HBVdb

Dataset for nucleotide sequence P of genotype D

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****    * *    *     ***  *       * *   ** *     *  * **  *     *  *   *  * **  
ATGCCCCTATCtTATCAACACTTCCGGAGACTACTGTTgTTAGACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCG
     t     c       g        a t tg    a     ga a                         a
                                g                                           
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*            *      *    *     *   *  *      * *  *             *           **  
CCTCGCAGACGAAGgTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGG---AAtCTCAATGTTAGTATTCCTTGGA
              a   a                    a  a            gcc ca c     a   c  c    
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  * * *     *    **  * **  *                 * *   *     **               
CTCATAAGGTGGGaAAcTTTACgGGGCTTTATTCTTCTACTGTaCCTGTCTTTAAcCCTCATTGGAAAA---CACCcTCT
    c  a     g gt     t       c  ct   ct   a       t  aa c           c  aa  
             t        a                    g                                t   
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
** *     ** *   *              *       **        *          **  *    *  *      *
TTTCCTAATATACATTTACACCAAGACATtATCAAAAAATGTGAACAaTTTGTAGGcCCACTcACAGTcAATGAgAAAaG
     c  c  t  c  g  t   a t  c  tg c g         g  c  g  t  g   ta t     a   c 
                                   g                       t        g           
                                                                    a           

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *            **     *     *  *  *     ** **  * ** **           * **     *  
AAGAcTGCAATTgATTATGCCTGCTAGGTTTTATCCAAAtGTTACCAAATATTTgCCATTgGATAAGGGTATTAAACCTT
gc gt aa    a  c        c  a  c  c  t  gtcc  t        a  c  a  c     c  c     
                                       a g               t                      
                                       c                                        

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ** *      *    **   *      *   *          * *    *     * **  *    **    ** *  
ATTATCCAGAACATCTAGTTAATCATTACTTCCAAACcAGACAtTATTTACACACTCTATGGAAGGCGGGTaTATTATAT
 c  c  g      t g   g          t   g t     c        t t   t   c    a   g t     c
              g                      a                    g              c      
              a                                                                 

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             *    *        ** *           *      ** **        **  ******        
AAGAGAGAAACAACACaTAGCGCCTCATTTTGTGGGTCACCATATTCTTGGGAACAAgAgCTACAGCATGGG---GC---
         t t  t g            c     a   tt    a           a ta   gt              
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
              *  *  *  * * *  *    ** **  * **     * *    **  ** *  * *  *      
---------AGAATCTTTCCACCAGCAATCCTCTGGGATTCTTTCCCGACCACCAGTTGGATCCAGCCTTCAGAGCAAAC
                g                             g  t           c          a   g  t
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *  *  *****   * *  *    *   *    * *      *     **    **    **  *      
ACcGCAAATCCAGATTGGGACTTCAATCCCAACAAGGACACCTGGCCAGACGCCAACAAGGTAGGAGCTGGAGCATTCGG
t aaac  c           t                  c t      a t              g  c     c     
  t g                                    a                          g           
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *   *      * *                     *                                   
GCTGGGaTTCACCCCACCgCACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATAcTACAAACcTTGCCAgCAA
a ca  tc    a  g  a        t  g  a  a        g  a     a    cga g     tg     aa g
  y   g           t                                                   c      t  
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                       *                                        
ATCCGCCTCCTGCcTCtACCAATCGCCAGTCAGGAAGGCAGCCTACCCCgCTGTCTCCACCTTTGAGAaACACTCATCCT
    a     g tag c    g   t g a g  gc a  a  c  t  t   a       gc     g t  g  c   
             t                             g     a                       c      
                                                                                

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                          *  ** 
CAGGCCATGCAGTGGAAcTCCACAACCTTCCACCAAACTCTGCAAGATCCCAGaGTGAGAGGCCTGTATTTCCCTGCTGG
  a  ag a       ct aa a  at  t  t   g g  a         -ag----ag---------c-t        
                          a     a                   --    -t     a   - -        
                                                           -                    

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                         *  *     *     *                   *      * *     *   *
TGGCTCCAGTTCAGGAACAGTAAACCCTGTTCCGACTACTGcCTCTCcCaTATCGTCAATCTTCTCGAGGATTGGGGACC
      a c   c agg   cg          t   c    ta    a tc  ta             a        g  
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 **        ****          *          *      * *          * *****  * *     *   * *
cTGCGCTGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTgCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACA
t  tatc         a               c             t                      c          
     aa                                                                         
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     * *                **   **  * *  ***  * **      *     **      *         ** 
AGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGaACtACCGTGTGTCTTGG
 a       g       aa                              g            g ac          g   
                                                              c  g              
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
   *   * **  *  *        *     **   * * *   *  ***          **  * ***           
CCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAACTTGTCCTGGTTATCGCTGGATGTGTC
                                          t        g           a     t       a  
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 ** *        **     * ** *  *  *      *  *  * *   *  ***  *    ****    *   *  * 
TGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATG
                a                 t          c           g            c gg      
                                                                         c      
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     ***    **        *              * *           **      *      *        ** * 
TTGCCCGTtTGTCCTCTAATTCCA------GGATCtTCAACc---------ACCAGCacGGGACCATGCaGAACCTGCAc
        c     aa g                 c  g  t               gt    t c   cag  t    t
        g                          a     a                             c  a     
                                   g                                            

