HBVdb

Dataset for nucleotide sequence P of genotype D

[Download (right click)] [Alignment] [Repertoires]

1256 sequence(s)

>gnl|hbvcds|AB048701_P_P-D Feature FT:CDS AB048701_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacaacgaggcaggaccattagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttactgggctttattcttcttccgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatcaagatattatcaaaaaatgtgaacagtttgtagggccgctcacagtcaatgagaaaagaaggtt
gaaattgatcatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtattaaaccttattatc
cagaacatctagttaatcattacttccacactagacactatttacacactctatggaaggcgggtatcttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcggactagggttcaccccaccgca
cggaggccttctggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctacca
atcgacagtcaggacggcagcctaccccgctgtctccacctctgagaaccactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccacattgtcaacctcctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtgttggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttaccgctgttacc
aattttcttttatctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtattctctaaatttcatgggcta
tgtcattggaagttggggatcattgccacaagatcacatcagacacaaaatcaaagaatgttttagaaaactccctgttc
acaggcctattgattggaaagtgtgccaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgggtat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggccctgtcgtcctcttctccacctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB078031_P_P-D Feature FT:CDS AB078031_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FH1-YS). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggacaccaaatatttgccattagattagagtatttaaacttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatcttatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaactccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagccgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctggcaacgtaatgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB078032_P_P-D Feature FT:CDS AB078032_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AH1-SY). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggacaccaaatatttgccattagattagagtatttaaacttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatcttatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaactcagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagccgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttcccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctggcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB078033_P_P-D Feature FT:CDS AB078033_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IS1-OY). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggacaccaaatatttgccattagattagagtatttaaacttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatcttatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaactccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagccgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctggcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB090268_P_P-D Feature FT:CDS AB090268_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacggcaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactaacaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagtctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggacccccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB090269_P_P-D Feature FT:CDS AB090269_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaataaatgtgaacaatttgtaggtccactcacagtcaatgagaacagaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaacatggaga
agaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaat
ccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggatt
caccccaccgcacggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctc
ctgcatctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatg
cagtggaactccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccag
ttcaggaacagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctga
acatggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaataccgcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattc
gcagtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatctccaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctat
gtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaa
aattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttttt
accgctgttaccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaaaagatggggttactctttaaa
tttcatgggctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaa
aacttcctgttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttaca
caatgtggttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaa
ggcctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacg
caacccccactggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatact
gcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctc
ccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
cgtcggcgctgaatcccgcggacgacccttctcggggccgcttgggaatctatcgtccccttctccgtctgccgtttcgt
ccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttt
acctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB090270_P_P-D Feature FT:CDS AB090270_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaagccagacattatttacacactctttggaaggcgggtatattatataagaga
gaatcaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagggagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgccttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB104709_P_P-D Feature FT:CDS AB104709_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG64). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacgggactttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattattaaaaaatgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB104710_P_P-D Feature FT:CDS AB104710_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG105). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgcccttggataagggcatcaaaccttattatc
cagaacatctagttaatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatatcagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagcgggagcattcgggctgggattcaccccaccgca
cggaggcctgttggggtggagccctcaggctcagggcacactacaaaccctgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggtta
tgtcattggatgttatggctcattgccacaagagcacatcatacacaaaatcaaagaatgttttagaaaacttcctgtta
accgacctattgattggaaagtctgtcaacgtattgtgggccttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB104711_P_P-D Feature FT:CDS AB104711_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG104). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacgggactttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattattaaaaaatgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctcaaacctgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtcttgggggccaagtctgtgcagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB104712_P_P-D Feature FT:CDS AB104712_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG75). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
acaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacacatcctcaggccatgcagtggaactcc
actaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggtta
tgtcattggatgttatggatcattgccacaagatcacattatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcagtgtggttat
cctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
tcaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB109475_P_P-D Feature FT:CDS AB109475_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctatgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB109476_P_P-D Feature FT:CDS AB109476_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcaatggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB109477_P_P-D Feature FT:CDS AB109477_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB109478_P_P-D Feature FT:CDS AB109478_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacatcaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatgacaaccttgccagcaaatccgcctcctgcgtctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB109479_P_P-D Feature FT:CDS AB109479_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttctatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaactcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactcctg
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB110075_P_P-D Feature FT:CDS AB110075_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataaaacaaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataattctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB116266_P_P-D Feature FT:CDS AB116266_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccatcaaggacacctggccagacgccaagaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggaccagccctcaggctcagggcataatagaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgaggagcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggcaaagctgctccatttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttcgttg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtcgtccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB119251_P_P-D Feature FT:CDS AB119251_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctctattcctctactgtacctatctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatcttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacacgcatcctcaagccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggctactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB119252_P_P-D Feature FT:CDS AB119252_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacaccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
accgacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB119253_P_P-D Feature FT:CDS AB119253_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctatctttaacccttattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggctactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB119254_P_P-D Feature FT:CDS AB119254_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaaccttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgggggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagccgaccccactgtcaccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacattatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggccgattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB119255_P_P-D Feature FT:CDS AB119255_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacccctccgca
cggaggccttttggggtggagccctcaggctcagggcatgatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccggtcaaccaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
caaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatctgcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagactgtgcagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB119256_P_P-D Feature FT:CDS AB119256_P_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcatcacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggtgtgaagccctcaggctcagggcataatacaaaccatgccagtatatccgcctcctgcatctacca
atcgaaggtcaaaaaggcagcctaccccgctgtctccacctttgagagacactcatccccaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtgtttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggacttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgagacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcctgggactccctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB120308_P_P-D Feature FT:CDS AB120308_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacaccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggacccccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB126581_P_P-D Feature FT:CDS AB126581_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU301). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggtggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctggacgactcctggtcaaggaacctctatgtatccctcctg
gtgctggaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggata
tgtcattggatgttatgggtcattgccacaagaacacattatacagaaaatcaaggaatggtttagaaaacttcctgtta
acaggcctattgattgtaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttactcaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB188241_P_P-D Feature FT:CDS AB188241_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA25). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggacac
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattgggaaacacccttttttcct
aagatacatttacaccaagacattatcaaaaaatgtgaacaatttgtgggcccactcacagtcaatgaaaaacgcagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgcccttggataagggtattaaaccttattatc
cagaacatttagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttgggttggagccctcaggctcagggcataatacaatccttgccagtaaatccgcctcctgcatccacca
atcgccagtcaggaaggcaacctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattca
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttccggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgatgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctatcctctaatt
ccaggatcgtcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttgaattttatgggcta
tgtcattggatgttatgggtcattgccacaggatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtatcgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgccattgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtttgccgtttcgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB188242_P_P-D Feature FT:CDS AB188242_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA38). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtgcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggccctctcacagtcaatgaaaaacgaagact
gcaattaatcatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctcgttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcgttcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatgacaaccttgccagcaaatccgcctcctgcatctacca
atcgcaagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaat
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcgaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaccaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaactcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcgacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB188244_P_P-D Feature FT:CDS AB188244_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZ24). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggwcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttctatccaaatcttaccaaatatttgcccttggacaagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacayagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactct
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtggccctcatg
ttgctgtaccaaacctacggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatggg
agtgggcctcagcccgtttctcktggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactccctacacttcatgggtta
cataattggaagttatgggacattgccacaggatcacattgtacagaagatcaaacactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaccggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccttcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB205126_P_P-D Feature FT:CDS AB205126_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-IF714-1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB205127_P_P-D Feature FT:CDS AB205127_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU313-2). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
acaaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
actatacacttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttctatcccaatgttaccaaatatttgccattagataagggtattaaaccctattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatcgacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatccacaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcttg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccaccagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactctgttgttctctcccgcaaatatac
gtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB205128_P_P-D Feature FT:CDS AB205128_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU316-1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaaggcattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattaattatgcctgctaggttttatcctaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattcttccccgaccaccagttggatccagccttcagagcaaacaccgcacatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggttccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcttcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaagtaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
ccttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcctccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctccgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB210820_P_P-D Feature FT:CDS AB210820_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaagacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttcttctgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaaaagt
aaaccctgttccgactactgcctctccaatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgcacaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaacgatggggttactctttaaatttcatgggtta
tgtcattggatgtcatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgccttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacctacaaaacctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcccctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgattgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB210821_P_P-D Feature FT:CDS AB210821_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB210822_P_P-D Feature FT:CDS AB210822_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB222709_P_P-D Feature FT:CDS AB222709_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV34). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcca
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacaatcaatgagaaaagaagact
gcaattgattatgcctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagagcatgtagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcattctacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaagaaggcagcctacccctctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgygctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtctttgcctcaagatcacatcatacagaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcagttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB222710_P_P-D Feature FT:CDS AB222710_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6M). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2496 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgatcatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaacaagacattatttacacactctatggaaggcgggtatattatatcagaga
gaaacaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcattctacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaagaaggcagcctacccctctgtctccacctttgcgaaacactcatcctcaggcacagtggaactccaca
accttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagtaaa
ccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgygctgaacatggagaacatca
catcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagt
ctagactcgtggtggacttctctcaattttctcgggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctc
caatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctct
tcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattcca
ggatcttcaactaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctgttg
ctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagt
gggcctcagcccgtttctgctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttgg
ctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaat
tttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggctatgt
cattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgttaaca
ggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgcccctttcacacaatgtggttatcct
gctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaa
acaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggtt
ggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctagcc
gcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatc
atttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatc
ctgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgc
acctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgc
atggagaccaccgtga
