagggattaaaccctattatcctgagcatgcagtt
KP995111_P_P-F      gttactaaatactttcctatggagaaagggattaaaccctattatcctgagcaggcagtt
KP995101_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP718106_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP995105_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccccattatcctgagcatgtagtt
FJ589067_P_P-F      cttaccaaatatttcctattggagaaagggattaaaccctattatccagagcaggcagtt
FJ589066_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgtagtt
KP995117_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP718103_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
AB036908_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036913_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036915_P_P-F      gttaccaaatactttcctatcgagaaagggattaaaccctattatcctgagcattcagtt
AB036914_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036906_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036907_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036920_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036919_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036916_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036917_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036918_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036911_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036905_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036909_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
AB036912_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
KX264498_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcattcagtt
KP995106_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
DQ899150_P_P-F      gttactaaatattttcctatggagaaagggattaaaccctattatcttgagcatgcagtt
KP995123_P_P-F      gttactaaatattttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP995125_P_P-F      gttactaaatattttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP718111_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP995119_P_P-F      gttaccaaatactttcctttggagaaagggattaaaccctattatccggagcatgcagtt
DQ899148_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
AB116550_P_P-F      gttacaaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
AY311370_P_P-F      gttaccaaatactttcctctggagaaagggattaaaccctattatcctgagcatgcagtt
KP995124_P_P-F      gttaccaaatactttcctctggagaaagggattaaaccctattatcctgagcatgcagtt
KP995126_P_P-F      gttaccaaatactttcctctggagaaagggattaaaccctattatcctgagcatgcagtt
AB116549_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KJ638659_P_P-F      gttacaaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
DQ899149_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
MH051986_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
MH051987_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP995109_P_P-F      gttaccaaatattttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
AB036910_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
AB116551_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP718109_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
KP718112_P_P-F      gttaccaaatactttcctatggagaaagggattaaaccctattatcctgagcatgcagtt
DQ899147_P_P-F      gttaccaaatattttcctatggagaaaggaatcaagccttattatcctgagcatgcagtt
DQ899146_P_P-F      gttaccaaatattttcctatggagaaaggaatcaagccttattatcctgagcatgcagtt
DQ899144_P_P-F      gttaccaaatattttcctatggagaaaggaatcaagccttattatcgtgagcatgcagtt
DQ899145_P_P-F      gttaccaaatattttcctatggagaaaggaatcaagccttattatcctgagcatgcagtt
KP995114_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
KP995097_P_P-F      gttaccaaatattttcctatagacaaaggcatcaaaccctattatcctgagcatgcagtt
KP995115_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
DQ899142_P_P-F      gttaccaaatattttcctacggacaaaggcatcaaaccctattatcctgagcatgcagtt
DQ899143_P_P-F      gttaccaaatattttcctacggacaaaggcatcaaaccctattatcctgagcatgcagtt
KP995113_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
KP995104_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
KC494399_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
AY311369_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
KP995107_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
AY090455_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
KC494396_P_P-F      gttaccaaatattttcctatggataaaggcatcaaaccctattatcctgagcatgcagtt
KT896494_P_P-F      gttacaaaatattttcccttggataaaggcatcaaaccctattatcctgagcaygcagtt
KP995110_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
KJ843191_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
KP995120_P_P-F      gttaccaaatattttcctatggacaaaggcatcaaaccctattatcctgagcatgcagtt
KC494397_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
KC494401_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
KC494394_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
X69798_P_P-F        gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
KC494402_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
KX264497_P_P-F      gttaccaaatattttcctatggataaaggcatcaaaccctattatcctgagcatgcagtt
KC494395_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
KC494403_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
KC494405_P_P-F      gttaccaaatattttcccatggataaaggcatcaaaccctattatcctgagcatgcagtt
JQ272888_P_P-F      cttactaaatattttcctctggaaaaaggcatcaaacctcattatcctgagcatgcagtt
MG098578_P_P-F      cttactaaatattttcctctggagaaaggcatcaaaccttattatcctgagcatgcagtt
KY476326_P_P-F      cttaccaaatattttcctttggagaaaggcatcaaaccttattatcctgagcatgcagtt
JN688720_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098579_P_P-F      cttactaaatattttcctctggaaaaaggcattaaaccttattatcctgagcatgtagtt
MG098577_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatggagtt
KJ843225_P_P-F      cttactaaatattttcctctggagaaaggcatcaaaccttattatcctgagcatgcagtt
MG098582_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
EF576808_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
X75658_P_C-F        cttactaaatatttccctctggagaaagacattaaaccttattatccagagcatgcagtt
MG098570_P_P-F      cttactaaatattttcctctggaaaaaggcattaaaccttattatcctgagcatgcagtt
AB365453_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
JN688709_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
AB166850_P_P-F      cttactaaatattttccgctggagaaaggcattaaaccctattatcctgagcatgcagtt
AB214516_P_P-F      cttactaaatattttccgctggagaaaggcattaaaccctattatcctgagcatgcagtt
MG098565_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098583_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098569_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098575_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098574_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098573_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098566_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
EU366132_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
AB365449_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843185_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098580_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843226_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
AB365450_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
AB365446_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
DQ823086_P_P-F      cttactaaatattttcctctggaaaaaggcattaaaccttattatcctgagcatgcagtt
KJ843223_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843209_P_P-F      cttactaaatattttcctctggaaaaaggcattaaaccttattatcctgagcatgcagtt
AF223965_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
EF576812_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843175_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843189_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
DQ823089_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
JN811655_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
MG098564_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
DQ823088_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
JN688701_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843211_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
