Dataset for nucleotide sequence X of genotype E

[Download (right click)] [Edit] [Sequences] [Repertoires]

412 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

HM363596_X_P-E      atggctgctaggctgggctgccaactggatcctgggagggacgtcctttgtctacgtccc
GQ161775_X_P-E      atggctgctaggctgtrctgccaactggatycttcgmgggacgtcctttgtttacgtccc
HM363567_X_P-E      atggctgctaggctgtgctgccaactggctcctgccagggacgtccttggtatacgtgca
HM363604_X_P-E      atggctgctaggctgtgctgccaactggctcctgccagggacgtccttggtatacgtgca
HM363611_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtccc
HM363605_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtatacgtccc
HM363597_X_P-E      atgggtgctaggatgtgctgccaactggatcctgggagggacgtcctttgtctacgtccc
JQ272902_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccc
MG776800_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363606_X_P-E      atggctgctaggctgtgctgccaactggctcctgcgagggacgtcctttgtctacgtccc
LT623851_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB219533_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363600_X_P-E      atgggtgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363607_X_P-E      atgggtgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MF772354_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594751_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
LT623844_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776772_X_P-E      atggctgctaggctgtgctgccaactggatcctgggagggacgtcctttgtctacgtccc
KU736904_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MK321264_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MK720631_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MK720632_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776534_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776744_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736911_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736903_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736902_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
AM494695_X_P-E      atggctgctaggctgtgctgccaactggatcctrcgagggacgtcctttgtctacgtccc
MG776512_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MG776798_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
MN967528_X_P-E      atggctgctaggctgtgctgccaactggatactacgagggacgtcctttgtctacgtccc
KF170742_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494699_X_P-E      atggctgctaggctgtgctgccaactggatactacgagggacgtcctttgtctacgtccc
AM494698_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736892_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB915176_X_P-E      atggctgctaggttgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736891_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN967526_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtcttcgtccc
AM494701_X_P-E      atggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtctacgtccc
AM494707_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
KU736909_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN967527_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtccc
MG776797_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776734_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
MG776503_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776427_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
MG776403_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776799_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494703_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AB915177_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494702_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AM494693_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AM494704_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AM494715_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AM494708_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AM494713_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AM494717_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
MN967529_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
MG776678_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776550_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736910_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736905_X_P-E      atggctgctaggctgtgctgccaattggatcctgcgagggacgtcctttgtctacgtccc
KU736893_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736900_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494690_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736913_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736906_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736907_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736908_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736912_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
X75657_X_P-E        atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363598_X_P-E      atggctgctaggctgtgctgccaactggatcctgggagggacgtcctttgtctacgtccc
LT623850_X_P-E      atggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgyctacgtccc
FJ349240_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtccc
AB915180_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtccc
MG776729_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
HM363603_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
FN594748_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363599_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtccttcgtctacgtccc
HM363602_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtccc
FN594762_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
HM363591_X_P-E      atggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363590_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363586_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363574_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363568_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363601_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363610_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363585_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363595_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363584_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363575_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363582_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363583_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849713_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363588_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363589_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363592_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363587_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363565_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363566_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363576_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363579_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363580_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MT426115_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363581_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849715_X_P-E      atggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849720_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849717_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161785_X_P-E      atggctgctaggctgtactgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594750_X_P-E      atggctgctaggctgtgctgcaaactggatcctgcaagggacgtcctttgtctacgtccc
MF772355_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtttacgtccc
KF849726_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN545822_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274975_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849725_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849728_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849727_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
LT623846_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849716_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060822_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
KF922438_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF922439_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KT192626_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH464856_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AY935700_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
EU239223_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MW679683_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
EU239219_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849714_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849722_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849719_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060823_X_P-E      atggctgctaggctgtgctgccaattggatcctgcgagggacgtcctttgtctacgtccc
OM256457_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849721_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AY738144_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AY738145_X_C-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AY738146_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AY738147_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KF849723_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060824_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
JQ000009_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507841_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KM606739_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB219529_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
LT623843_X_P-E      atggctgctaggctgtactgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN545827_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494691_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
AM494705_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
MG776745_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363593_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776426_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MF772358_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB205188_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161822_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161768_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507840_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MF772357_X_P-E      atggctgctaggttgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MF772356_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB205190_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161833_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MF772361_X_P-E      atggctgctaggctgtgctgccaactggatcttgcgagggacgtcctttgtctacgtccc
FN594765_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274980_X_P-E      atggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtctacgtccc
MF772359_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
LT623847_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
HM363608_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594749_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
EU239220_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB915178_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB219534_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MW455165_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161820_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507844_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MW455164_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962189_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161836_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507847_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363609_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594753_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580626_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363594_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
GQ161812_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161796_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB205189_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580645_X_P-E      atggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtctacgtccc
FN545842_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274985_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274984_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
FN594758_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AM494689_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494692_X_P-E      atggctgctaggctgtactgccaactggatcctgcgagggacgtcctttgtctacgtccc
MG776737_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtccc
KF170741_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363578_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
GQ161823_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161797_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
GQ161762_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161759_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MW455161_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN545821_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtttacgtccc
EU239222_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB201287_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtccc
AB274981_X_P-E      atggctgctcggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HQ700550_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HQ700552_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580648_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB205129_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB205192_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
LT623845_X_P-E      atggctgctaggctgtgctgccaactggatcctrcgagggacgtcctttgtctacgtccc
MH580631_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580632_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580652_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580617_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580628_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580644_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161790_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161799_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161805_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161818_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161821_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MT570163_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060826_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060827_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
KM606738_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580650_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
LT623849_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
LT623842_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
KT749841_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
KF849724_X_P-E      atggctgctaggctgtactgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161831_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161811_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161803_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161771_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
FN594760_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594759_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594752_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN545841_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
EU239224_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494711_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtccc
AB274969_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AB194948_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB106564_X_C-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507842_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MT570162_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MW082636_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB205191_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060825_X_P-E      atggctgctaggctgtgctgccaactggatcctgagagggacgtcctttgtctacgtccc
KF849718_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736894_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161782_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161792_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161814_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MW455162_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB091256_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB091255_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507843_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594766_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