>gnl|hbvcds|AB222711_P_P-D Feature FT:CDS AB222711_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNV24). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacaatcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggtctttctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB222712_P_P-D Feature FT:CDS AB222712_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV61). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtgcctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttgcaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaacgttaccaaatatttgcccttggataagggtattaagccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatctkgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtaatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB222713_P_P-D Feature FT:CDS AB222713_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttaccccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgctttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctatg
taaccaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttcttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB246347_P_P-D Feature FT:CDS AB246347_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttacccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB246348_P_P-D Feature FT:CDS AB246348_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacaatcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaatactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaagttcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatatatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatgcagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB267090_P_P-D Feature FT:CDS AB267090_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ehime 22-HS). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaactccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagccgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB270539_P_P-D Feature FT:CDS AB270539_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL200F). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccatgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaatttcatgggcta
tgtcattggatgttatgggtcattgccacaggaacacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtggatat
cctgctctaatgcccttgtatgcatgtattcaatctaaacaagctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactcggttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|AB270540_P_P-D Feature FT:CDS AB270540_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL241F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=2478 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgttagtgttccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaaaacattatcgagaaatgtgaacaatttgtaggcccactcacagtaaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggagaagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatatncttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagccgacccctctgtctccacctttgagaaacacccatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatccccctgctggtggctccagttcaggaacagtaaaccctgttccgaccactgt
ctctcatatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggac
ccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggact
tctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctc
ctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcc
tcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctaattccaggatcttcaaccaccagc
acgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcgga
cggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcccgtttct
cctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatg
atgtggtattgggggccaagaatgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
atacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggaagttatgggtc
attgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattgattggaaag
tctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgctttaatgcccttgtat
gcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttgtgtaaacaatacctgaaccttta
ccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggcc
atcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagc
aggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatcgtttccatggctgctagg
ctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctc
ggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacggggcgcacctctctttacgcggac
tccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB270541_P_P-D Feature FT:CDS AB270541_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL47F). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttgatattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaagaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagaga
gaaacaacacatagcgcctcattttatgggtcatcatatccttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccaatcaggaaggcagccgacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagaatgwrcagcatcttgagtccctttttaccgctgtkacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgtttcgctcgcagcaggtctggggcgaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB270542_P_P-D Feature FT:CDS AB270542_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL12F). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtgttccttggacac
ataaggtgggaaactttacggggctttattcttctactgtgcctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gnaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgaaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctcygactccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcctggagaccaccgtga
>gnl|hbvcds|AB270543_P_P-D Feature FT:CDS AB270543_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL209F). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gaaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB270546_P_P-D Feature FT:CDS AB270546_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL88F). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaatactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgckgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB270547_P_P-D Feature FT:CDS AB270547_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL295F). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggackc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaacatgcagaacctgcacgacccctgctcgcggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaactccctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactccgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB270548_P_P-D Feature FT:CDS AB270548_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL207F). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacgttatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gaaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcctacgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctcgactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtc
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaggtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactgtctcgtccccttctctgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB270550_P_P-D Feature FT:CDS AB270550_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL247F). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatccaactgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaacaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactcyttacatttcatgggcta
tgtcattggawgttatgggtcattgccacaagagcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaggtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcaacaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctga
atcctgcggacgacccgtctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB330367_P_P-D Feature FT:CDS AB330367_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ14HBV). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaatgcttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaagctttacggggctttattcttctaatgttcctgtctttaaccctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcaggtatcttatataagaga
gaaacagcacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctctcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacactgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcggggaggcagcctactcctctgtctccgcctttgagagtcactcatcctcaggccatgcagtggaattcc
acgaccttccaccaaactctgcaagattccagagtaagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctaacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgcttgatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgccctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggtcactctctacatttcatgggcta
tgtcattggatgttatgggtccttgccacaagatcacatcagacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacgcaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacatacaaggcctttttgtg
caaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgattgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB330369_P_P-D Feature FT:CDS AB330369_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ5HBV). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgcgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgcaaacttcctgtta
ataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB330370_P_P-D Feature FT:CDS AB330370_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ6HBV). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgcgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttgtgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggcta
tgtcattggatgttatgggtcattgccacaagagcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
atagacctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtggttat
cctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB471856_P_P-D Feature FT:CDS AB471856_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB471857_P_P-D Feature FT:CDS AB471857_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O-C2). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB493846_P_P-D Feature FT:CDS AB493846_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17UC). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaattttactgggctctattcttctactgtaccggtctttaatcctcattggaaaacgccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtatcaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaacccagattgggac
ttcaatcccaacaaggacacctggccggacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgcctctcccttatcgtcaatctactcgaggattggggaccctgcgctgaacatggagaaca
ttacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctacattttatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttactcaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gatggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcgaacattattgggactgataactctgttgtcctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB555496_P_P-D Feature FT:CDS AB555496_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA31). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttctggagactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctgtatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggaccacttacaattaatgagaaaagaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatatttttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagaaactcatcctcaggccatgcagtggaactcc
acaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggggccctgctaatgatacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttatatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctaccgatccatactgcggaactcctg
gccgcttgttttgctcgcagcaggtctggagcaaacattattgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctgtcgtcccctcatccgtttgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB555497_P_P-D Feature FT:CDS AB555497_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA37). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttctggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacaattaatgagaaaagaagact
gcaattaattatgcctgctaggttttatccaaatgttacaaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagaaactcatcctcaggccatgcagtggaaatcc
acgaacttccagcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaagattgggggccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcctggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtccttgccacaaaatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccaccagcgcatgcgtggaacctttccggctcctctaccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactcggttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgattgggactctatcgtcccctcctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB555500_P_P-D Feature FT:CDS AB555500_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA64). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacaasgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgtgtcgcagaagatctcaatctcgggacgcccaatgctagtattccttggactc
ataaggtgggaaactttacgggactttattcttacaatgtacctgtctttaacccaaattggaaaacacactcttttcct
aatatacatttacatgaagacattatcaaaaaatgtgaacaatttgtaggcccacttacaattaatgaaaaaagaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataaaggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaaa
aaaacaacccgtagcgcctcattttgggggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccggacgccaacaaggtaggagccggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaagccatgcagtggaactcc
acgaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
taacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctgctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgctcaacaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtgtacatttaaaccctgacaaaactaaaagatggggttactgtttaaatttcatggggta
tgtcattggaagttatgggtccttgccacaaaatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccaccagcgcatgcgtggaacctttccggctcctctaccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactcggttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgattgggactctatcgtcccctcctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB555501_P_P-D Feature FT:CDS AB555501_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA65). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacaattaatgagaaaagaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcacctttttcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccacctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgatgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctctaatt
ccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttatgtctttgggtattcatataaaccctaacaaaacaaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggtttcgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggctctatcgtcccctcctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB583680_P_P-D Feature FT:CDS AB583680_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Pkst7912). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtcccggtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
acaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgaagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctccgctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674405_P_P-D Feature FT:CDS AB674405_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraHCCA12). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagatt
gcaatggattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattttttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttgaacccaaacaaaacaaaaagatggggttactctttacatttcatgggcta
taycattggatgttatgggtcattgccacaggatcacattatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674406_P_P-D Feature FT:CDS AB674406_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB23). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aacatacatttacaccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaaatgattatgcctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaacaagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcctcattctgtgggtcaccttattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacaactggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggcccagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaagatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggagccaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctactt
ccaggatcttcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcrtcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggycttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcmtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactccgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674407_P_P-D Feature FT:CDS AB674407_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD35). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaaaacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaacaagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aagccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaactcaaagaatgttttagaaaacttcctgtca
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674408_P_P-D Feature FT:CDS AB674408_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD83). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatggtaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcactatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggagtggagccctcaggctcaaggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaacagc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
raaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggatttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674411_P_P-D Feature FT:CDS AB674411_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD84). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaactccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattggttatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctctggaaggcgggtgtattatataagaga
gaaactacacatagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattttttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggactgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatctcctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaacgaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggttttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgggcta
tgtcattggaagttatgggtcattaccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctatcgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttttcgcaaacttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674413_P_P-D Feature FT:CDS AB674413_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=2484 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgccagctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacattcagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatacaagaga
gaaactacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctgtcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacagaccttgccagcaaatccgcctcctgcctcaacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttaagaaacacgcatcctcaggccatgcagtggaacacc
acaatcttccaccaaactctgacacctacaagcaatcctgctggtggctccagttcaggaacagtaaaccctgttccgac
tactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgagcatggagaacatcacatcaggattcc
taggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtgg
tggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
aacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgc
tatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaact
accagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaacc
ttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagccc
gtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttata
tggatgatgtggtattgggggccaggtctgtacaacatcttgagtcccttttttccgctgttaccacctttcttttgtct
ttgggtatacatttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggatgtta
tgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcctgttaacaggcctattgatt
ggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtggttatcctgctttaatgcct
ttgtatgcctgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaa
cctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtca
tgggccatcagcgcatgcgcggaacctttcaggctcctctgccgatccatactgcggaactcctagccgcttgttttgct
cgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatcgtatccatggct
gctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacc
cttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctttac
gcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccacc
gtga
>gnl|hbvcds|AB674415_P_P-D Feature FT:CDS AB674415_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC24). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2481 residues).
atgcccctatcttatcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttgnactc
ataaggtgggnaactttacggggctttattcttctactgttcctgtctttanccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
ccgaacatctagttaatcattacttccaaactagacattatttacamactctatggaaggcgggcatattatataagaga
gaaactacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacacccatcctcaggccatgcagtggaactcc
acaaccttccaccaacctcwgcaagttcaaaactctgttggtggctccagttcaggaacagtaaaccctgttccgactac
tgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggattcctag
gacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtgg
acttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaac
ctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctat
gcctcatcttcttgttggttcttctggactatcaaggtatgctgcccgtttgtcctctaattccaggatcttcaaccacc
agcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttc
ggacggaaattgcacctgtattcccatcccatcatcmtgggctttcggaaaattcctatgggagtgggcctcagcccgtt
tctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatgg
atgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttgtctgtg
ggtatacatttaaaccctaacaaaacaaaaagatggggtyactctttacatttcatgggttatgtcattggatgttatgg
atcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattgattgga
aagtctgtcaacgtattgtgggacttttggggtttgctgcaccttttacacaatgcggttatcctgctttaatgcccttg
tatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacct
ttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgg
gccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgc
agcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatcgtttccatggctgct
aggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgaccctt
ctcggggccgcttgggactctmtcgtccccttctccgtttgccgtttcgtccgaccacggggcgcacctctctttacgcg
gactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccatg
a
>gnl|hbvcds|AB674416_P_P-D Feature FT:CDS AB674416_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE19). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagagtactgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacgc
atagggtgggaaactttacgggactttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aacatacatttacaccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttacccaaatgytaccaaatatttgccattggataagggtataaagccttattatc
cagaacatctagttaatcattacttccaaacaagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgaaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcagggaggcagcctacccctctcactccacctttgagagacactcatcctcaggctattcagtggaactcc
acgaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttacctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattgggggccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctctaatt
ccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagactgttcagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaaggtggggttactctttacattttatgggcta
tgtcattggatgtcatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatcaaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcctgttttgctcgcagcaggtctggagcaaacattatcgggacggataactccgttgttctctcccgcaaatatac
gtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|AB674417_P_P-D Feature FT:CDS AB674417_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraLCE1). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=2487 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaccaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgrgtcaccatattcgtgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactaacaaccttgccaacaaatccgcctcctgcctctacca
atcgccagacaggaaggcagcctacccctctgactccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccaggcctctccctgctggtggctccagttcaggaacagtaaaccctgttcc
gactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggat
tcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcg
tggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactc
accaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgc
tgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcttca
accaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaa
accttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcag
cccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagtt
atgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttg
tctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggatg
tcatgggtcattgccacaagatcacattatacaaaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattg
attggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgcggttatcctgctttaatg
cctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacct
gaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttgg
tcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctagccgcttgtttt
gctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatcgtttccatg
gctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggagctgaatcccgcggacg
acccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctt
tacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagacc
accgtga
>gnl|hbvcds|AB674418_P_P-D Feature FT:CDS AB674418_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC7). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=2487 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaccaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcgtgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactaacaaccttgccaacaaatccgcctcctgcctctacca
atcgccagacaggaaggcagcctacccctctgactccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccaggcctctccctgctggtggctccagttcaggaacagtaaaccctgttcc
gactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggat
tcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaagagtctagactcg
tggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactc
accaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgc
tgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcttca
accaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtaccaa
accttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcag
cccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagtt
atgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttg
tctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggatg
tcatgggtcattgccacaagatcacattatacaaaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattg
attggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgcggttatcctgctttaatg
cctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacct
gaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttgg
tcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctagccgcttgtttt
gctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatcgtttccatg
gctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggagctgaatcccgcggacg
acccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctt
tacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagacc
accgtga
>gnl|hbvcds|AB674419_P_P-D Feature FT:CDS AB674419_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC16). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagttaatgagaaaagaagact
gcaattgattatgcctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagatctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggac
ttcaaccccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggcctcttggggtggagccctcaggctcaaggcacactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgacagtcaggaaggcagccgacccctctgtctccacctttgagaaacactcatcctcaggccatacagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagggacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
ttacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatgccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatgtggatgatgtggtgttgggggccaagtctgtacagcatcttgagtccctttttaccgctgtttcc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttactctttacatttcatgggcta
tgtcattggctgttatgggtcattgccacaagatcacattatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgaagctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674420_P_P-D Feature FT:CDS AB674420_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunLCD2). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggagaagacactcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccmgacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggactcctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggcctgttggggtggagccctcaggctcaaggcataatacaaaccttgccagcaaatccgcctccggcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagggacctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagtacgggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgtttccctcatg
ttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaatacctatggg
agtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttataccgctgttacc
aattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttaggtctctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674422_P_P-D Feature FT:CDS AB674422_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtmtcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggamtc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacamaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcacacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagataactctgttgttctctcccgcaaattgac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674423_P_P-D Feature FT:CDS AB674423_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD18). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttcttctgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattatttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtggatcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacacaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggacggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttatcgaggattggggaccttgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatataaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgtaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674424_P_P-D Feature FT:CDS AB674424_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE24). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaactcttccggagacttctgttattagatccagaagcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagacgact
gcaattggttatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataggaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctctacca
atcgccagacaggaaggcagcctaccccgctgtctccacctttgagagacacccatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaaaatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggtccctgcgttgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtccactaatt
ccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgagtcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcatggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccatcacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtccttgccacaagatcacatcagacacaaaatcaaagaatgttttcgaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccatttacacaatgtggttat
cctgccttaaagcccttgtatgcatgtattcagtcgaagcaggctttcaccttctcgccaacttacaaggtctttctgta
taaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
ttcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|AB674425_P_P-D Feature FT:CDS AB674425_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE44). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtcycaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattacc
cagaacatttagttaatcattacttccaaaccagacattatttacatactctatgggaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatatccttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgaaaatccggattgggac
ttcaatcccaacaaggacacctggcccgacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgccgtctccacctctgagaaacacgcatcctcaggccgtgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagc
aaaccctgttccgactactgtctctcccatatcatcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcaaacacaaaatcaaagaatgttttcgaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggccttcctgcg
taaacaatacatgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgtttcgctcgcagcaggtctggagcgaaccttctcgggacggataactcagttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674427_P_P-D Feature FT:CDS AB674427_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD54). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttaatattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcgtttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtrtattatataagaga
gaaacaacacatagcgcctcattttgcgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaaytcc
acaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgcttcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgtaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674428_P_P-D Feature FT:CDS AB674428_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB26). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacccagatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtatcaaaccttattacc
cagaacatctagttaatcattacttccaarccagacattatttacacactctatggaaggcgggtgtattatatcagaga
gaaacaacacatagcgcctcattctgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacaccgccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccacctcctgcctccacca
atcgtcagtcgggaagacagcctactccgctgtctccacctttgagagacactcatcctcaggccacacagtggaactcc
acaactttccaccaaactttgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgcggaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgagtcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtgtcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatggggctttgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acagaccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AB674431_P_P-D Feature FT:CDS AB674431_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC27). Complete genome. [Hepadnaviridae] (length=2502 residues).
atgcccctatcttatcatcacttccggagacttgtgttgttagacgacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaaccctcattggagaagacgaccctctttt
cctaatatacatttacaccaagacactattaacaaatgtgaacaatttgtagggccactcacaggcaatgagaaaagaag
actgcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttatt
atccagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtgttatataag
agagaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatcttt
ccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgg
gacttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacc
gcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctcta
ccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacacatcctcaggccatgcagtggaac
tccacaaccttccaccaaactctgcaagatcccaaagtgaaaggcctgtatttccctgctggtggctccagttcaggaac
agtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaga
acatcacatcaagattcctaggacccctgctcgggttactggcggggttttccttgttgacaagaatcctcacaataccg
cagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggccaaaattcgcagtcccc
aacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatct
tcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctcta
attccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctc
ctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctat
gggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccact
gtttggctttcagttatatggatgatgtggtgttgggggccaagtctgtacagcatcttgagtccctttttaccgctgtt
accaattttcttttgtctttgggtatacatttaaaccctaacaaaacraaaagatggggttactctttacatttcatggg
ctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaactccctg
ttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggt
tatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttct
gtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccca
ctggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactc
ctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagacaactctgttgttctttcccgcaaata
tacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgc
tgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacg
gggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgca
cgtcgcatggagaccaccgtga
>gnl|hbvcds|AF043593_P_P-D Feature FT:CDS AF043593_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6/89). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=2487 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gaaattaattatgcctgctaggttctatccaaatgttaccaaatatttgccattagataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagacctgctggtggctccagttcaggaacagtaaaccctgttcc
gactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggat
tcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcg
tggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactc
accaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgc
tgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaattccaggatcttca
accaccagcgtgggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccctcctgttgctgtacaaa
accttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcag
cccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagtt
atatggatgatgtggtattgggggccaagactgtaccgcatcttgagtccctttttaccgctgttaccaattttcttttg
tctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggctatgtcattggaag
ttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgttaaccggccaattg
attggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgctttaatg
cccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtgtcaacaatatct
gaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttgg
ttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctagccgcttgcttt
gctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatcgtttccatg
gctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacg
acccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctt
tacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagacc
accgtga
>gnl|hbvcds|AF043594_P_P-D Feature FT:CDS AF043594_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1/91). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaacccttattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
accggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
tcaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AF121239_P_P-D Feature FT:CDS AF121239_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1303). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacccccttttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacacccatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctagtaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttttgggtcattgccacaagatcacatcacacagaaaatcaaagaatgtttcagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccatttacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AF121240_P_C-D Feature FT:CDS AF121240_P_C-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/11066). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacccccttttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctagtaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcacacagaaaatcaaagaatgtttcagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccatttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AF121241_P_P-D Feature FT:CDS AF121241_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1758). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacccccttttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctagtaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcacacagaaaatcaaagaatgtttcagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccatttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AF121242_P_P-D Feature FT:CDS AF121242_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1218). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacccccttttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaaaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctagtaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcacacagaaaatcaaagaatgtttcagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccatttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AF151735_P_P-D Feature FT:CDS AF151735_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggct
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcaggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacacaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagccgaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgttaatcttctcgaagattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggaaggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctatta
accggcctgttgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcagtctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctgtgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AF280817_P_P-D Feature FT:CDS AF280817_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-D1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaatatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gatacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcatacgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaatcttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaatatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ131956_P_P-D Feature FT:CDS AJ131956_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggagcagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggtta
tgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ344116_P_P-D Feature FT:CDS AJ344116_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBsAg negative patient GX27). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgatcatgcctgctaggttttatccaaatgctaccaaatatttgccattggataagggtatcaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatatcagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtccggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgtccagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgggcta
tgtcattggaagttatgggtcattgccacaggatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttctctttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccataccgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctga
atcccgcggacgacccctctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627215_P_P-D Feature FT:CDS AJ627215_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 06115). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactc
ataaagtgggtaactttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagact
gaaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
ccgaacatctagttaatcattacttccaaacyagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggttaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaagctcagggcatgatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcgggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcctggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtcgctttttaccgctgttacc
aattttcttatgtctctgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgggata
tgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatcgaagcaggctttcaccttctcgctgacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgtccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627216_P_P-D Feature FT:CDS AJ627216_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17707). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactc
ataaagtgggtaactttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagact
gaaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
ccgaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggttaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaagctcagggcgtgatrcaaaccttgccagcaaatccgcctcctgcatctacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcgggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcctggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtcgctttttaccgctgttacc
aattttcttwtgtctctgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgggata
tgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatcgaagcaggctttcaccttctcgctgacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatrggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgtccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627218_P_P-D Feature FT:CDS AJ627218_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 21116). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactc
ataaagtgggtaactttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
gatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagact
gaaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
ccgaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggttaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaagctcagggcgtgatgcaaaccttgccagcaaatccgcctcctgcatctacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcgggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcctggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcgctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgggata
tgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatcgaagcaggctttcaccttctcgctgacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgtaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgtccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627219_P_P-D Feature FT:CDS AJ627219_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 24039). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatctacatcaagatattatcaaaaaatgtgaacagtttgtaggcccgcttacagtcaatgaaaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaatgtcaccaaatatttgcccttggacaagggtattaarccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctgtcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaatccgygccagcaaatccgcctcctgcctctacca
atcgcaagtcaggcaggcagcctaccccgctgtctccacctctgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttyagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaaatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaagatcacattagacataaaatcaaagaatgtttcagaaaactccctgtta
acmggcctattgattggaaagtatgtcaacgaattgtgggtctgctgggttttgctgcccctttcacacaatgtggttat
cctgctttgatgcccttgtatgcctgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacatactcgggactgacaactctgttgtcctctcccgcaaatatac
gtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627220_P_P-D Feature FT:CDS AJ627220_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 29234). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcatttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagact
acaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatamtacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcagcaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaaactctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgggcta
tatcattggatgtcatgggtcactgccacaagagcacatcatacagaaaatcaaagactgttttagaaaacttcctgtta
acaggccaattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcgtcaggctttcactttctcaccaacttacaaggcctttctgtg
taaacaatatctgaccctttaccccgttgcccggcaacggccaggcctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctttcgtccccttctccgactgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627222_P_P-D Feature FT:CDS AJ627222_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 31228). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgmagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctgttttcct
aatatacatttacaccaagacattattaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagatt
gcaattaattatgcctgctaggttctatccaaaggttacaaaatatttgccattagagaagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggcctcttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcracctccgcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaca
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcgtacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgctgccccttttacccaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatacac
atcatttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttycgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627223_P_P-D Feature FT:CDS AJ627223_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33720). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaactctcattggaaaacaccctcatttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
acaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aacccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgggcta
tgtcattggatgttatgggtcgttgccacaagatcacataatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtttattgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcgtcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacttttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaatacac
ctcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggtcgcttgggactctttcgtcccctcctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AJ627224_P_P-D Feature FT:CDS AJ627224_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 33852). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgc
ataaggtgggaaactttacggggctttactcttctactgctcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttgcaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattctgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaggatcacatcaggcacaaaatcaaagattgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AM422939_P_P-D Feature FT:CDS AM422939_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X28). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctcaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY090452_P_P-D Feature FT:CDS AY090452_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagtgtactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaactcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcatttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagact
acaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatacaagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataacacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaacaaactctgcaagatcccagggtgaaaggcctgtttctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggcccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctgatt
ccaggatcctcaaccaccagcacgggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaacgatggggttactctttaaattttatgggcta
tgtcattggaagttatgggtcattgccacaagatcacattgtacagaaaatcaaagaatgttttcgaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttatatgcctgtattcaatctcgtcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatatctgaacctttaccccgttgctcggcaacggccaggcctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcatctctctttacgcgagctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cacatggagaccaccgtga
>gnl|hbvcds|AY090453_P_P-D Feature FT:CDS AY090453_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggtcagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagcccacaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgttgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcattttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcaagacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatggg
agtgggcctcagcccgtttcttctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacagtgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY161150_P_P-D Feature FT:CDS AY161150_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattgaataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
tcagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccccaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaacaatcatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY161151_P_P-D Feature FT:CDS AY161151_P_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattgaataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaaccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccccaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaacaatcatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY161152_P_P-D Feature FT:CDS AY161152_P_P-D of [Viruses] Hepatitis B Virus genotype D. Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattgaataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
tcagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacataaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccccaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaacaatcatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY161157_P_P-D Feature FT:CDS AY161157_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagaccactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aaaatacatttacaccaagacattatcaaaagatgtgaacaatttgtaggcccacttacagttaatgagaagagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccagc
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttccggtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtttgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY161158_P_P-D Feature FT:CDS AY161158_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagagctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aaaatacatttacaccaagacattatcaaaagatgtgaacaatttgtaggcccacttacagttaatgagaagagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcaatccccagc
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttccggtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatacac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtttgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY233291_P_P-D Feature FT:CDS AY233291_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 179). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttcaactatacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagg
gaaacaacacatagcacctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctggcctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgcaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taagcaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggtctctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY233292_P_P-D Feature FT:CDS AY233292_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 184). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
ctgaacatctagttaatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctatcccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggttgacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtgtgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctactctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttcgaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaccctttctggctcctctgccgatccataccgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcactttgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY233294_P_P-D Feature FT:CDS AY233294_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 305). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaattttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggttgacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtgtgtcctctaatt
ccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtaccatttgttcagtggttcgtaaggctttcccccactgtt
tggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctactctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccataccgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgtccgaccacgggg
cgcacctctctttacgcggactccccgtatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY233296_P_P-D Feature FT:CDS AY233296_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 185). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaattttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtatcaaaccttattatc
cagaacatgtagttaatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttttcaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatggtccttggccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccatttacacaatgtggatat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatac
atcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY236160_P_P-D Feature FT:CDS AY236160_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1A). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctagggtttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcacccaaccgca
cggaggtcttttggggtggagccctcaggttcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcggcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcaggggttcggagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttctttggtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttagtttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgttcgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggccgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY236162_P_P-D Feature FT:CDS AY236162_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 23A). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtggggaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY236164_P_P-D Feature FT:CDS AY236164_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 30). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctagggtttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcacccaaccgca
cggaggtcttttggggtggagccctcaggcttagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaatctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttctttggtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtcgtgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY661792_P_P-D Feature FT:CDS AY661792_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ayw). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacgggtctttattcttctactgtacctgtctttaaccctcattggaaaacatcctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccgctcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttagggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctacctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcttcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacagtgtggttat
cctgctttaatgcctttatatgcatgtattcagtccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatgtac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY661793_P_P-D Feature FT:CDS AY661793_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacgggtctttattcttctactgtacctgtctttaaccctcattggaaaacatcctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggccagctcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggcggggattcaccccaccgca
cggaggccttttagggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctacctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcttcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgtgatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacagtgtggttat
cctgctttaatgcctttatatgcatgtattcagtccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatgtac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY721605_P_P-D Feature FT:CDS AY721605_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AK1.1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccgggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY721606_P_P-D Feature FT:CDS AY721606_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AT1.2). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggatttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccctcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
gtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY721607_P_P-D Feature FT:CDS AY721607_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HIY1.3). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttactaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatacttcaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgcccacatacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcgtctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY721608_P_P-D Feature FT:CDS AY721608_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IB1.4). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgccgaacatgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctgtgggtatacatttaaaccctaccaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaattaaagaatgttttagaaaacttcctgtta
acaggcctattgactggaaagtctgtcaacgtattgtgggtctttggggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaatattctcgggacggataactatgttgttctttcccgcaaatatac
atagtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY721609_P_P-D Feature FT:CDS AY721609_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA1.5). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcagtacttccaaaccagacattatttacacactctatggaaggtgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggccttttgggttttgctgccccttttacacaatgcggttat
cctgctttaatgcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|AY721611_P_P-D Feature FT:CDS AY721611_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SK1.7). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattgtcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaaggagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtatcaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggcctgttgggatggagccctcaggctcagggcatgctacacaccgtgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
gcaaccttccacgaaactctgcaagatcccagagtgagaagcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
ataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttatccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY721612_P_P-D Feature FT:CDS AY721612_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BL1.8). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttgcaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgccagctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacattgagttaatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatacaagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaactcc
acaacctaccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcctgtta
acaggcctattgactggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctaccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY741794_P_P-D Feature FT:CDS AY741794_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-50). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcacaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtggggaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagacaagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactccttacatttcatgggcta
tgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccacgg
gctggggcttggtcatgggccatcagcgcatgcggggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY741795_P_P-D Feature FT:CDS AY741795_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-Hi). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagacaagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactccttacatttcatgggcta
tgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccacgg
gctggggcttggtcatgggccatcagcgcatgcggggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY741796_P_P-D Feature FT:CDS AY741796_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P3). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagacaagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttggcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactccttacatttcatgggcta
tgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccacgg
gctggggcttggtcatgggccatcagcgcatgcggggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY741797_P_P-D Feature FT:CDS AY741797_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-21). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgcgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
acaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggacaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatccgcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaaaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtctttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttgcc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggatactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttttcgccaacttataaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccccctg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
gtcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY741798_P_P-D Feature FT:CDS AY741798_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P4). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttccacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactca
acaacattccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacag
agtctagactcgtggtggacttctctcaattttctaggggacaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccagtcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctgtaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgaggccctttataccgctgttgtc
aattttctttggtctttgggtattcatttaaaccctggcaaaacgaaaagatggggtcactctttacattccatgggcta
tgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgctttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcactcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|AY796030_P_P-D Feature FT:CDS AY796030_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FC1.9). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccc
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctgacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcccgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY796031_P_P-D Feature FT:CDS AY796031_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RA1.10). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
acaaagtgggtaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacacccagacattatcaaaaaatgtgaacaatttgtaggcccactcacagccaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cggaacatgtagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaaccacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaacacc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggaaaccaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaagggacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatgggggtattccttaaatttcatgggcta
tgtcattggctgttatggctccttgccacaagatcacatcaagcagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccctgtattcctgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggattttttcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY796032_P_P-D Feature FT:CDS AY796032_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NA1.11). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattctactactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgcccacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagacaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggatttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|AY945307_P_P-D Feature FT:CDS AY945307_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagttaatgagaaaagacgact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttgggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttacctctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttatatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaagacctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcctgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ111986_P_P-D Feature FT:CDS DQ111986_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MBT181). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacnacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaaccccctcttttcct
aatatacatttacaccaagacgttatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacaccctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggatgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctccgtctccacctttaagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccatcaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggtccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttctgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacacttcatgggcta
tgtcattggatgttatgggtccttgccacaagatcatatcatacataagatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgaagcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ304547_P_P-D Feature FT:CDS DQ304547_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcgaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacgaccgcgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttagccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ304548_P_P-D Feature FT:CDS DQ304548_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttggagggccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggtaacaaataatttgccattggataagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgacaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ304549_P_P-D Feature FT:CDS DQ304549_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaagtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttaaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ304550_P_P-D Feature FT:CDS DQ304550_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaagaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ304551_P_P-D Feature FT:CDS DQ304551_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatc
cagaacatctagttaatcattacttccaacacagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaagaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ315776_P_P-D Feature FT:CDS DQ315776_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI00615). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ329356_P_P-D Feature FT:CDS DQ329356_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgctagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcggcggagaagatctaaatctcgggaatctcaatgttagaattccttggactc
ataaggtggggagctttactgggctttattcttctactggacctgtctttaatcctaattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattcttgcccgaccaccagttggatccagccttcagagcaaacaccggaaatccagattgggac
ttcaatccaaacaaggacacctggcaagacgccaacaaggaaggagctggagcattcgggctgggtttcacccaaccgca
cggaggccttttggggtggagccctcaggttcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgttgtctcaacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gtttgggcgtcgtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcccttgggactctctcgtccccttctccggctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgggcacttcgcttcacctctgcgcgt
ccgatggagaccaccgtga
>gnl|hbvcds|DQ329357_P_P-D Feature FT:CDS DQ329357_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaagggctcaatcgccgcggcggagaagatctaaatctcgggaatctcaatgttaggattccttggactc
ataaggtggggagctttactgggctttattcttctactggacctggctttaatcctcattggaacacatcttcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattcttgcccgaccaccagttggatccagccttcagagcaaacaccggaaatccagattgggac
ttcaatcccaacaaggacacctggcaagacgccaacaaggtaggagctggagcattcgggctgggtttcacccaaccgca
cggaggccttttggggtggagccctcaggttcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgttgtctcaacctttgagaaacactcatcctcaggccatgcagtggaactcc
tcaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gtttgggcgtcgtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcccttgggactctctcgtccccttctccggctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgggcacttcgcttcacctctgcgcgt
ccgatggagaccaccgtga
>gnl|hbvcds|DQ336674_P_P-D Feature FT:CDS DQ336674_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336675_P_P-D Feature FT:CDS DQ336675_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336676_P_P-D Feature FT:CDS DQ336676_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336677_P_P-D Feature FT:CDS DQ336677_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336678_P_P-D Feature FT:CDS DQ336678_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336679_P_P-D Feature FT:CDS DQ336679_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336680_P_P-D Feature FT:CDS DQ336680_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2475 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaagaaatgtgaacagtttgtaggcccactcactatcaatgagaaaagaagact
gcaattgattatgcctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaagccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtggatcactatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagctggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccgctacca
atcgccagtcaggaaggcagcccactcctctgtctccaccgttgagaaacacccatcctcaggccatgcagtggaactca
acaactttccaccaaactctgcaaaatcctgctggtggctccagttcaggaactgtaaaccctgttccgactactgcctc
tcacatatcgtcaatcttctcgaggattggggaccctgcgctgaaaatggagaacatcacatcaggattcctaggacccc
tgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttct
ctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctg
tcctcagacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctca
tcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatcccaggatcttcaaccaccagcacg
ggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacgg
aaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctctt
ggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatg
tggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttaccaattttcttttgtctgtgggtata
catttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggaagttatgggtcatt
gccacaagatcacatcagacacaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattgattggaaagtct
gtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgctttaatgcccttgtatgca
tgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccc
cgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatc
agcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcagg
tctggagcaaacattatcgggacggataactctgttgtcctctcccgcaaatatacatcgtttccatggctgctaggctg
tgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggg
gccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctttacgcggactcc
ccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ336681_P_P-D Feature FT:CDS DQ336681_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2475 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaagaaatgtgaacaatttgtaggcccactcactatcaatgagaaaagaagact
gcaattgattatgcctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcactatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccgctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctc
tcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggacccc
tgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttct
ctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctg
tcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctca
tcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacg
ggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacgg
aaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctctt
ggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatg
tggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtctgtgggtata
catttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggaagttatgggtcatt
gccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattgattggaaagtct
gtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgctttaatgcccttgtatgca
tgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccc
cgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatc
agcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcagg
tctggagcaaacattctcgggacggataactctgttgtcctctcccgcaaatatacatcgtttccatggctgctaggctg
tgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggg
gccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctttacgcggactcc
ccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ336682_P_P-D Feature FT:CDS DQ336682_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2475 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaagaaatgtgaacagtttgtaggcccactcactatcaatgagaaaagaagact
gcaattgattatgcctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaagccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtggatcactatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagctggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccgctacca
atcgccagtcaggaaggcagcccactcctctgtctccaccgttgagaaacacccatcctcaggccatgcagtggaactca
acaactttccaccaaactctgcaaaatcctgctggtggctccagttcaggaactgtaaaccctgttccgactactgcctc
tcacatatcgtcaatcttctcgaggattggggaccctgcgctgaaaatggagaacatcacatcaggattcctaggacccc
tgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttct
ctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctg
tcctcagacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctca
tcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatcccaggatcttcaaccaccagcacg
ggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacgg
aaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctcat
ggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagctatgtggatgatt
tggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttaccaattttcttttgtctgtgggtata
catttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggaagttatgggtcatt
gccacaagatcacatcagacacaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattgattggaaagtct
gtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgctttaatgcccttgtatgca
tgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccc
cgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatc
agcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcagg
tctggagcaaacattatcgggacggataactctgttgtcctctcccgcaaatatacatcgtttccatggctgctaggctg
tgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggg
gccgcttgggactctatcgtccccttctcagtctgccgtttcgaccgaccacggggcgcacctctctttacgcggactcc
ccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ336683_P_P-D Feature FT:CDS DQ336683_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2475 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaagaaatgtgaacagtttgtaggcccactcactatcaatgagaaaagaagact
gcaattgattatgcctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaagccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtggatcactatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagctggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccgctacca
atcgccagtcaggaaggcagcccacccctctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaaaatcctgctggtggctccagttcaggaacagtaaaccctgttccgaccactgcctc
tcacatatcgtcaatcttctcgaggattggggaccctgcgctgaagatggagaacatcacatcaggattcctaggacccc
tgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttct
ctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctg
tcctcaaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctca
tcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatcccaggatcttcaaccaccagcacg
ggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacgg
aaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctctt
ggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatg
tggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttaccaattttcttttgtctgtgggtata
catttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggaagttatgggtcatt
gccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattgattggaaagtct
gtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgctttaatgcccttgtatgca
tgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccc
cgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatc
agcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcagg
tctggagcaaacattatcgggacggataactctgttgtcctctcccgcaaatatacatcgtttccatggctgctaggctg
tgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggg
gccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctttacgcggactcc
ccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ336684_P_P-D Feature FT:CDS DQ336684_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2475 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaagaaatgtgaacagtttgtaggcccactcactatcaatgagaaaagaagact
gcaattgattatgcctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaagccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtggatcactatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagctggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccgctacca
atcgccagtcaggaaggcagcccactcctctgtctccaccgttgagaaacacccatcctcaggccatgcagtggaactca
acaactttccaccaaactctgcaaaatcctgctggtggctccagttcaggaactgtaaaccctgttccgactactgcctc
tcacatatcgtcaatcttctcgaggattggggaccctgcgctgaaaatggagaacatcacatcaggattcctaggacccc
tgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttct
ctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcctg
tcctcagacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctca
tcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatcccaggatcttcaaccaccagcacg
ggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccctcctgttgctgtaccaaaccttcggacgg
aaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagcccgtttctctt
ggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatg
tggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttaccaattttcttttgtctgtgggtata
catttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggaagttatgggtcatt
gccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcctgttaacaggcctattgattggaaagtct
gtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgctttaatgcccttgtatgca
tgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctgaacctttaccc
cgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggccatc
agcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcagg
tctggagcaaacattatcgggacggataactctgttgtcctctcccgcaaatatacatcgtttccatggctgctaggctg
tgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctgaatcccgcggacgacccttctcggg
gccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctttacgcggactcc
ccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ336685_P_P-D Feature FT:CDS DQ336685_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctccttgttagtattccttggactc
ataaagtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaggacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatactaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcgaccaccagcacgggtccttgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttattctttaaattttatgggtat
agtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccgacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336686_P_P-D Feature FT:CDS DQ336686_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttgggctc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatccttcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaaccgccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336687_P_P-D Feature FT:CDS DQ336687_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagtcggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatccttcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaaccgccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336688_P_P-D Feature FT:CDS DQ336688_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatccccattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgcaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgactaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagccttcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatccttcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaaccgccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336689_P_P-D Feature FT:CDS DQ336689_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtactccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcgacaaccagcacgggaccatgccggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336690_P_P-D Feature FT:CDS DQ336690_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaggacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgcaaggttttatccaaatactaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagtactacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggcttgggttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggatggggacccttgcactgaacatggagaaca
tcacatcaagactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgggtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttaccaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgcttgctgatgcaacccccactg
gctggggcttggccatgggccatctgcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ336691_P_P-D Feature FT:CDS DQ336691_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=2480 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaccaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcaaggcatactacaaactttgccagcaaatccgcctcctgcctccaaca
aatgtcagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttccctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtgggattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttctttggcctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgtaccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaaagcttgagctcttctttttcacctctgcc
>gnl|hbvcds|DQ336692_P_P-D Feature FT:CDS DQ336692_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactggacctgtctttaatcctcattggaaaacaccatcttttcct
tacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacacagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccaaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatccttcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaaccgccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ399006_P_P-D Feature FT:CDS DQ399006_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate G1). Complete genome. [Hepadnaviridae] (length=2508 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtatcaaaccttattatc
cagaacatgtagttaatcattacttccaagccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgactccacctttgagagacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtatctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagtacgaccagtacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgta
tccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaat
tcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcc
cccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttacc
gctgttaccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttaaattt
catgggctatgttattggatgttatgggtccttgccacaagatcacatcagacagaaactcaaagaatgttttcgaaaac
tccctgttaacaggcctattgattggaaagtttgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaa
tgtggttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggc
ctttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaa
cccccactggctggggcttggccataggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcg
gaactcctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccg
caaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgt
cgtcgctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccg
accacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacc
tctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ464168_P_P-D Feature FT:CDS DQ464168_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttgggctc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagcagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcagccaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttgggttggagccctcaggctcaaggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaacaagt
aaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccagcttgtcctggttgtcgctgggtgtgtctgcggcgttttgtcagcttcc
tcttcagcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggc
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464169_P_P-D Feature FT:CDS DQ464169_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaagagggggactttactgggctttattcttctactgtacctggctttaatcctcattggaaaacaccatctttcctt
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccgggttgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcaaggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccggctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggaatcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacggcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggcgaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctcgatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggc
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctggacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464170_P_P-D Feature FT:CDS DQ464170_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT8). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatggtaggattccttggactc
ataaggtggggaactttactgggctttattcttctactgaccctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcaa
ccagcaatcctttgggattctttccgcaccaccagttggatccagccttcagatcaaacaccgcaaatccagattgggac
ttcaatcccaacaagaacacctggccagacgccaacaaggtaggagctggagcattcgggcttgggttcaccccaccgca
cggaggccttttggggtgggaccctcaggctcaaggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaagaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcatggtggacttctctcaattttctagggggaactaccgtgtgtcttggcgaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464172_P_P-D Feature FT:CDS DQ464172_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacaacgaggcaggtcccctacaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcaggaatctcactgttagttattcttggactc
ataaggtgaggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttaccccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgccctcttttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactctgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttctttggtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464173_P_P-D Feature FT:CDS DQ464173_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggaggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttctttggtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464174_P_P-D Feature FT:CDS DQ464174_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgataatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggtccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttctgtctttgggtatacatttaaaccctaacaaaacaaaacgatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaacgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttcttgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatctgcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccca
gccgcttgttttgctcgcagcaggtctggggcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464175_P_P-D Feature FT:CDS DQ464175_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgtgtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgcgcaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464176_P_P-D Feature FT:CDS DQ464176_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggtattatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctcctcca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgtcgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgttgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaagttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
accgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcctaa
tcatgcccagcatcatgca
>gnl|hbvcds|DQ464177_P_P-D Feature FT:CDS DQ464177_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgttgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccctttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtcagtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcctaa
tcatgcccagcatcatgca
>gnl|hbvcds|DQ464178_P_P-D Feature FT:CDS DQ464178_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaacctcattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaattccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgttggtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgtgtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcactctaagcaggcttgcactatctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccacttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ464181_P_P-D Feature FT:CDS DQ464181_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S3). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2493 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggactgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgtcggtcaggaaggcagcctacccctctgactccacctttgagaaacacccatcctcaggccatgcagtggaactca
acaaccttccaccaaactctgcaagatcccggagtgaggcagttacctgctggtggctccagttcaggaacagtaaaccc
tgttccgactactgtctctccaatatcgtcaatcttctcgaggattggggaccgtgcgctgaacatggagaacatcacat
caggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtcta
gactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggcgaaaattcgcagtccccaacctccaa
tcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttca
tcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccagga
tcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctgttgctg
taccaaaccttcggacggaaattgcacatgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtggg
cctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgcctggctt
tcagttacatggatgatgtggtattgggggccaagtctgtacagcatcttgagtctctttttaccgctgttaccaatttt
cttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggctatgtcat
tggatgttatgggtcattgccgcaagaacacattatacagaaaatcaaagaatgttttagaaaacttcctattaacaggc
ctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgcg
ttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtgtaaaca
atacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggg
gcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactcctagccgct
tgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatacatcgtt
tccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctg
cggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccaaccgaccacggggcgcacc
tctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatg
gagaccaccgtga
>gnl|hbvcds|DQ464182_P_P-D Feature FT:CDS DQ464182_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatggtagtattccttggactc
ataaggtgggaacttttacggggctttattcttctactgttcctgtctttaacccgcagtggaaaacaccctcttttcct
aatatacatttgcaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttctatccaaaggtcaccaaatatttgccattggataagggcattaaaccttattacc
cagaacatctagttaatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcactatattcttgggaacaagagctacagcatggggcggaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctactcctctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggcttcagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagggatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttttgctcaaggaacctctatgaatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtggttat
cctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
ttcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ486021_P_P-D Feature FT:CDS DQ486021_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT13). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagc
aaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
tgtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttggctttgggtatacatttaaaccctaacaaaacaaaaggatggggttattctttaaattttatgggtat
tgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgtggtagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ486022_P_P-D Feature FT:CDS DQ486022_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT11). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctagggtttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcacccaaccgca
cggaggtcttttggggtggagccctcaggcttagggcatgctacaaactttgccagcaaatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaataccgcag
agtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaatctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
cgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttctttggtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtcgtgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|DQ486023_P_P-D Feature FT:CDS DQ486023_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT10). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=2478 residues).
atgcccctatcttatcaacacttccggagactagtgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgaagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
tatatacatttaccccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gaaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacagctagttaatcattacttccaaactagacattatctacacactctatggaaggcgggtgtattatataagaga
gaaaccacacatagcgcctcattttgtggatcaccatactcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaattctctgggattctttccccgccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggtcttttggggtggagccctcaggttcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaagaaggcagcctacccctctgtctccgcctttgagagacactcatcctcaggccatgcagtggaactca
acaaccttccaacaaactctgcaagatccccctgctggtggctccagttcaggaacagtaaaccctgttccgactactgt
atctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggactcctaggac
ccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggact
tctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctc
ctgtcctccaacttgtcctggttatcgctggatgtgcttgcggcgttttatcatcttcctcttcatcctggtgctatgcc
tcatcttcttgttgggtcttctggactaccaaggtatgttgcccgtttgtcctctaatgccaggatcttcaaccaccagc
acgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctggtgctgtaccaaaactttgga
cggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagtgggcctcagcctgttcct
tctggctcagtttactagtgccatttgtccaggggttcggagggctttcccccactgtttggctttcagttatatggatg
atgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggt
attcttttaaaccctaacaaaacacaaagatggggttactctttacattttatgggctatgtcattggaagttatgggtc
attgccacaagatcacatcagacagaaaatcaaagactgttttagaaaacttcctgttaacagacctattgattggaaag
tctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtgggtatcctgctttaatgccgttgtat
gcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatacctaaaccttta
ccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcatgggcc
atcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagc
aggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatacatcgtttccatggctgctagg
ctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccttctc
ggggccgcttggggatcttccgtccccttctccgtctgccgtttcgcccaaccacggggcgaacctctctttacgcggac
tccccgtctgtgccttctcatctgccggaagctgtgcagctctcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ486025_P_P-D Feature FT:CDS DQ486025_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT12). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgaacctatctttaatcctcattggaaaacaccatcttttcct
aacatacatttacaccaagacattatcagaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggacaagggtattaaaccttattatc
cagaacatctagttaatcattactttcaagctagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacactgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacacactgtgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctctctccaccgctgagaaacactcatcctcaggccgtgcagtggaactcc
acaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggaggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtcactttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF103275_P_P-D Feature FT:CDS EF103275_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran11). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagttaatgagaaaagacgact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttacctctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctatta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgttccgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF103276_P_P-D Feature FT:CDS EF103276_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran22). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaattcttacttccaaaccagacattatttacacactctatggaaggcgggcatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaacaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagccaccccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaacccc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaatatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaacaattgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctccaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgttgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtccggtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF103277_P_P-D Feature FT:CDS EF103277_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran33). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttgcaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgccagctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatttagttaatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatacaagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaactct
ccaaacttccaccaaactttgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtgtgcggcgtttaatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcctgtta
acaggcctattgactggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctaccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF103279_P_P-D Feature FT:CDS EF103279_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran99). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcaaacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
gtcgccagtcaggaaggcagccgacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtgaaattcc
acaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttcggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggcttttactttctcgccaacttataaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gcagcttgctttgcccgcagcaggtctggagcaaacatcatcgggacggataactctgctgttctctcccgcaaatatac
atcgtttccatggctggtaggctgtgctgccaacgggatcttgcgcgggacgtcctttgtttacgtcccgtgggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaacccccgtga
>gnl|hbvcds|EF103280_P_P-D Feature FT:CDS EF103280_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran100). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttacccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggaccattccaggtgggattcaccccaccgca
cggaggccttttgggggggagccctcaggctcagggcatactacaaaccttgccaacgaatcatcctcctgcctctacca
gtcgtcactcaggaagggagccgacccctctgtctccacctttgagagacactcctgctctggccatgcagtgaaactcc
acaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtggccctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggtta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtca
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaggttcttgctgacgcaacccccactg
gctggagcatggtcataggccatcagcgcatgcgtggaacttttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgcgacggataactctgttgttctctcccggaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgccga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EF103281_P_P-D Feature FT:CDS EF103281_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran102). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaacaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatcccaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatcttttca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaactttccaccaaactctgcaagatcccagaggggaaggcctgtatttccctgctgggggctccagttccggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtggccctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgggtta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaccattcttgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU155893_P_P-D Feature FT:CDS EU155893_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 4). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaggttgctgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctaattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctatcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatcaagattgggac
ttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgtctccacca
atcgccagtcacgaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcaatggaattcc
aaaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggggaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcaa
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctctaatt
tcaggatcctcaaccaccagcacgggaccctgccgaccctgcataacaactgctcaagaaacctctatgtttgcctcatg
ttgctgtaccaaacctttggacggaaattacacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggacgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggtta
tgtcattggaggctatggggccttaccacaagaacacatcagacaaaaaatcaaagaatgtttcagaaaactccctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactccgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgaatggagaccaccgtga
>gnl|hbvcds|EU414135_P_P-D Feature FT:CDS EU414135_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttkkwggsscmcttacagtcaatgaaaaaagaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccagaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggccttttgggrtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaaratcccaragtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgggcta
cgttattggawgttrkgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgttr
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|EU414136_P_P-D Feature FT:CDS EU414136_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctattttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatattaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggsgggtatattatataagaga
gaaacaacacatagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccattcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacgcaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacgcaatgtggttat
cctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgtgctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU414138_P_P-D Feature FT:CDS EU414138_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttcttctgkaystgtctttaaccctcattggaaaacaccctcttttcct
aatatacacttacaccaagacattatcaaaaaatgtgaacaatttgtaggaccactcacagttaatgaaaaacgaagact
acaattaattatgcctgctaggttttatccaaatgtcaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcngaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccggacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatatgttcagtggttcgtagggctttcccccactgtc
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggawgttrkgggtcattgccacaagatcacatcgtacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU414139_P_P-D Feature FT:CDS EU414139_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaamtccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaagtgggtaactttacggggctttattcttctactttacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaacgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cggaacatttagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcagggaggcaacctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaaytcc
acaactttccatcaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggawgttrkgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU414140_P_P-D Feature FT:CDS EU414140_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaatcatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtaccgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcycatatcgtcaatcttctcgaggattggggaccctgtgccgaacatggagagca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactmccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcytgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactmtcaaggtatgttgcccgtytgtcctctaatt
ccaggatcwtcaaccaccagyrygggaccmtgcmraacctgcacgactmytgytcaaggaacctctatgtwtccctcmtg
ttgctgtwcmaaaccttcggacggaaattgcacytgtattcccatcccatcatcmtgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgymgggctttcccccactgty
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacccyaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggatcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU414141_P_P-D Feature FT:CDS EU414141_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcrcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaaytttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatyaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacacactatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggcygggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaactktgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaactcc
acaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaattttatgggtta
tgtcattggawgttrkgggtcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgctgcaccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttatccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|EU414142_P_P-D Feature FT:CDS EU414142_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacartttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgcctttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccrccaca
cggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgactccacctttgcgaaacactcatcctcaggccatgcagtggaactcc
acaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggaytcctaggaccccttctcgggttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccaytgtt
tggctttcagytatatggatgatgtggtattgggggccaagtctgtaycgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaattttatgggtta
tgtcattggawgttrkgggtcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgctgcaccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttwtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|EU414143_P_P-D Feature FT:CDS EU414143_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcrtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactc
ataaggtggggaattttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gaaattgattatgcctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccacccca
cggaggccttttggggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccacctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctcgcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctactatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaattttatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
ataggcctattgattggaaagtatgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctccgctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594382_P_P-D Feature FT:CDS EU594382_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagccaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgttgtctccacctttgcgaaacactcatcctcaggccatgcagtggaactcc
acaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggactggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaattttatgggtta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggtttcgctgcaccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaagacctttctgtg
taaacaatacctgaacctttaccccgttgtccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594396_P_P-D Feature FT:CDS EU594396_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagacaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacytgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgattcatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594397_P_P-D Feature FT:CDS EU594397_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaagaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattaattatgcctgctaggttttatccaaatggtaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacccaaacaaaacaaaaagatggggttactctttacatttcatgggcta
