HBVdb

Dataset for nucleotide sequence X of genotype E

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** **** ** **  **** ** *** *  *    *********** *  * *** * ***     * ** *  *  *
ATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGAGGGACGTCCTTTGTCTACGTCCCGTCAGCGCTGAATCCTGCGG
            a   a                aa c              t           g        c  c    
                                 tg                                             
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ** *   **** *   * **       * *** *  **    **    *  *   *  * *** * *  ** * *
ACGACCCgTCTCGGGGTCGCTTGGGGaTCTaTCGTCCCCTTCTCCGTCTGCCGTTCCaGCCGACCACGGGGCGCACCTCT
       c        c   c     g t cc     t  a     a          ga  at                 
       a                  c a g                               c                 
                              t                                                 

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *** * * *****  * **   **   *  *   **  *** * * ***** * ******    ****  *****  
CTTTACGCGGTCTCCCCGTCTGTgCCTTCTCATCTGCCGGaCCGTGTGCACTTCGCTTCACCTCTGCACGTCGCATGGAG
  g              a     tg  a   gc c     t                      t               a
                       a                g                                       
                                        c                                       

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **   **** *   *                * * * **      * **  ***** * ****         *******
ACCACCGTGAACGCCCAC------CAAaTcTTGCCCAAGGTCTTACATAAGAGGACTCTTGGACTCTCtGCAATGTCAAC
   c        a t gt      aggcga           t   t     c             t ag t         
                         t t                                        c           
                           g                                                    

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* * * ********  ** **** *   **  * ** **  **** ***** *  ********       *         
GACCGACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTtGGGGGAGGAGAtTAGaTTAAaGgTCT
               g         a    cg    c      a                cc   g c ct a g 
               c                                                 g              
                                                                                

       410       420       430       440       450       460       470 
....:....|....:....|....:....|....:....|....:....|....:....|....:....|.
 ***    **** * ****** *** *   * **           *  *   ****** *** * ** ** 
TTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGCGCACCAGCACCATGCAACTTTTTCACCTCTGCCTAA
    ct c                       g    t    t                g            
                                                                       
                                                                       
© 1998-2020Legal notice