AB274979_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274973_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN545823_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580633_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ349226_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AY739674_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AY739675_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ349237_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ349238_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161815_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MT570164_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962197_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MW679682_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH918655_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580640_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580641_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580614_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580615_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580616_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580618_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580619_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580620_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580623_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580651_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MF772362_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MF772360_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736897_X_P-E      atggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtcttcgtccc
KU736898_X_P-E      atggctgctaggctgtgctgccaactggatccttcgagggacgtcctttgtcttcgtccc
HQ700551_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363571_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
HM363572_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
HM363570_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363569_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161834_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161825_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161781_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161769_X_P-E      atggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
GQ161779_X_P-E      atggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtttacgtccc
GQ161764_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
FN594761_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594756_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ349239_X_P-E      atggctgctaggctgtgctgccaactggatcctacgagggacgtcctttgtctacgtccc
EU239226_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
EU239217_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060830_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494706_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274978_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274977_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB201290_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB201288_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494832_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494712_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494714_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507846_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507848_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580630_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494710_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494697_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494709_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736901_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962190_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MW455163_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736899_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736895_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KU736896_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MN507845_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161755_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161835_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274972_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274970_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
JQ000008_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962196_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580622_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363577_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580621_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580625_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580637_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB201289_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB915175_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580634_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580635_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580636_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FN594763_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580647_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
HM363573_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962192_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161778_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161810_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962195_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161757_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161760_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161808_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161793_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161827_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161807_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060828_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
DQ060829_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161783_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161824_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962198_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
LT623848_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161801_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161794_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962194_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161776_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161784_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161789_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161828_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161765_X_P-E      atggctgctaggatgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161763_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161761_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161830_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161756_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161795_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274982_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274976_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274974_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161816_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB194947_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
EU239221_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161770_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161772_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161777_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161780_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161787_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161791_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161798_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161800_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161804_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161819_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161829_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161832_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
KX186584_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580638_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962193_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962199_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580624_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580646_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580649_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MH580629_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
FJ349227_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161826_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161817_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161773_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161802_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161758_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161766_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161774_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
MZ962191_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AB274971_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
GQ161786_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494694_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494696_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
AM494700_X_P-E      atggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtctacgtccc
                    **** **** ** **  **** ** *** *  *    *********** *  * *** * 

HM363596_X_P-E      gtcagcgctgaatcgtgcggacgacccgtctcggggtcgcttgggggtctctcgtcccct
GQ161775_X_P-E      gtcggcgctgaatcccgcggacgacccctctcggggycgcttgggactctatcgtcccct
HM363567_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggataaaccatcccct
HM363604_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggataaaccatcccct
HM363611_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccccc
HM363605_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctaccgtcccct
HM363597_X_P-E      gtcagcgctgaatcctggggacgacccgtctcggggtcgcttggggatctatcgtcccct
JQ272902_X_P-E      gtcggcgctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtcccct
MG776800_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtcctct
HM363606_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
LT623851_X_P-E      gtcrgcactgaatcctgcggacgacccgtcccggggtcgcttggggatctatcgtcccct
AB219533_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctgtcgtcccct
HM363600_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatatatcgtcccct
HM363607_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatatatcgtcccct
MF772354_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
FN594751_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctttcgtcccct
LT623844_X_P-E      gtcagcgctgaatccagcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MG776772_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcctct
KU736904_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctrtcgtcccct
MK321264_X_P-E      gtcagcgctgaancctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MK720631_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MK720632_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776534_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MG776744_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
KU736911_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736903_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736902_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
AM494695_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776512_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MG776798_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MN967528_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgtttggggatctatcgtcccct
KF170742_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494699_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494698_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
KU736892_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB915176_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736891_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MN967526_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494701_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggctctatcgtcccct
AM494707_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736909_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MN967527_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776797_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776734_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776503_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MG776427_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776403_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MG776799_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AM494703_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB915177_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494702_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494693_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
AM494704_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
AM494715_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
AM494708_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494713_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494717_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MN967529_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776678_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776550_X_P-E      gtcagcgctgaatcctgcagacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736910_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736905_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736893_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736900_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494690_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736913_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736906_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736907_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736908_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736912_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
X75657_X_P-E        gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363598_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
LT623850_X_P-E      gtcagcgctgaatcccgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FJ349240_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB915180_X_P-E      gtcagcgctgaatccagcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MG776729_X_P-E      gtcagcgctgaatcccgcggacgacccgtctcggggccgcttgggcctctatcgtcccct
HM363603_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FN594748_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
HM363599_X_P-E      gtcagtggtgaatcctggggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363602_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FN594762_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363591_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
HM363590_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363586_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363574_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
HM363568_X_P-E      gtcagcgctgaatcctgcggacgacccgtcttggggtcgcttggggatctaccgtcccct
HM363601_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363610_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363585_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363595_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363584_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HM363575_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363582_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtcccct
HM363583_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggccgcttggggatctatcgtcccct
KF849713_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
HM363588_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363589_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363592_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363587_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363565_X_P-E      gtcagcgctgaaccctgcggacgacccgtcccggggtcgcttggggatctatcgtcccct
HM363566_X_P-E      gtcagcgctgaatcctgcggacgacccgtcacggggtcgcttggggatctatcgtcccct
HM363576_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363579_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
HM363580_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
MT426115_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
HM363581_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
KF849715_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849720_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849717_X_P-E      gtcggcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
GQ161785_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FN594750_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MF772355_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849726_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
FN545822_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
AB274975_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
KF849725_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849728_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849727_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
LT623846_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctttcgtcccct
KF849716_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