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *        *        *              *  ** **    ***     *     *** * ***  ****** * 
GACTcCTGcTCAAGGAACCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTCCCA
  t at  t  g   c         at      a  c  t    ta     c t   ta    c              
                                 t                                              
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**** ** ** **    ** *  * **  * * **   ***  *  ** *   * *   *     *     **    ** 
TCCCATCATCcTGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCcTGGCTCAGTTTACTAGTGCCA
       g  t                         c        t            a                     
          a                                               t                     
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *  **  * * *        *  * *   *   **    *     *    ** *     *    *** ** *     
TTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAGTCT
                c              t   c       t      g t                       aa  
                                                    c                           
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *      *  *           *    *  *****     *  *     * *   * **       ** **
GTACAGCATCTTGAGTCCCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTAACAAAAC
 cttca  c      g      a                      c c   c    cg     c g  t   cct  g  
  g  c                                             g                            
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *****  *     *  * *    ***        * *        **  *     * **    ** **     
aAAaAGATGGGGTTACTCTtTacATTTcATGGGcTATGTCATTGGAtGTTATGGgTCaTTGCCACAAGAtCACATCAtAC
t  gc g      tcacc ga c  t     t   agt     ta  cgg   c  a  g  g  a  t  tgg  
g                            g           cg                    g       a  
                                 a                                           c  

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *       **        *    **           *  * **  *  *    *   *  *    *   *    
AgAAAATCAAAGAaTGTTTTAGAAAACTTCCTgTTAACAGgCCTATTGATTGGAAAGTcTGTCAACGtATTGTGGGTCTT
ta  gc g     c  c  cc g     c   a c  tc a               a     ga a     a  c  c
 c           t                                          g        c            
 t           g                                            t                     

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
         *  ** ** **    **  * *  ** **  *  *     *     *     *    *             
TTGGGtTTTGCTGCCCCTTTtACACAATGTGGTTATCCTGCtTTaAtGCCcTTGTATGCaTGTATTCAaTCTAAGCAGGC
c a  g     c  t  g  c  g        g         g a   t  a     c  c c   gg gcga     
     c        a        t                        a                 c  c        
                                                                     a        

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      *          *   *    **           * *       *  **  ***       * ** *      
TTTCACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTAAACAATACCTGAACCTTTACCCCGTTGCCCGGCAACGGCCAG
   t  c  t   g  c g  t   a     t a a c       ta   c               ta        t t 
                  c                           t                   a           c 
                                                                                

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  * ** ** *   *    **  * ** ***   *  * *    *       **      * *  ***  *     *  
GTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCTTGGTCATGGGCCATCAGCGCATGCGTGGAACCTTT
    a                              t          ct  a                           
                                                                                
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      *     *  ** ***   *  ** *      * ** ** **  *  * *** **  *   **     *    * 
ctGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGtTTTGCTCGCAGCAGGTCTGGAGCAAACATTcTCGG
tc       t a           c              a     c            c       g  g   c ca t  
ga                                                                      g       
ag                                                                              

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  **  * *      *  * ** ** ** *  **    *  ** *****  * **  *    **  *  **    *  
GACgGATAACTCTGTTGTtCTCTCCCGCAAATATACATCgTtTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGC
   t      c  a   a     t  g   g  a                 a                
   a        g        t                 c                                        
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *     **  *  * * *****           *****                          * **       ** 
GCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCcGCGGACGACCCtTCTCGGGGcCGCTTGGGaCTCTcTCGT
                         c  a           t           g        t  tc    gactgaa   
                                        g           c                 t    t    
                                                                           g    

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *     *          *  *   *  * ***** *     ****  **  *   **  * **  **           *
CCCCTTCTCCGTCTGCCGTTtCGaCCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCCGTCTGTGCCTTCTCATCT
  t  ca at c        c at                             c                        
                       c                                                        
                       g                                                        

      2490      2500      2510      2520      2530      2540      2550 
....:....|....:....|....:....|....:....|....:....|....:....|....:....|.
  * *       *            *  ***    **                                  
GCCGGACCGTGTGCACTTCGC---TTCACCT---CTG---CACGTC------GCATGGAGACCACCGTG-A
     t                  g                                  a           
                                                                       
                                                                       
© 1998-2020Legal notice