FJ657528_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843224_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843212_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843219_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843221_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843222_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KY382411_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843207_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
AF223962_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
DQ823087_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
JN811656_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
JX079937_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843220_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
DQ823090_P_P-F      cttactaaatattttcctctggaaaaaggcattaaaccttattatcctgagcatgcagtt
FJ657522_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843213_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
FJ657519_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
DQ776247_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843208_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ843210_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
EU366116_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KX264499_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
HE981181_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KC494398_P_P-F      cttactaaatattttcctctggagaaaggcattaaaccttattatcctgagcatgcagtt
KJ676694_P_P-F      cataccaaatattttcctctggaaaaaggaattaaaccctattatcctgagcatgcagtt
MG098584_P_P-F      cttaccaaatattttcctttggaaaaaggtattaaaccctattatcctgagcatgcagtt
                       ** ***** ** *     ** ** *  ** ** **  * ****  **  *    ***

JN792921_P_P-F      aatcattaytttaaraccagacaytatttgcatactttatggaargcrggaattytatat
KJ638660_P_P-F      aatcattactttaaaacccgacactatttgcatactttatggaaggcgggaattttatat
KJ638662_P_P-F      aatcattactttaaaacccgacactatttgcatactttatggaaggcgggaattttatat
KJ638663_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatac
KJ638664_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KX757665_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatat
AY090461_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatat
AY090459_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatat
KP718104_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatat
KP718113_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaggcaggcattctatat
AY090456_P_P-F      aatcattactttaagactagacactatttgcatactttatggaaggcaggcattctatat
AY090458_P_C-F      aatcattattttaagactagacactatttgcatactttatggaaggcaggcattctatat
KP718107_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaatcaggaattctatat
KJ638657_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KJ638656_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
AB116654_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KP718110_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476324_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476329_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476327_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY382415_P_P-F      aatcattattttaaraccaracactatttgcatactttatggaaagcaggcattytatat
KY382417_P_P-F      aatcattattttaaraccaracactatttgcatactttatggaaagcaggcattytatat
KY382416_P_P-F      aatcattattttaaraccaracactatttgcatactttatggaaagcaggcattytatat
FJ657525_P_P-F      aatcattattttaagaccagacactatttgcatacattatggaaagcaggaattctatat
AB086397_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476330_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KJ586807_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KP995116_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KY476325_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476328_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
HM590474_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
HM585186_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
HM590471_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
HM590472_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KM233681_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
EU670262_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
JX079936_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KJ843177_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KJ843178_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KC494400_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KF779236_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709462_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
AB064316_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KF199901_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709457_P_P-F      aatcattattttaagaccaggcactatttgcatactttatggaaagcaggcattctatat
MK058437_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM622135_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843202_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KC494404_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585192_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
EU366133_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843169_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709465_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585198_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585195_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709459_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709458_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585191_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HE981182_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HE981183_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843171_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585196_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585189_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585187_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709494_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585190_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585199_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585188_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM590473_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
DQ823091_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaargcrggcattctatat
AF223963_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843168_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843170_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
JN688691_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
JN688699_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
JN688703_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KY458062_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KP995098_P_P-F      aatcattattttaaaaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843194_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843193_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ586808_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709463_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585193_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
AB116552_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
AF223964_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843197_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843205_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843204_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843203_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843180_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843174_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843164_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
AY179735_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843181_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843179_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709460_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843167_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843196_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843199_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843195_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843200_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KM998715_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KY458061_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843163_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM585197_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