DQ060822_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF922438_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
KF922439_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
KT192626_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
MH464856_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
AY935700_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
EU239223_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MW679683_X_P-E      gtcggcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
EU239219_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
KF849714_X_P-E      gtcggcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849722_X_P-E      gtcggcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849719_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
DQ060823_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
OM256457_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849721_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
AY738144_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
AY738145_X_C-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
AY738146_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
AY738147_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KF849723_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
DQ060824_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggggctatcgtcccct
JQ000009_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
MN507841_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctatcgtcccct
KM606739_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AB219529_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgtttgggggtctatcgtcccct
LT623843_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgtttgggggtctmtcgtcccct
FN545827_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494691_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494705_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776745_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
HM363593_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatgtatcgtcccct
MG776426_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MF772358_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB205188_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161822_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
GQ161768_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggccgcttggggatctctcgtcccct
MN507840_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MF772357_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MF772356_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AB205190_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161833_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
MF772361_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
FN594765_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
AB274980_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MF772359_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
LT623847_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctctcgtcccct
HM363608_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FN594749_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
EU239220_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB915178_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB219534_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatgtatcgtcccct
MW455165_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161820_X_P-E      gtcrgcgctgaatcctgcggacgayccgtctcggggtcgcttggggatctatcgtcccct
MN507844_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MW455164_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ962189_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161836_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MN507847_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363609_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
FN594753_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580626_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HM363594_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctaccgtcccct
GQ161812_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
GQ161796_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AB205189_X_P-E      gtcagcgctgaatcctgcggacgacccgtttcggggtcgcttggggatctttcgtcccct
MH580645_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctgtcgtcccct
FN545842_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274985_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AB274984_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FN594758_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AM494689_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494692_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MG776737_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
KF170741_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgtttgggggtctatcgtcccct
HM363578_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
GQ161823_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161797_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161762_X_P-E      gtccgcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
GQ161759_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MW455161_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FN545821_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
EU239222_X_P-E      gtcagcgctaaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB201287_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274981_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
HQ700550_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
HQ700552_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MH580648_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
AB205129_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB205192_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
LT623845_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MH580631_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MH580632_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MH580652_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MH580617_X_P-E      gtcggcgctgaatcctgcggacgacccatctcggggtcgcttggggatttatcgtcccct
MH580628_X_P-E      gtcggcgctgaatcctgcggacgacccatctcggggtcgcttggggatttatcgtcccct
MH580644_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatttatcgtcccct
GQ161790_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161799_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161805_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161818_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161821_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MT570163_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgtttgggggtctatcgtcccct
DQ060826_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
DQ060827_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
KM606738_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580650_X_P-E      gtcaacgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
LT623849_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
LT623842_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KT749841_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
KF849724_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
GQ161831_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161811_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161803_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161771_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggctctatcgtcccct
FN594760_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
FN594759_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtccyct
FN594752_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
FN545841_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
EU239224_X_P-E      gtcagcgctgaatcctgcggacgatccgtctcggggtcgcttgggggtctatcgtcccct
AM494711_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274969_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
AB194948_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
AB106564_X_C-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MN507842_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MT570162_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggactctctcgtcccct
MW082636_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB205191_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
DQ060825_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttggggatctatcgtcccct
KF849718_X_P-E      gtcagcgctgaatcctgcggacgacccctctcggggtcgcttgggggtctctcgtcccct
KU736894_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttgggggtctctcgtcccct
GQ161782_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
GQ161792_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
GQ161814_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
MW455162_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctgggggtctatcgtcccct
AB091256_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctgtcgtcccct
AB091255_X_P-E      gtcagcgctgaatcctgcggacgatccgtctcggggtcgcttggggatctatcgtcccct
MN507843_X_P-E      gtcagcgctgaatcctgcggacgatccgtctcggggtcgcttggggatctatcgtcccct
FN594766_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AB274979_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274973_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FN545823_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MH580633_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
FJ349226_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatttctcgtcccct
AY739674_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AY739675_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcctct
FJ349237_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FJ349238_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161815_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MT570164_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ962197_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MW679682_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
MH918655_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
MH580640_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttagggatctatcgtcccct
MH580641_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttagggatctatcgtcccct
MH580614_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
MH580615_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
MH580616_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
MH580618_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
MH580619_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
MH580620_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
MH580623_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
MH580651_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctgtcgtcccct
MF772362_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcctct
MF772360_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
KU736897_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736898_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
HQ700551_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
HM363571_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccct
HM363572_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccct
HM363570_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcacttggggatctatcgtcccct
HM363569_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcacttggggatctatcgtcccct
GQ161834_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctaccgtcccct
GQ161825_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
GQ161781_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161769_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccct
GQ161779_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccct
GQ161764_X_P-E      gtcggcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FN594761_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
FN594756_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
FJ349239_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
EU239226_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
EU239217_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
DQ060830_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494706_X_P-E      gtcagcgttgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AB274978_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274977_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB201290_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggccgcttgggggtctatcgtcccct
AB201288_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
AM494832_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494712_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494714_X_P-E      gtcagcgctgaaccctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MN507846_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MN507848_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MH580630_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494710_X_P-E      gtcagcgctgaatcctgcggacgacccatctcggggtcgcttggggatctatcgtcccct
AM494697_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494709_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736901_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ962190_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MW455163_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736899_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KU736895_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccct
KU736896_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccct
MN507845_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctttcgtcccct
GQ161755_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161835_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274972_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274970_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
JQ000008_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ962196_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MH580622_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
HM363577_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580621_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580625_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580637_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
AB201289_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctgggggtctatcgtcccct
AB915175_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580634_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580635_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580636_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
FN594763_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
MH580647_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctatcgtcccct
HM363573_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtcccct
MZ962192_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161778_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161810_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MZ962195_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161757_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161760_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161808_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161793_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161827_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161807_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
DQ060828_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtcccct
DQ060829_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttgggggtctctcgtcccct
GQ161783_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161824_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
MZ962198_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
LT623848_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161801_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161794_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ962194_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161776_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161784_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161789_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161828_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161765_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161763_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161761_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161830_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161756_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161795_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274982_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274976_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274974_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161816_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB194947_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
