HBVdb

Dataset for nucleotide sequence P of genotype D

[Download (right click)] [Download Frequencies (right click)] [Sequences] [Alignment]

        10        20        30        40        50        60        70        80
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
****      *    *     ***  *       * *                                           
ATGCCCCTATCtTATCAACACTTCCGGAGACTACTGTTgTTAGACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCG
     t     c       g        a t tg    a     ga a  c     a        g             a
                                g                 t     c                       
                                                                                

        90       100       110       120       130       140       150       160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                *           **  
CCTCGCAGACGAAGgTCTCAATCGCCGCGTCGCAGAAGATCTCAATCTCGGG---AAtCTCAATGTTAGTATTCCTTGGA
              a   a              c     a  a            gcc ca c     a   c  c    
                                                                                
                                                                                

       170       180       190       200       210       220       230       240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  *  *  *   *     *    **  * **  *                 * *   *     **               
CTCATAAGGTGGGaAAcTTTACgGGGCTTTATTCTTCTACTGTaCCTGTCTTTAAcCCTCATTGGAAAA---CACCcTCT
    c  a     g gt     t       c  ct   ct   a       t  aa c              aa  
             t        a                    g                                t   
                                                                                

       250       260       270       280       290       300       310       320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * *     ** *   *              *       **        *          **  *    *  *      *
TTTCCTAATATACATTTACACCAAGACATtATCAAAAAATGTGAACAaTTTGTAGGcCCACTcACAGTcAATGAgAAAaG
     c  c  t  c  g  t   a t  c  tg c g         g  c  g  t  g   ta t     a   c 
                                   g                       t        a           
                                                                    g           

       330       340       350       360       370       380       390       400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
     *            **     *     *  *  *     ** **  * ** **           * **     *  
AAGAcTGCAATTgATTATGCCTGCTAGGTTTTATCCAAAtGTTACCAAATATTTgCCATTgGATAAGGGTATTAAACCTT
   gt aa    a  c        c  a  c  c  t  gtcc  t        a  c  a  c     c  c     
                                       a g               t                      
                                       c                                        

       410       420       430       440       450       460       470       480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  ** *      *    **   *      *              * *    *     * **  *    **     * *  
ATTATCCAGAACATCTAGTTAATCATTACTTCCAAACcAGACAtTATTTACACACTCTATGGAAGGCGGGTaTATTATAT
 c  c  g     ct g   g          t   g t     c        t t   t   c    a   g t      
              g                      a                    g              c      
              a                                                                 

       490       500       510       520       530       540       550       560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
             *    *        *  *           *      ** **        **  **** *        
AAGAGAGAAACAACACaTAGCGCCTCATTTTGTGGGTCACCATATTCTTGGGAACAAgAgCTACAGCATGGG---GC---
         t t  t g      t     c     a   tt    a           a ta   gt              
                                                                                
                                                                                

       570       580       590       600       610       620       630       640
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                    *  *  * * *  *    ** **  * **     * *    **  ** *  * *  *   
---------AGA---ATCTTTCCACCAGCAATCCTCTGGGATTCTTTCCCGACCACCAGTTGGATCCAGCCTTCAGAGCA
                   g                             g  t           c          a   g
                                                                                
                                                                                

       650       660       670       680       690       700       710       720
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            *  *  *****   * *  *    *   *    * *      *     **    **            
AACACcGCAAATCCAGATTGGGACTTCAATCCCAACAAGGACACCTGGCCAGACGCCAACAAGGTAGGAGCTGGAGCATT
  tt aaac  c           t                  c t      a t              g  c     c  
     t g                                    a                          g        
                                                                                

       730       740       750       760       770       780       790       800
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                                
CGGGCTGGGaTTCACCCCACCgCACGGAGGCCTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATAcTACAAACcTTGCCAg
   a ca  tc    a  g  a        t  g  a  a        g  a     a    cga g  c  tg     a
         g           t                                                   c      
                                                                                

       810       820       830       840       850       860       870       880
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                          *                                     
CAAATCCGCCTCCTGCcTCtACCAATCGCCAGTCAGGAAGGCAGCCTACCCCgCTGTCTCCACCTTTGAGAaACACTCAT
a g    a       tag c    g   t g a ga gc a  a  c  t  t   a       gc  c  g t  g  c
                t                             g     a                       c   
                                                                            a   