DQ823094_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaargcrggcattctatat
DQ823095_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaargcrggcattctatat
DQ823092_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaargcrggcattctatat
EU366118_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ657529_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843198_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843201_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843206_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843176_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
DQ823093_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
FJ709464_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HQ378247_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KJ843190_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
KX264496_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggcattctatat
HM627320_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
HM585194_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
HM585200_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476331_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476323_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
JN792916_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
JN792922_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
JN792919_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476322_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
KY476332_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
JN792918_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
JN792920_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
JN792914_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
JN792917_P_P-F      aatcattattttaagaccagacactatttgcatactttatggaaagcaggaattctatat
X75663_P_P-F        aatcattattttcaaaccagacattatttgcatactttatggaaggcgggaattctatat
KP995118_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP995111_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggagtcttatat
KP995101_P_P-F      aatcattattttaaagcaagacattatttgcatactttatggaaggcgggaatcttatat
KP718106_P_P-F      aatcattattttaaaacaagacattatttgcatactctatggaaggygggaatcttatat
KP995105_P_P-F      aatcattattttaaaacgagacattatttgcatactttatggaaggcgggaatcttatat
FJ589067_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaattttatat
FJ589066_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP995117_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP718103_P_P-F      aatcattattttaaaacaagacattatttgcatactttgtggaaggcgggaatcttatat
AB036908_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036913_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036915_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036914_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036906_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036907_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036920_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036919_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036916_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036917_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036918_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036911_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036905_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036909_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
AB036912_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
KX264498_P_P-F      aatcattattttaaaacaagacattatttgcatactctttggaaggcgggaatcttatat
KP995106_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
DQ899150_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP995123_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP995125_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP718111_P_P-F      aatcattattttaaaacaaggcattatttgcatactttatggaaggcgggaatcttatat
KP995119_P_P-F      aatcattactttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
DQ899148_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcaggaatcttatat
AB116550_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
AY311370_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP995124_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP995126_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
AB116549_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KJ638659_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
DQ899149_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
MH051986_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
MH051987_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP995109_P_P-F      aatcattattttaaaactagacattatttgcatactttatggaaggcgggaatcttatat
AB036910_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
AB116551_P_P-F      aatcattattttaaaactagacattatttgcatactttatggaaggcgggaatcttatat
KP718109_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
KP718112_P_P-F      aatcattattttaaaacaagacattatttgcatactttatggaaggcgggaatcttatat
DQ899147_P_P-F      aatcattacttcaaaaccagacattatttgcatactttatggaaggcgggaattttatat
DQ899146_P_P-F      aatcattacttcaaaaccagacattatttgcatactttatggaaggcgggaattttatat
DQ899144_P_P-F      aatcattacttcaaaaccagacattatttgcatactttatggaaggcgggaattttatat
DQ899145_P_P-F      aatcattacttcaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KP995114_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KP995097_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KP995115_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
DQ899142_P_P-F      aatcattactttaaaaccagacattatttacatactttatggaaggcgggaattttatat
DQ899143_P_P-F      aatcattactttaaaaccagacattatttacatactttatggaaggcgggaattttatat
KP995113_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KP995104_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494399_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
AY311369_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KP995107_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
AY090455_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494396_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KT896494_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KP995110_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KJ843191_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KP995120_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494397_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494401_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494394_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
X69798_P_P-F        aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494402_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KX264497_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494395_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494403_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
KC494405_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
JQ272888_P_P-F      aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatat
MG098578_P_P-F      aatcattactttaaaaccagacattatttgcatactttatgggaggcgggaattttatat
KY476326_P_P-F      aatcattactttaaaaccaggcattatttgcatactttatggaaggcgggaattttatat
JN688720_P_P-F      aatcattattttcaaaccagacattatttgcatactttatggaaggcgggaattttatat
MG098579_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaatcttatat
MG098577_P_P-F      aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatat
KJ843225_P_P-F      aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
MG098582_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcaggaattttatat
EF576808_P_P-F      aatcattattttaagaccagacattatttgcatactttatggaaggcgggaattttatat
X75658_P_C-F        aatcattattttcaaaccagacattatttgcatactttatggaaggcgggaattttatat
MG098570_P_P-F      aatcattattttaagaccagacattatttgcatactttatggaaggcgggaatcttatat
AB365453_P_P-F      aatcattattttaagaccagacattatttgcatacgttatggaaggcgggaattttatat
JN688709_P_P-F      aatcattattttaaaaccagacattatttgcatactttatggaaggcgggaattctatat
AB166850_P_P-F      aatcattactttaaaaccagacattatttgcatactttatggaaggcgggaattttatat
AB