EU239221_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161770_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161772_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161777_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161780_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161787_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161791_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161798_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161800_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161804_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161819_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161829_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161832_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
KX186584_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MH580638_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ962193_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ962199_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MH580624_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
MH580646_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
MH580649_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
MH580629_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
FJ349227_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161826_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161817_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161773_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161802_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctctcgtcccct
GQ161758_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161766_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161774_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
MZ962191_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AB274971_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
GQ161786_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcttggggatctatcgtcccct
AM494694_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
AM494696_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
AM494700_X_P-E      gtcagcgctgaatcctgcggacgacccgtctcggggtcgcctggggatctatcgtcccct
                    ***     * ** *  *  ***** ** *   **** *   * **       * *** * 

HM363596_X_P-E      tctccgtctggcgttccggccgaccacggggcgcacctctctttacccgggctccccgtc
GQ161775_X_P-E      tctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363567_X_P-E      tctccgtctgccgttccggccgaccacgcggcgcacctctctttacgcggtctcccagtc
HM363604_X_P-E      tctccgtctgccgttccggccgaccacgcggcgcacctctctttacgcggtctcccagtc
HM363611_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363605_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtt
HM363597_X_P-E      tctccgtctgccgttccgggcgaccacggggcgcacctctctttacgcggtctccccgtc
JQ272902_X_P-E      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtc
MG776800_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
HM363606_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
LT623851_X_P-E      tctccgtctgccgttccagccgwccacggggcgcacctctctttacgcggtctccccgtc
AB219533_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363600_X_P-E      tctccgtctgccgttccggccgtccacggggcgcacctctctttacccggtctccccgtc
HM363607_X_P-E      tctccgtctgccgttccggccgtccacggggcgcacctctctttacccggtctccccgtc
MF772354_X_P-E      tctccgtctgccgttccaaccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594751_X_P-E      tctccgtctgccgttccgaccaaccacggggcgcacctctctttacgcggtctccccgtc
LT623844_X_P-E      tctccgtctgctgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776772_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736904_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MK321264_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MK720631_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MK720632_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776534_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776744_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736911_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736903_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736902_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494695_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776512_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776798_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MN967528_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF170742_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494699_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494698_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736892_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
AB915176_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736891_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
MN967526_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494701_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494707_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736909_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MN967527_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776797_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776734_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776503_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776427_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776403_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776799_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494703_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB915177_X_P-E      tctccgtctgccgttccagccaaccacggggcgcacctctctttacgcggtctccccgtc
AM494702_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494693_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494704_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494715_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494708_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494713_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494717_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MN967529_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776678_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776550_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736910_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736905_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736893_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736900_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494690_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736913_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736906_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736907_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736908_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736912_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
X75657_X_P-E        tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363598_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
LT623850_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FJ349240_X_P-E      tctccgtctgccgttccaaccgaccacggggcgcacctctctttacgcggtctccccgtc
AB915180_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776729_X_P-E      tctccgtctgccgtttcgaccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363603_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
FN594748_X_P-E      tctccgtctgccgttccarccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363599_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363602_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594762_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccatc
HM363591_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363590_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363586_X_P-E      tctccgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtc
HM363574_X_P-E      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363568_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363601_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363610_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363585_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363595_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363584_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363575_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363582_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363583_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849713_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363588_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363589_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363592_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363587_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363565_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363566_X_P-E      tctccgtctgccgttccggccgtctacgggtcgcacctctctttacgcggtctccccgtc
HM363576_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363579_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363580_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MT426115_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363581_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849715_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849720_X_P-E      cctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849717_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161785_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594750_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MF772355_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849726_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
FN545822_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274975_X_P-E      cctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849725_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849728_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849727_X_P-E      tctccgtctgccgttccagccgaccacggggcgtacctctctttacgcggtctccccgtc
LT623846_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849716_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ060822_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF922438_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF922439_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KT192626_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH464856_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
AY935700_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU239223_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MW679683_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU239219_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849714_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849722_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849719_X_P-E      tctccgtctgccgttccgaccgactacggggcgcacctctctttacgcggtctccccgtc
DQ060823_X_P-E      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtc
OM256457_X_P-E      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849721_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY738144_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctgtacgcggtctccccgtc
AY738145_X_C-E      tctccgtctgccgttccagccgaccacggggcgcacctctctgtacgcggtctccccgtc
AY738146_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctgtacgcggtctccccgtc
AY738147_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctgtacgcggtctccccgtc
KF849723_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ060824_X_P-E      tctccgtctgccgttccagccgacgacggggcgcacctctctttacgcggtctccccgtc
JQ000009_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MN507841_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KM606739_X_P-E      tctccgtctgccgttccaaccgtccacggggcgcacctctctttacgcggtctccccgtc
AB219529_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
LT623843_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
FN545827_X_P-E      tctccggctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494691_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494705_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776745_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363593_X_P-E      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776426_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MF772358_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB205188_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161822_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161768_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MN507840_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MF772357_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MF772356_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AB205190_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161833_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MF772361_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594765_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274980_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MF772359_X_P-E      tctccgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtc
LT623847_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363608_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594749_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
EU239220_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB915178_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacgtctctttacgccgtctccccgtc
AB219534_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MW455165_X_P-E      tctccgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtc
GQ161820_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MN507844_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MW455164_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962189_X_P-E      tctccgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtc
GQ161836_X_P-E      tctccgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtc
MN507847_X_P-E      tctccgtctgccgttccggccaaccacggggcgcacctctctttacgcggtctccccgtc
HM363609_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594753_X_P-E      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580626_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363594_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161812_X_P-E      tctccgtctgccgttccacccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161796_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AB205189_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580645_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FN545842_X_P-E      tctccggctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccrtc
AB274985_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274984_X_P-E      cctgcgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594758_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494689_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494692_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MG776737_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF170741_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363578_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161823_X_P-E      tctccgtctgccgttccagccgcccacggggcgcacctctctttacgcggtctccccgtc
GQ161797_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161762_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161759_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MW455161_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
FN545821_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU239222_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcagtctccccgtc
AB201287_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
AB274981_X_P-E      actccgtctgccgttccacccgtccacggggcgcacctctctttacgcggtctccccgtc
HQ700550_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccatc
HQ700552_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccatc
MH580648_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB205129_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AB205192_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctatatttacgcggtctccccgtc
LT623845_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580631_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580632_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580652_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580617_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580628_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580644_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161790_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161799_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161805_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161818_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161821_X_P-E      tctccgtctgccgttcccgccgaccacggggcgcacctctctttacgcggtctccccgtc
MT570163_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ060826_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ060827_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KM606738_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580650_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
LT623849_X_P-E      actccgtctgccgttccagccgaccacggggcgcacctctctttacgcggcctccccgtc
LT623842_X_P-E      tctccgtctgccgttccrgccgaccacggggcgcacctctctttacgcggtctccccgtc
KT749841_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849724_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161831_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161811_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161803_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161771_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594760_X_P-E      tctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594759_X_P-E      tctccgtctgccgttccgcccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594752_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccatc
FN545841_X_P-E      tctccggctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccatc
EU239224_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494711_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274969_X_P-E      actccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB194948_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB106564_X_C-E      tctccgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtc
MN507842_X_P-E      tctccgtctgccgttccggccgcccacggggcgcacctctctttacgcggtctccccgtc
MT570162_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MW082636_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB205191_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ060825_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KF849718_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736894_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161782_X_P-E      tctctgtctgccgttccatccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161792_X_P-E      tctctgtctgccgttccatccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161814_X_P-E      tctctgtctgccgttccatccgaccacggggcgcacctctctttacgcggtctccccgtc
MW455162_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB091256_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB091255_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MN507843_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594766_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274979_X_P-E      tctccgtctgccgttccggccgaccacggggcacacctctctttacgcggtctccccgtc
AB274973_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
FN545823_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580633_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FJ349226_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY739674_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AY739675_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FJ349237_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FJ349238_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161815_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MT570164_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
MZ962197_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MW679682_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggcctccccgtc
MH918655_X_P-E      tctccgtctaccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580640_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580641_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580614_X_P-E      tctccgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580615_X_P-E      tctccgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580616_X_P-E      tctccgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580618_X_P-E      tctccgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580619_X_P-E      tctccgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580620_X_P-E      tctccgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580623_X_P-E      tctccgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580651_X_P-E      tctccgactgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MF772362_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MF772360_X_P-E      tctccgtctgccgttccaaccgtccacggggcgcacctctctttacgcggtctccccgtc
KU736897_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736898_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HQ700551_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363571_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363572_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363570_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363569_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161834_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161825_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161781_X_P-E      tctccgtctgccattccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161769_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161779_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161764_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594761_X_P-E      tctccgtctgccgttccagccgwccacggggcgcacctctctttacgcggtctccccgtc
FN594756_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FJ349239_X_P-E      tctccgtctgccgttccaaccgaccacggggcgcacctctctttacgcggtctccccgtc
EU239226_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU239217_X_P-E      actccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ060830_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494706_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274978_X_P-E      actccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274977_X_P-E      gctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB201290_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AB201288_X_P-E      tctccatctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494832_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494712_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494714_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MN507846_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MN507848_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580630_X_P-E      tctccgtctgccgttccagccgaccacggggcgaacctctctttacgcggtctccccgtc
AM494710_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494697_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494709_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736901_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962190_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MW455163_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736899_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736895_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
KU736896_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MN507845_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161755_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161835_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274972_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274970_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
JQ000008_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962196_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580622_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363577_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580621_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580625_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580637_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
AB201289_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB915175_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580634_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580635_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580636_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
FN594763_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580647_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
HM363573_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962192_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
GQ161778_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
GQ161810_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
MZ962195_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
GQ161757_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161760_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161808_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161793_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161827_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161807_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ060828_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
DQ060829_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161783_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161824_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962198_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
LT623848_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161801_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161794_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962194_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161776_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161784_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161789_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161828_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161765_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161763_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161761_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161830_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161756_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161795_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274982_X_P-E      tctccgtctgccgttccaaccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274976_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274974_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161816_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB194947_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
EU239221_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161770_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161772_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161777_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161780_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161787_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161791_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161798_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161800_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161804_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161819_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161829_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161832_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
KX186584_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580638_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962193_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962199_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MH580624_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
MH580646_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
MH580649_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
MH580629_X_P-E      tctccgtctgccgttccagccgtccacggggcgcacctctctttacgcggtctccccgtc
FJ349227_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161826_X_P-E      tctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161817_X_P-E      tctccgtctaccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161773_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161802_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161758_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161766_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161774_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
MZ962191_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AB274971_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
GQ161786_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494694_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494696_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
AM494700_X_P-E      tctccgtctgccgttccagccgaccacggggcgcacctctctttacgcggtctccccgtc
                     **    **    *  *   *  * *** * *  ** * * * *** * * *****  * 

HM363596_X_P-E      tggggcttctcatctggcggaccgggtggacttcgcttcacctctggacgtcacatggag
GQ161775_X_P-E      tgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
HM363567_X_P-E      tgtgccttctcatccgccggaccgtgagcacttcgcttcaccttcgcacgtcgcatggag
HM363604_X_P-E      tgtgccttctcatccgccggaccgtgagcacttcgcttcaccttcgcacgtcgcatggag
HM363611_X_P-E      tgtggcttcacatctgccggtccgtggggacttcccttcacctctgcacgtctcatggcg
HM363605_X_P-E      tgtgccttatcatccaacggaccgtgtgcacttcgcttcacctttccacgtcgcatggaa
HM363597_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ272902_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
MG776800_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
HM363606_X_P-E      tgtgccttatcatccgccggtccgtgtgcacttcgcttcacctctccacgtcgcatggag
LT623851_X_P-E      tgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgtacgtcgcatggag
AB219533_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
HM363600_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363607_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF772354_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594751_X_P-E      tgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
LT623844_X_P-E      tgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggar
MG776772_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736904_X_P-E      tgttccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggar
MK321264_X_P-E      tgtaccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MK720631_X_P-E      tgtaccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MK720632_X_P-E      tgtaccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776534_X_P-E      tgtgccttctcgcctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776744_X_P-E      tgtgccttctcgcctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736911_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736903_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736902_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494695_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776512_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776798_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN967528_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF170742_X_P-E      tgtrccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494699_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494698_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736892_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
AB915176_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736891_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN967526_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494701_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494707_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736909_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN967527_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776797_X_P-E      tgtgcctgttcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776734_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776503_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776427_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776403_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776799_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494703_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB915177_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494702_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494693_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494704_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494715_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494708_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494713_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494717_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN967529_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776678_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776550_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736910_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736905_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736893_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736900_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494690_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736913_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736906_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736907_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736908_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736912_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
X75657_X_P-E        tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363598_X_P-E      tgtgccttctcatctgccggaccgtgtggacttcgcttcacctctgcacgtcgcatggag
LT623850_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ349240_X_P-E      tgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB915180_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
MG776729_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363603_X_P-E      tgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctccacgtcgcatggaa
FN594748_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363599_X_P-E      tgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363602_X_P-E      tgtgccttatcatccgccggaccgtgtgcacttcgcttcacctttgcacgtcgcatggag
FN594762_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