       890       900       910       920       930       940       950       960
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
                                                                             *  
CCTCAGGCCATGCAGTGGAAcTCCACAACCTTCCACCAAACTCTGCAAGATCCCAGaGTGAGAGGCCTGTATTTCCCTGC
     a  ag a       ct aa a  at  t  t   g g  a          ag----ag---------c-t     
                             a                          -    -t     a   - -     
                                                              -                 

       970       980       990      1000      1010      1020      1030      1040
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**                          *  *     *     *                   *      *         
TGGTGGCTCCAGTTCAGGAACAGTAAACCCTGTTCCGACTACTGcCTCTCcCaTATCGTCAATCTTCTCGAGGATTGGGG
         a c   c agg   cg          t   c    ta    a tc  t              a        
                                                                                
                                                                                

      1050      1060      1070      1080      1090      1100      1110      1120
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
  * **        ***           *          *      * *          * *****    *     *   
ACCcTGCGCTGAACATGGAGAACATCACATCAGGATTCCTAGGACCCCTgCTCGTGTTACAGGCGGGGTTTTTCTTGTTG
 t  tatc         a               c             t                      c       
        aa                                                                      
                                                                                

      1130      1140      1150      1160      1170      1180      1190      1200
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *     * *                **   **  * *  ***  *  *      *     **                
ACAAGAATCCTCACAATACCGCAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGaACtACCGTGTGTCT
    a               aa                              g            g ac          g
                                                                 c  g           
                                                                                

      1210      1220      1230      1240      1250      1260      1270      1280
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**    *   * **  *  *        *     **   * * *   *  ***          **  * **         
TGGCCAAAATTCGCAGTCCCCAACCTCCAATCACTCACCAACCTCCTGTCCTCCAACTTGTCCTGGTTATCGCTGGATGT
                                             t        g           a     t       
                                                                                
                                                                                

      1290      1300      1310      1320      1330      1340      1350      1360
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
    ** *        **     * ** *  *  *      *  *  * *   *  * *  *    ****        * 
GTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGT
a                  a          c      t          c                        c gg   
                                                                            c   
                                                                                

      1370      1380      1390      1400      1410      1420      1430      1440
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *      ***    **        *              *             **      *      *        **
ATGTTGCCCGTtTGTCCTCTAATTCCA------GGATCtTCAACc---------ACCAGCacGGGACCATGCaGAACCTG
           c     aa gc                c  g  t               gt    t c   cag  t  
           g                          a     a                                   
                                      g                                         

      1450      1460      1470      1480      1490      1500      1510      1520
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *  *        *        *                 ** **    ***     *     *** * ***  *** **
CAcGACTcCTGcTCAAGGAACCTCTATGTATCCCTCCTGTTGCTGTACCAAACCTTCGGACGGAAATTGCACCTGTATTC
   t at  t  g   c          t      a  c  t    ta     c t   ta    c           
                                    t                                           
                                                                                

      1530      1540      1550      1560      1570      1580      1590      1600
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 * **** ** ** **    ** *  *  *  * * **   ***     ** *   *     *     *     **    
CCATCCCATCATCcTGGGCTTTCGGAAAATTCCTATGGGAGTGGGCCTCAGCCCGTTTCTCcTGGCTCAGTTTACTAGTG
          g  t                         c        t            a                  
             a                                               t                  
                                                                                

      1610      1620      1630      1640      1650      1660      1670      1680
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*  *  *  **  * * *        *  *     *   **    *     *    ** *     *    ***  * *  
CCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTTTCAGTTATATGGATGATGTGGTATTGGGGGCCAAG
  c                c              t           t      g t           g           a
                                                       c                        
                                                                                

      1690      1700      1710      1720      1730      1740      1750      1760
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
            *      *  *           *    *  ** **     *  *              *         
TCTGTACAGCATCTTGAGTCCCTTTTTACCGCTGTTACCAATTTTCTTTTGTCTTTGGGTATACATTTAAACCCTAACAA
a   cttca  c     ag      a                      a c   c    cg     c g  t   cct  
     g  c                                             g                         
                                                                                