HM363591_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363590_X_P-E      tgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363586_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363574_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363568_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363601_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363610_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363585_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363595_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363584_X_P-E      tggggcttctcatctgccggaccgtgtgcacttcccttcacctctgcacgtcgcatggag
HM363575_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363582_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363583_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849713_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363588_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363589_X_P-E      tgtggcttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363592_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363587_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtagcatggag
HM363565_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctttgcacgtcgcatggag
HM363566_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363576_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363579_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363580_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MT426115_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363581_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849715_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849720_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849717_X_P-E      tgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161785_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594750_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
MF772355_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849726_X_P-E      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctacacgtcgcatggag
FN545822_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
AB274975_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849725_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849728_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849727_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
LT623846_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849716_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ060822_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF922438_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF922439_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KT192626_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH464856_X_P-E      tgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY935700_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU239223_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MW679683_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU239219_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849714_X_P-E      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849722_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849719_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ060823_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
OM256457_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849721_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY738144_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY738145_X_C-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY738146_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY738147_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849723_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgttgcatggag
DQ060824_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ000009_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN507841_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM606739_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB219529_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
LT623843_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN545827_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494691_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494705_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776745_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363593_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
MG776426_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF772358_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB205188_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
GQ161822_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161768_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
MN507840_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
MF772357_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF772356_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB205190_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161833_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF772361_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594765_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274980_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF772359_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
LT623847_X_P-E      tgtgccttctcayctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363608_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594749_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU239220_X_P-E      tgtgccttctcacctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB915178_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB219534_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MW455165_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161820_X_P-E      tgtgccttctcrtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN507844_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MW455164_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962189_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161836_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN507847_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363609_X_P-E      tgtgccttctcatctgccgcaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594753_X_P-E      tgtgccttctcatctgccggwccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580626_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
HM363594_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161812_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
GQ161796_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB205189_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580645_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcgtcacctctgcacgtcgcatggag
FN545842_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274985_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274984_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594758_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494689_X_P-E      tgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494692_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MG776737_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF170741_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363578_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161823_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
GQ161797_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161762_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161759_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
MW455161_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
FN545821_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU239222_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB201287_X_P-E      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274981_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HQ700550_X_P-E      tgtgccttctcgtctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HQ700552_X_P-E      tgtgccttctcgtctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580648_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB205129_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB205192_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
LT623845_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580631_X_P-E      tgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580632_X_P-E      tgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580652_X_P-E      tgtgccttctcgtctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580617_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580628_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580644_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161790_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161799_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161805_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161818_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161821_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MT570163_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ060826_X_P-E      tgttccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ060827_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KM606738_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580650_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
LT623849_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
LT623842_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KT749841_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849724_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161831_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161811_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161803_X_P-E      tgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
GQ161771_X_P-E      tgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594760_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594759_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594752_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
FN545841_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaa
EU239224_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494711_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274969_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB194948_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB106564_X_C-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN507842_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MT570162_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MW082636_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB205191_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ060825_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KF849718_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736894_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161782_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161792_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161814_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MW455162_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB091256_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB091255_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN507843_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594766_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274979_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274973_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN545823_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580633_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ349226_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY739674_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AY739675_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ349237_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ349238_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161815_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MT570164_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcacggag
MZ962197_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MW679682_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH918655_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580640_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580641_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580614_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580615_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580616_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580618_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580619_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580620_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580623_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580651_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF772362_X_P-E      tgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MF772360_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736897_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736898_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HQ700551_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363571_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363572_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363570_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363569_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161834_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161825_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161781_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161769_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161779_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161764_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594761_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594756_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ349239_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU239226_X_P-E      tgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU239217_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ060830_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494706_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274978_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274977_X_P-E      tgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB201290_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB201288_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494832_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494712_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494714_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN507846_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN507848_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580630_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494710_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494697_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494709_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736901_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962190_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MW455163_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736899_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736895_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KU736896_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MN507845_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161755_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161835_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274972_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274970_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
JQ000008_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962196_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580622_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363577_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580621_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580625_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580637_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB201289_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB915175_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580634_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580635_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580636_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FN594763_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580647_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
HM363573_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962192_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161778_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161810_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962195_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161757_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161760_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161808_X_P-E      tgtgcctactcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161793_X_P-E      tgtgccttctcgtctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161827_X_P-E      tgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161807_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ060828_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
DQ060829_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161783_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161824_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962198_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
LT623848_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161801_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161794_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962194_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161776_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161784_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161789_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161828_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161765_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161763_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161761_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161830_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161756_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161795_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274982_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274976_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274974_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161816_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB194947_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
EU239221_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161770_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161772_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161777_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161780_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161787_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161791_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161798_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161800_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161804_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161819_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161829_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161832_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
KX186584_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580638_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962193_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962199_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580624_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580646_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580649_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MH580629_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
FJ349227_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161826_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161817_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161773_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161802_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161758_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161766_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161774_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
MZ962191_X_P-E      tgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AB274971_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
GQ161786_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494694_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494696_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
AM494700_X_P-E      tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggag
                    **   **   *  *   **  *** * * ***** * ******    ****  ** **  

HM363596_X_P-E      accacggtgaacgcgcag------caaatcttgcccaaggtcttacataagaggactctt
GQ161775_X_P-E      accaccgtgaacgcccat------cagatcctgcccaaggtcttacataagaggactctt
HM363567_X_P-E      accaccgtgaacgttcac------caactctcgcccaaggtcatacataagaggactctt
HM363604_X_P-E      accaccgtgaacgttcac------caactctcgcccaaggtcatacataagaggactctt
HM363611_X_P-E      cccaccgtgaacgcccac------caaagcttggccaaggtcttacataagaggactctt
HM363605_X_P-E      accaccgtgaacgctcac------caactcttgcccaaggttttatataagaggactctt
HM363597_X_P-E      accatcgtgaacgcccac------caactcttggccaagggcttatataagaggactctt
JQ272902_X_P-E      accaccgtgaacgcccgc------caaatcttgcccaaggtcttacataagaggactctt
MG776800_X_P-E      accaccgtgagcgcccac------caactattgcccaaggtcttatataagaggactctt
HM363606_X_P-E      accacagtgaacgctcac------caactctcgcccaaggtcggtcataagaggactctt
LT623851_X_P-E      accaccgtgaacgcccac------caattcttgcccaaggtcttacataagaggactctt
AB219533_X_P-E      accaccgtgaacgcccacgctcatcaaatattgcccaaggtcttatataagaggactctt
HM363600_X_P-E      accaccgtgaacgcccac------cagtgcttgcccaaggtcttacataagaggactctt
HM363607_X_P-E      accaccgtgaacgcccac------cagtgcttgcccaaggtcttacataagaggactctt
MF772354_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN594751_X_P-E      accaccgtgaacgcccac------caamtattgcccaaggtcttatataagaggactatt
LT623844_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttayataagaggactctt
MG776772_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagaggactctt
KU736904_X_P-E      accaccgtgaacgcccac------cgaayattgcccaaggtcttacataagaggactctt
MK321264_X_P-E      acccccgtgaacgcccgc------caaatattgcccaaggtcttacataagaggactctt
MK720631_X_P-E      acccccgtgaacgcccgc------caaatattgcccaaggtcttacataagaggactctt
MK720632_X_P-E      acccccgtgaacgcccgc------caaatattgcccaaggtcttacataagaggactctt
MG776534_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagaggactctt
MG776744_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagaggactctt
KU736911_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagaggactctt
KU736903_X_P-E      accaccgtgaacgcccac------cgaatattgcccaaggtcttacataagaggactctt
KU736902_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggttttacataagaggactctt
AM494695_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagcggactctt
MG776512_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MG776798_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MN967528_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KF170742_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494699_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494698_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736892_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttayataagaggactctt
AB915176_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736891_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MN967526_X_P-E      accaccgtgaacgcccac------caagtattgcccaaggtcttacataagaggactctt
AM494701_X_P-E      accaccgtgaacgcccac------caagtattgcccaaggtcttacataagaggactctt
AM494707_X_P-E      accaccgtgaacgcccac------caagtattgcccaaggtcttacataagaggactctt
KU736909_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MN967527_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MG776797_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MG776734_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagaggactctt
MG776503_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MG776427_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagaggactctt
MG776403_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MG776799_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494703_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagaggactctt
AB915177_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttatataagaggactctt
AM494702_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494693_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494704_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494715_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494708_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494713_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494717_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MN967529_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MG776678_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MG776550_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736910_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736905_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736893_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736900_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AM494690_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736913_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736906_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736907_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736908_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KU736912_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
X75657_X_P-E        accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
HM363598_X_P-E      accatcgtgaacgccccc------caaatattggccaagggcttacataaaaggactctt
LT623850_X_P-E      accaccgtgaacacccac------caaatcttgcccaaggtcttacacaagaggactctt
FJ349240_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AB915180_X_P-E      accaccgtgagcgcccac------caaatattgcccaaggtcttatataagaggactctt
MG776729_X_P-E      accaccgtgaacgcccac------caggtcttgcccaaggtcttacataagaggactctt
HM363603_X_P-E      accaccgtgaacgcccac------caaagcttgcccaaggtcttacataagaggactctt
FN594748_X_P-E      accaccgtgaacgcccac------caaatmttgcccaaggtcttacataagaggactctt
HM363599_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363602_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN594762_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
HM363591_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
HM363590_X_P-E      accaccgtgaacacccac------caaatattgcccaaggtcttacataagaggactctt
HM363586_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactgtt
HM363574_X_P-E      accaccgtgaacgcccac------cgaatcttgcccaaggtcttacataagaggactctt
HM363568_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
HM363601_X_P-E      accaccgtgaacgcccac------caaacattgcccaaggtctaacataagaggactctt
HM363610_X_P-E      accaccgtgaacgcccac------caaacattgcccaaggtctaacataagaggactctt
HM363585_X_P-E      accaccgtgaacgcccac------cacctcttgcccaaggtcttacataagaggactctt
HM363595_X_P-E      accaccgtgaacgcccac------cacctcttgcccaaggtcttacataagaggactctt
HM363584_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363575_X_P-E      acctccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363582_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363583_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849713_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
HM363588_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
HM363589_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
HM363592_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363587_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363565_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363566_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363576_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363579_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363580_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MT426115_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363581_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849715_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849720_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
KF849717_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161785_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagcggactctt
FN594750_X_P-E      accaccgtgaacgcccac------caagtcttgcccaaggtcttacataagaggactctt
MF772355_X_P-E      accaccgtgaacgcccac------caattcttgcccaaggtcttacataagaggactctt
KF849726_X_P-E      accaccgtgaccgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN545822_X_P-E      accaccgtgagcgcccac------caaagcttgcccaaggtcttacataagaggactctt
AB274975_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849725_X_P-E      accaccgtgaacgcccac------caaagcttgcccaaggtcttacataagaggactctt
KF849728_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactcty
KF849727_X_P-E      accaccgtgaacgcccac------cacgtcttgcccaaggtcttacataagaggactctt
LT623846_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849716_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
DQ060822_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF922438_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF922439_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KT192626_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH464856_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AY935700_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
EU239223_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MW679683_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
EU239219_X_P-E      accaccgtgaacgcccac------aaaatcttgcccaaggtcttacataagaggactctt
KF849714_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849722_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849719_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
DQ060823_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
OM256457_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849721_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AY738144_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AY738145_X_C-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AY738146_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AY738147_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849723_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
DQ060824_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
JQ000009_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MN507841_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KM606739_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB219529_X_P-E      accaccgtgaacgcccat------caacctttgcccaaggtcttacataagaggactctt
LT623843_X_P-E      accaccgtgaacgcccac------caattcttgcccaaggtcttacataagaggactctt
FN545827_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AM494691_X_P-E      acccccgtgaacgcccac------aagatcttgcccaaggtcttacataagaggactctt
AM494705_X_P-E      accaccgtgaacgcccac------aagatcttgcccaaggtcttacataagaggactctt
MG776745_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
HM363593_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
MG776426_X_P-E      accaccgtgaacgcccac------caaatattgcctaaggtcttacataagaggactctc
MF772358_X_P-E      gccaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
AB205188_X_P-E      accaccgtgaacgcccac------caattcttgcccaaggtcttatataagaggactctt
GQ161822_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
GQ161768_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
MN507840_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
MF772357_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
MF772356_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
AB205190_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
GQ161833_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
MF772361_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
FN594765_X_P-E      accaccgtgaacgcccac------caaagcttgcccaaggtcttacataagaggactctt
AB274980_X_P-E      accaccgtgaacgcccac------cgaagcttgcccaaggtcttacataagaggactctt
MF772359_X_P-E      accaccgtgaacgcgcgc------caaatcttgcccaaggtcttacataagaggactctt
LT623847_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363608_X_P-E      accaccgtgaacgcccac------caactcttgcccaagggcttacataagaggactctt
FN594749_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
EU239220_X_P-E      accaccgtgaacgcccac------caaagcttgcccaaggtcttacataagaggactctt
AB915178_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AB219534_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MW455165_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161820_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MN507844_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MW455164_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962189_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161836_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MN507847_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363609_X_P-E      accaccgtgaacgcccac------ctaatcttgcccaaggtcttacataagaggactctt
FN594753_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttatataagaggactctt
MH580626_X_P-E      accaccgtgaacgcccac------cgactcttgcccaaggtcttacataagaggactctt
HM363594_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
GQ161812_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161796_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB205189_X_P-E      accaccgtgaacgcccac------caaatcttgcccagggtcttacataagaggactctt
MH580645_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN545842_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AB274985_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagcggactctt
AB274984_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
FN594758_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AM494689_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AM494692_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MG776737_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
KF170741_X_P-E      accaccgtgaacgcccat------caaatcttgcccaaggtcttgcataagaggactctt
HM363578_X_P-E      accatcgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
GQ161823_X_P-E      accaccgtgaacgcccac------caaagcttgcccaaggtcttacataagaggactctt
GQ161797_X_P-E      accaccgtgaacgcccac------caattcttgcccaaggtcttacataagaggactctt
GQ161762_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161759_X_P-E      accaccgtgaacgcccac------caagtcttgcccaaggtcttacataagaggactctt