      1770      1780      1790      1800      1810      1820      1830      1840
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
 *              *****        *  * *    ***        * *        **  *     * **    *
AACaAAaA------GATGGGGTTACTCTtTAcATTTcATGGGcTATGTCATTGGAtGTTATGGgTCaTTGCCACAAGAtC
g  t  gc       g     g  tcacc ga c  t     t   agt     ta  cgg   c  a  g  g  a 
   g                 c                  g           cg                    g 
                                          a                                     

      1850      1860      1870      1880      1890      1900      1910      1920
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* **           *       **        *    **           *  * **  *  *    *      *    
ACATCAtACAgAAAATCAAAGAaTGTTTTAGAAAACTTCCTgTTAACAGgCCTATTGATTGGAAAGTcTGTCAACGtATT
 t  tgg  ta  gc g c   c  c  cc g     c   a c  tc a               a     ga a   
      a   c           t                                          g        c   
          t           g                                            t            

      1930      1940      1950      1960      1970      1980      1990      2000
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*                 *  ** ** **    **  * *  ** **  *        *     *          *    
GTGGGTCTTTTGGGtTTTGCTGCCCCTTTtACACAATGTGGTTATCCTGCtTTaAtGCCcTTGTATGCaTGTATTCAaTC
  a  c  cc a  g     c  t  g  c  g        g        g  g a   t  a     c  c c   gg 
              c        a        t                 c        a                 c  
                                                  a                             

      2010      2020      2030      2040      2050      2060      2070      2080
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
          *      *          *   *    **           * *       *  **  ***       * *
TAaGCAGGCTTTCACTTTCTCGCCAACTTACAAGGCCTTTCTGTGTAAACAATACCTGAACCTTTACCCCGTTGCCCGGC
gcga        t  c  t      c g  t   a     t aca c       ta   c               ta   
c                          c                                               a    
a                                                                               

      2090      2100      2110      2120      2130      2140      2150      2160
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
* *      *  *  * ** *   *    **  * ** ***   *  * *    *       **      * *  ***  
AACGGCCAGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGCTGGGGCTTGGTCATGGGCCATCAGCGCATGCGT
     t t                                  t          ct  a                  
       c                                                                        
                                                                                

      2170      2180      2190      2200      2210      2220      2230      2240
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
*     *        *     *  ** ***   *  ** *      * ** ** **     * **  **  *   **   
GGAACCTTTctGGCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGtTTTGCTCGCAGCAGGTCTGGAGCAAA
         tc       t a           c              a     c            c       g  g  
         ga                                                                     
         ag                                                                     

      2250      2260      2270      2280      2290      2300      2310      2320
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
       *  *  **  * *      *  * ** **    *  **    *  ** *****  * **  *    **  *  
CATTcTCGGGACgGATAACTCTGTTGTtCTCTCCCGCAAATATACATCgTtTCCATGGCTGCTAGGCTGTGCTGCCAACT
 c ca t     t      c  a   t     t  g   g  a                 a         
 g          a        g        a                 c                               
                                                                                

      2330      2340      2350      2360      2370      2380      2390      2400
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
**    *    *     **  *  * * *****           *****                          * ** 
GGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCcGCGGACGACCCtTCTCGGGGcCGCTTGGGa
       a                          c  a           t           g        t  tc    g
                                                 g           c           g     t
                                                                                

      2410      2420      2430      2440      2450      2460      2470      2480
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
      **  *     *          *  *   *     **** *     ****  **  *   **  * **  **   
CTCTcTCGTCCCCTTCTCCGTCTGCCGTTtCGaCCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCCGTCTGTGCC
actga      t  ca at c        c at  a                            c               
    t                           c                                               
    g                           g                                               

      2490      2500      2510      2520      2530      2540      2550      2560
....:....|....:....|....:....|....:....|....:....|....:....|....:....|....:....|
        *  * *       *            *  ***    **                                  
TTCTCATCTGCCGGACCGTGTGCACTTCGC---TTCACCT---CTG---CACGTC------GCATGGAGACCACCGTG-A
              t                  g                            a     a           
                                                                                
                                                                                
© 1998-2022Legal notice