MW455161_X_P-E      accaccgtgaacgcccac------caagtcttgcccaaggtcttacataagaggactctt
FN545821_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttgcataagaggactctt
EU239222_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB201287_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274981_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HQ700550_X_P-E      accaccgtgaacgcccac------cagatcttgcccaaggtcttacataagaggactctt
HQ700552_X_P-E      accaccgtgaacgcccac------cagatcttgcccaaggtcttacataagaggactctt
MH580648_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
AB205129_X_P-E      accaccgtgaacgcccat------caaatcttgcccaaggtcttacataagcggactctt
AB205192_X_P-E      accaccgtgaacgcccat------caaatcttgcccaaggtcttacataagcggactctt
LT623845_X_P-E      accaccgtgaacgcccac------caawtcttgcccaaggtcttacataagaggactctt
MH580631_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580632_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580652_X_P-E      accaccgtgaacgcccac------caaattttgcccaaggtcttacataagaggactctt
MH580617_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580628_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580644_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
GQ161790_X_P-E      accaccgtgaacgcccac------ctaatcttgcccaaggttttacataagaggactctt
GQ161799_X_P-E      accaccgtgaacgcccac------ctaatcttgcccaaggttttacataagaggactctt
GQ161805_X_P-E      accaccgtgaacgcccac------ctaatcttgcccaaggttttacataagaggactctt
GQ161818_X_P-E      accaccgtgaacgcccac------ctaatcttgcccaaggttttacataagaggactctt
GQ161821_X_P-E      accaccgtgaacgcccac------ctaatcttgcccaaggttttacataagaggactctt
MT570163_X_P-E      accaccgtgaacgcccat------caaatcttgcccaaggtcttacataagcggactctt
DQ060826_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
DQ060827_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KM606738_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580650_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
LT623849_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
LT623842_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KT749841_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849724_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161831_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161811_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161803_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
GQ161771_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN594760_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
FN594759_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
FN594752_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
FN545841_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
EU239224_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AM494711_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274969_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB194948_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB106564_X_C-E      accaccgtgaacgcccac------cgaatcttgcccaaggtcttacataagaggactctt
MN507842_X_P-E      accaccgtgaacgcccac------cgaatcttgcccaaggtcttacataagaggactctt
MT570162_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MW082636_X_P-E      accaccgtgaacgcccac------caaatgttgcccaaggtcttacataagaggactctt
AB205191_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
DQ060825_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KF849718_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataataggactctt
KU736894_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161782_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161792_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161814_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MW455162_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB091256_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB091255_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MN507843_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN594766_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AB274979_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274973_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN545823_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580633_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
FJ349226_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AY739674_X_P-E      accaccgtgaacacccac------caaatcttgcccaaggtcttacataagaggactctt
AY739675_X_P-E      accaccgtgaacacccac------caaatcttgcccaaggtcttacataagaggactctt
FJ349237_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FJ349238_X_P-E      accaccgtgaacgctcac------caaatcttgcccaaggtcttacataagaggactctt
GQ161815_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MT570164_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962197_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MW679682_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH918655_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580640_X_P-E      accaccgtgaacgcccac------caactattgcccaaggtcttacataagaggactctt
MH580641_X_P-E      accaccgtgaacgcccac------caactattgcccaaggtcttacataagaggactctt
MH580614_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580615_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580616_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580618_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580619_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580620_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580623_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MH580651_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MF772362_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MF772360_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KU736897_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KU736898_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HQ700551_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363571_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
HM363572_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
HM363570_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363569_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
GQ161834_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161825_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161781_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161769_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161779_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161764_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN594761_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN594756_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FJ349239_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
EU239226_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
EU239217_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
DQ060830_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AM494706_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AB274978_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274977_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB201290_X_P-E      accaccgtgaacgcccac------caagtcttgcccaaggtcttacataagaggactctt
AB201288_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AM494832_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AM494712_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AM494714_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MN507846_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MN507848_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580630_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AM494710_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AM494697_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
AM494709_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
KU736901_X_P-E      accaccgtgaacgcccac------caactcttgcccaaggtcttacataagaggactctt
MZ962190_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttatataagaggactctt
MW455163_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KU736899_X_P-E      accaccgtgaacgcccac------catatcttgcccaaggtcttacataagaggactctt
KU736895_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KU736896_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MN507845_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161755_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161835_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274972_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274970_X_P-E      accaccgtgaacgcccac------caattcttgcccaaggtcttacataagaggactctt
JQ000008_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962196_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580622_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363577_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580621_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580625_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580637_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB201289_X_P-E      accaccgtgaacgcccat------caaatcttgcccaaggtcttacataagaggactctt
AB915175_X_P-E      accaccgtgaacgcccat------caaatcttgcccaaggtcttacataagaggactctt
MH580634_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580635_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580636_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FN594763_X_P-E      accaccgtgaacgcccac------caaatattgcccaaggtcttacataagaggactctt
MH580647_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
HM363573_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962192_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161778_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161810_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962195_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161757_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161760_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161808_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161793_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161827_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161807_X_P-E      accaccgtgaacgcccac------acaatcttgcccaaggtcttacataagaggactctt
DQ060828_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
DQ060829_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161783_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161824_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962198_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
LT623848_X_P-E      accaccgtgaacgcccac------caattcttgcccaaggtcttacataagaggactctt
GQ161801_X_P-E      accaccgtgaacgcccac------caaatgttgcccaaggtcttacataagaggactctt
GQ161794_X_P-E      accaccgtgaacgcccac------caaattttgcccaaggtcttacataagaggactctt
MZ962194_X_P-E      accaccgtgaacgcccac------caaattttgcccaaggtcttacataagaggactctt
GQ161776_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161784_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161789_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161828_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161765_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161763_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161761_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161830_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161756_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161795_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274982_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274976_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggccttacataagaggactctt
AB274974_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161816_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB194947_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
EU239221_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161770_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161772_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161777_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161780_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161787_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161791_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161798_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161800_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161804_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161819_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161829_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161832_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
KX186584_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580638_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962193_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962199_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580624_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580646_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580649_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MH580629_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
FJ349227_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161826_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161817_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161773_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161802_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161758_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161766_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161774_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
MZ962191_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AB274971_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
GQ161786_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AM494694_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AM494696_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
AM494700_X_P-E      accaccgtgaacgcccac------caaatcttgcccaaggtcttacataagaggactctt
                     **   **** *   *                * * * **      * **  ***** * 

HM363596_X_P-E      ggactctccgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
GQ161775_X_P-E      ggactctcagcaatgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaa
HM363567_X_P-E      ggacactcggcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
HM363604_X_P-E      ggacactcggcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
HM363611_X_P-E      ggactctcggcaatgtcaacgaccgaccttgagggatacttcaaagactgtttgtttaag
HM363605_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
HM363597_X_P-E      ggactctcgggaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaag
JQ272902_X_P-E      ggactctctgctatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776800_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcctacttcaaagactgtttgttcaag
HM363606_X_P-E      ggactctcggcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
LT623851_X_P-E      ggactctctgcaatgtcaacgtccgaccttgaggcatacttcaaagactgtttgtttaaa
AB219533_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
HM363600_X_P-E      ggactctcggcaatgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaag
HM363607_X_P-E      ggactctcggcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MF772354_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaa
FN594751_X_P-E      ggactctctgcaatgtcaacgaccggccttgaggcatacttcaaagactgtttgtttaaa
LT623844_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776772_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
KU736904_X_P-E      ggactctctacaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MK321264_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MK720631_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MK720632_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776534_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776744_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
KU736911_X_P-E      ggactctctgtaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
KU736903_X_P-E      ggactctctacaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaag
KU736902_X_P-E      ggactctctgctatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
AM494695_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776512_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776798_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MN967528_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
KF170742_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
AM494699_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
AM494698_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
KU736892_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
AB915176_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
KU736891_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MN967526_X_P-E      ggactttctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
AM494701_X_P-E      ggactttctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
AM494707_X_P-E      ggactttctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
KU736909_X_P-E      ggactctctacaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MN967527_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776797_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776734_X_P-E      ggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaa
MG776503_X_P-E      ggactctctgcaa