tatcattggatgttatgggtcattgccacaggatcacattatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatacagcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594398_P_P-D Feature FT:CDS EU594398_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacacttacaccaagacattatcaaaaaatgtgaacaatttgtgggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggactgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattcccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactgctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccgattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594399_P_P-D Feature FT:CDS EU594399_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcctgtattcaatctcggcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594400_P_P-D Feature FT:CDS EU594400_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccactcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594401_P_P-D Feature FT:CDS EU594401_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594402_P_P-D Feature FT:CDS EU594402_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaagaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594403_P_P-D Feature FT:CDS EU594403_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594404_P_P-D Feature FT:CDS EU594404_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacactttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcatccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacacccaccctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaagactaaaagatggggttactctttaaatttcatgggcta
tgtcattggargttatgggtccttgccacaaactcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccgtttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccataccgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594405_P_P-D Feature FT:CDS EU594405_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaaccctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594407_P_P-D Feature FT:CDS EU594407_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594408_P_P-D Feature FT:CDS EU594408_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaatcatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattaccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttatctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594409_P_P-D Feature FT:CDS EU594409_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaagacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
gtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594410_P_P-D Feature FT:CDS EU594410_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594413_P_P-D Feature FT:CDS EU594413_P_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594414_P_P-D Feature FT:CDS EU594414_P_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctgactcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594415_P_P-D Feature FT:CDS EU594415_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acgaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctagacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggctatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgaacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594416_P_P-D Feature FT:CDS EU594416_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcgaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccgtttacacaatgtggttat
cctgctctaaagcccttgtatgcctgtattcaagctagacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594417_P_P-D Feature FT:CDS EU594417_P_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctcgttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgactacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594418_P_P-D Feature FT:CDS EU594418_P_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagatt
gcaattaattatgcctgctaggttttatccaaatgtcaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatttagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccggacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtc
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgcccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594419_P_P-D Feature FT:CDS EU594419_P_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gaaattaatcatgcctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
ataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgccattgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594420_P_P-D Feature FT:CDS EU594420_P_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gaaattaatcatgcctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttcagaaaacttcctgtta
ataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgccattgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594421_P_P-D Feature FT:CDS EU594421_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acgaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctagacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggctatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgaacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594422_P_P-D Feature FT:CDS EU594422_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gaaattaatcatgcctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
ataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgccattgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594423_P_P-D Feature FT:CDS EU594423_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gaaattaatcatgcctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
ataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgccattgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594424_P_P-D Feature FT:CDS EU594424_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacgccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagctcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594425_P_P-D Feature FT:CDS EU594425_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctatatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctgkttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagagctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatccagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtctgttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaagcattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594426_P_P-D Feature FT:CDS EU594426_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggaccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatttagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaactttatgggata
tgtcattggatgttatgggtcactgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtatcgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgtaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594427_P_P-D Feature FT:CDS EU594427_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctggttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594428_P_P-D Feature FT:CDS EU594428_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gaaattaatcatgcctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttgaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
ataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgccattgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594429_P_P-D Feature FT:CDS EU594429_P_P-D of [Viruses] Hepatitis B Virus genotype D. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcgattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
actaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594430_P_P-D Feature FT:CDS EU594430_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattaattatgcctgctaggttttatcctaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggctactctttaaatttcatgggtta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcgaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgatccttctcggggccgcttaggcctctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594431_P_P-D Feature FT:CDS EU594431_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcgattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
actaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594432_P_P-D Feature FT:CDS EU594432_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcgattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
actaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594433_P_P-D Feature FT:CDS EU594433_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattaattatgcctgctaggttttatcctaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccacca
atcgtcagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaacatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggtta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgatccttctcggggccgcttaggcctctatcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU594434_P_P-D Feature FT:CDS EU594434_P_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactc
ataaggtggggaattttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagttcgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctcgttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaatacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggtctgggtttcaccccacccca
cggaggccttttggggtggagccctcaggctcagggcatgctacacactttgccggcgaatccacctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattaccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaccctctatgtatccctcctg
ttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttaaaccctaacaaaacaaagagatggggttactctctcaattttatgggcta
tgtcattggaagttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
ataggcctattgattggaaagtatgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctccgctgccgatccatactgcggaactccta
gctgcttgttttgctcgcagccggtctggggcaaacattctcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787436_P_P-D Feature FT:CDS EU787436_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 165). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
caagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagagcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787437_P_P-D Feature FT:CDS EU787437_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggatcctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgggtat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgtctaccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787438_P_P-D Feature FT:CDS EU787438_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 7). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2496 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattccctggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttccc
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaagagtaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggaatactacaaaccatcccaacacatccgcctcctgcctccacca
atcgtcagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggcccagtggaattccaca
accttccaccaaactctgcaagatcccagagtgagaggcctgactttccctgctggtggctccagttcaggaacagtaaa
ccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatca
catcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagt
ctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctc
caatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctct
tcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattcca
ggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttg
ctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatgggagt
gggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttgg
ctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttaccaat
tttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggctatgt
cattggatgtcatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcctgttaaca
ggcctattgattggaaagtctgtcaacgtattgtgggtcttctgggttttgccgccccttttacacaatgtggttatcct
gctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaa
acaatacctgaacctttaccccgttgctcgacaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggct
ggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactcctagcc
gcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatc
gtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatc
ccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgc
acctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgc
atggagaccaccgtga
>gnl|hbvcds|EU787440_P_P-D Feature FT:CDS EU787440_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W17). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcatgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcgacaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaccctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctctgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787441_P_P-D Feature FT:CDS EU787441_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W32). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaaaacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagctttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggcgctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcttgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgtatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787442_P_P-D Feature FT:CDS EU787442_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W37). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacacccacttttcct
aatatacacttacaccaagatattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccacca
atcgcaagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcataaagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgcagccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctctgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787443_P_P-D Feature FT:CDS EU787443_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate w40). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctaattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagttggagcattcgggccgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttcaaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggcaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttataccgctgttacc
aattttcttttgtctctgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtaattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactcctt
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787445_P_P-D Feature FT:CDS EU787445_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W51). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtgggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagtttatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtattggccaaaattagcagtccccaac
ctacaatcactcaccagcatcaagtcctccaacttgtcgtggttatcgctggacgtgtatgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttatggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacatgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttctgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcgacaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787446_P_P-D Feature FT:CDS EU787446_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W75). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatattaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctccgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU787447_P_P-D Feature FT:CDS EU787447_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgagtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaacttcta
gcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcgctga
atcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU919197_P_P-D Feature FT:CDS EU919197_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJU). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttccc
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggct
gaaattgattatgcctgctaggttttttccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttgggatggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttaccatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctactg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttctgggttttgccgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctcacgtccccttctccgtctgctgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU921418_P_P-D Feature FT:CDS EU921418_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.165.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaattttactgggctctattcttctactgttcctgtctttaatcctcattggaaaacgccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattagataaaggtatcaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacactctctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctctcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaacccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgactccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgataagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctctgggtatacatttaaaccctaacaaaacaaagagatggggttactctctacattttatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttaaaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattcttgggactgataactctgttgtcctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccctctcggggtcgcttggggctctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU921419_P_P-D Feature FT:CDS EU921419_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 22.252.07). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagacgaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccctggactc
ataaggtggggaattttactgggctctattcttctactgtacctgtctttaatcctcattggaaaacgccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatacttgccattagataagggtatcaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaacccagattgggac
ttcaatcccaacaaggacacctggccggacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccgcctttgagaaacacacatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgtcgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctacattttatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagccaaccttattgggactgataactctgttgtcctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU939680_P_P-D Feature FT:CDS EU939680_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C186). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggtaccctagaagaagaactccctcg
cctcgccgacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtaaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatcccaatgtcaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccgccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtgtgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgattcctgctcaaggaacctctatgtatccctcttg
ttgctgtaccaaagcttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccatttctccttgctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggcta
tgtcattggatgtcatgggtcattgccacaagaacacatcagacaaaaaatcaaagaatgttttaggaaacttcctatta
acaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
tcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggaccgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|EU939681_P_P-D Feature FT:CDS EU939681_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaaccacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctctcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggcgctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagagacctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349205_P_P-D Feature FT:CDS FJ349205_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H5). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaagtgggtaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaactccctcttttcct
aatatacatttacacccagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cggaacatttagttaatcattacttccaaaccagacattattcacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggat
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactccttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcgaacattctcgggacggataactctgttgttttatcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349206_P_P-D Feature FT:CDS FJ349206_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctccatctcgggaatctcaatgttagtattccttggactc
ataaagtgggtaactttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggccctctcacagtaaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cggaacatgtagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggcctgttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccgcctttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctaggcaacggccgggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgcctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349208_P_P-D Feature FT:CDS FJ349208_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H25). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactc
ataaagtgggtaactttacggggctttattcttctactatacctgtctttaaccctaattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagact
gcaattaattatgcctgctaggttctatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cggaacatttagttaatcattacttccaaaccagacattatttacacactctatgggaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcccctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaaccaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaattagagaatgttttaggaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349209_P_P-D Feature FT:CDS FJ349209_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H29). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccagattttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaacaaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttgtatgcatgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349213_P_P-D Feature FT:CDS FJ349213_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H59). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagacttgtgttgttagacaacgacacaggtccactagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggagctttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcaggaatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggccgggtttcaccccaccgca
cggaggactcttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtacttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcgaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatggggta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacgaaaaatcaaggaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttactcaatgtggttat
cctgctttaatgcccttgtatgcgtgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacgcaacccccactg
gttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacatcatcgggactgataactctgttgtcctctcccgtaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgactgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|FJ349214_P_P-D Feature FT:CDS FJ349214_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H61). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacgcttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttgctgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcgtttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattactttcaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaactcatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacaactggccagacgccaacaaggtaggagctggagcattcgggctgggtttcactccaccgca
cggaggtcttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagccgaccccgctgtctccacctttgagaaacactcatcctcatgccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgcggagcatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgacaactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaatttcatgggtta
tgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctacta
acaggcctattgattggaaagtatgccaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgcg
taaacaatacctgaacctttaccccgttgcccggcaacgggcaggtctgtgccaagggtttggtgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349215_P_P-D Feature FT:CDS FJ349215_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H82). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aagatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattctgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggtggccttttggggtggaggcctcaggctcagggcatactacaaaccttgcctacaaatccgcctcctgcctctacca
atcgtcagccaggaaggcagcctaccactctgtctccacctttgagaaacacgcatcatcaggcaatgaagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgaatctccctgctggtggctccagttcaggaacagg
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgatacaggcggggtttttcttgttgataagaatcctcacaataacgcac
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtgttgtccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaaggtggggttactctttacattttatgggcta
tgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349216_P_P-D Feature FT:CDS FJ349216_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H113). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aagatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattctgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaaggtggggttactctttacattttatgggcta
tgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtcttgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349218_P_P-D Feature FT:CDS FJ349218_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H135). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacacttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttctatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaagtccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccctgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
attgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcctgtca
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggacaactctgttgttctctcccgcaaatatac
gtcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349219_P_P-D Feature FT:CDS FJ349219_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H138). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aagatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatgtagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattctgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttcaaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggtccctgcgctgaacatggagaaca
tcacatcaggattcctagcacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttgaaccctaacaaaacaaaaaggtggggttactctttacattttatgggcta
tgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349220_P_P-D Feature FT:CDS FJ349220_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H144). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aagatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcgattgattatgcctgctaggttttatccaaatggtaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaaggtggggttactctttacattttatgggcta
tgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349228_P_P-D Feature FT:CDS FJ349228_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C11). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactattcctgtctttaaccctcattggaaaacacccacttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggcaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtacgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349229_P_P-D Feature FT:CDS FJ349229_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C26). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctaccgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttactaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatatacttgggaacaagagatacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctcctcctttgagaaaccctcatcctggggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
caaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcgtacagaaaatcaaagaatgttttagaaaacttcctgttc
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggtctctatcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349230_P_P-D Feature FT:CDS FJ349230_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C7). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctaccgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacactttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttactaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatatacttgggaacaagagatacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctcctcctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctcctacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgtcctctcccgcaaatatac
gtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349231_P_P-D Feature FT:CDS FJ349231_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C22). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccctcttttcct
aagatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacagaccttgccagcaaatccgcctcctgcctcgacca
atcgccagtcaggaaggcaacctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggttttgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacacaagatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaagctaaacaggctttcactttctcgccaacttacaaggccttcttgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349232_P_P-D Feature FT:CDS FJ349232_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C51). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcactggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccgaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccacctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgacttctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggcta
tgttattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttactcaatgtggttat
cctgctttaatgcccttgtatgcatgtatccaatataagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349233_P_P-D Feature FT:CDS FJ349233_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C54). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacacccttttttcct
aatatacatttacaccaagacattatcacaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
aaaattgattatgcctgctaggttctatcccaatgttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcaggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaagaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcttggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctatta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcagtctaagcaagcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctgtcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349234_P_P-D Feature FT:CDS FJ349234_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C82). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aacatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcatttgattatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaactacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagcattcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcctacgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgcaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ349235_P_P-D Feature FT:CDS FJ349235_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C90). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccgtggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttaccccaagacattatcagaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcgattgattatgcctgctaggttttatcctaaggttaccaaatatttgccattggataagggtattaaaccttattacc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacacccatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttcgaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatcgaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctccgctgccgatccataccgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ386590_P_P-D Feature FT:CDS FJ386590_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1841). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatgctacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaatatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgtaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ562309_P_P-D Feature FT:CDS FJ562309_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I200). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcttaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattggttatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggaccattcgggccggggttcactccaccaca
cggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccacca
atcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaaaatcccggagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaacctgttcccactactgtctctcacatatcgkcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgtaacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaacataagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ562338_P_P-D Feature FT:CDS FJ562338_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I192). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcgtttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtaaatgagaaaagaagatt
gcagttgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgaaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggcctgttggggtggagccctcaggctcagggcatattacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccytgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttactgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgggtta
tgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgctttggaaaacttcctgtta
acaggcctattgattgggaagtctgtcaacgaattgtggggcttttgggttttgctgccccttttacgcaatgtggttat
cctgctttaatgcccctgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctaccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggaccgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttcgaggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgtacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|FJ692506_P_P-D Feature FT:CDS FJ692506_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50157). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacgccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagctctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttccaacta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ692507_P_P-D Feature FT:CDS FJ692507_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50158). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcct
aatatacatttacgccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagctctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttccaacta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ692532_P_P-D Feature FT:CDS FJ692532_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50053). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcs
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatctacaccaagatattatcaaaaaatgtgaacagtttgtaggcccgcttacagtcaatgaaaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtattaaaccttattatc
ccgaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggacggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtttccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaaatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaagatcacattatacacaaaatcaaagaatgcttcagaaaactccctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtctgctgggttttgctgcccctttcacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcttgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacatactcgggactgacaactctgttgtcctctcccgcaaatatac
atcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ692533_P_P-D Feature FT:CDS FJ692533_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D4_50064). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatctacaccaagatattatcaaaaaatgtgaacagtttgtaggcccgcttacagtcaatgaaaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggacggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcgtcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagaaatggggttattctctaaatttcatgggcta
tgtcattggatgttggggatcattgccacaagatcacattatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtctgctaggttttgctgcccctttcacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacatactcgggactgacaactctgttgtcctctcccgcaaatatac
ctcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttaggaccctgtcgtcctcttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ899792_P_P-D Feature FT:CDS FJ899792_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146-1). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaaccacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctctcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggcgctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagagacacgcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagagacctgtatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaacg
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccggcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcttg
ttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904395_P_P-D Feature FT:CDS FJ904395_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A10a). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaattttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgcttacaaycaatgagaaaagaaggtt
aaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacacagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagcgggagcattcgggctggggttcaccccacctca
cggaggtcttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgycagtcaggaaggcagccgaccccgctgtctccacctttgagagacactcatcctcaagccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtacttccctgctggtggctccagttcaggaacaat
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaaaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
artctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcatg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgttgtattgggggccaactctgcacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaatactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatccgacacaaaatcaaagaatgtttcagaaaacttcctgtta
acaggcccattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaaccttctcgggactgacaactctgtagttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904399_P_P-D Feature FT:CDS FJ904399_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A18). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagwcgaaggtstcaatcgscgcgtcgcagaagatctcaatctcgggaatctcaatgtaagtattccttggactc
ataaggtgggaaaccttacggggctttattcttmtactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggttcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcacatattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccctctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904402_P_P-D Feature FT:CDS FJ904402_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A26). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctagcagacgaaggtgtcaatcgccgcgtcgcagaagatctcaatctcgggaatcscaatgttagtattccttggactc
ataaggtgggaaactttgcggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacatcaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaaaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagraacagc
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccytgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagattgttttcgaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggccsggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904410_P_P-D Feature FT:CDS FJ904410_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A54b). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggacagtttacggggctttattcttctactgaacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcmaaagatgtgaacagtttgtaggcccgctcacaattaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggataagggtatcaaatcctattatc
cagaacatctagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggtattttatataagaga
gaaacaacacgtagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaatagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttggcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggcagttggggatccttgccgcaagatcatatcagacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacggattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904412_P_P-D Feature FT:CDS FJ904412_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A56). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatcctaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacacctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaagctcagggcatactacaaaccttgccagcaaatccgcctccttcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcaggcagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904415_P_P-D Feature FT:CDS FJ904415_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A63). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagcattctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cgtagcagtcgaaggtgtcaatcggcgggtagcagaagatctcaatctcgggaatctcaatgttagtattcgttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaggatccaagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatcttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gatggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcatccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904418_P_P-D Feature FT:CDS FJ904418_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A69a). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaccaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggacttttggggtggagccctcaagctcagggcatgctacaaaccttgccagcaaatccacctcctgcctctacca
atcgccagtcaggaaggcagcccacacctctgactccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acacccttccaccaaactctgcaagatcccaaagtgagcgacctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatggatcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgtttcgctcgcagcaggtctggagcgaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904419_P_P-D Feature FT:CDS FJ904419_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A70). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaatttaacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaaacgtaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatcccgattgggac
ttcaatcccaacaaggacacttggccagatgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggcggccttttggggtggagccctcaggctcagggcataattcaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgtttcaggcggggtgtttcttgttgacaagaatcctcacaatgccgcag
agtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttaccgctgtttcc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggatgttggggatccttgccgcaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacgacttgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcccttatatgcatgtattcaatctaaacaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcggaactgacaattctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904420_P_P-D Feature FT:CDS FJ904420_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71a). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcargatccmagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatcttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gatggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcatccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904421_P_P-D Feature FT:CDS FJ904421_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71b). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctactcctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcargatccmagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatcttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gatggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcatccaaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904422_P_P-D Feature FT:CDS FJ904422_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A76). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
ccgaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggactcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccaccgttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccmtgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcatatcatacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
caaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgtaccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904424_P_P-D Feature FT:CDS FJ904424_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A79a). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggacactttacggggttttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataggaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacacctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaattaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaggtctgtcaacgtattgtgggtcttctgggttttgctgctccttttacacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcctgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904426_P_P-D Feature FT:CDS FJ904426_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgctagtattccttggactc
ataaggtgggaaactttacggggctttattcttccactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatattcatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacacctagttaatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacccctcctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaagccatgcagtggaactcc
acaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttatg
taaacaatacytgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904427_P_P-D Feature FT:CDS FJ904427_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B6). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttccc
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatatagttaatcattactatcaaaccagacattatttacacactctatgggaggcgggtatattgtataagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagatacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagcgttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaagccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgaccactgtatctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgccttggccaaaattcgcagtccccgac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggaaagaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattaccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904429_P_P-D Feature FT:CDS FJ904429_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B8). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2484 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggtaactttacggggctttattcttctactgttcctgtctttaaccctcagtggaaaacaccatcttttcct
aatatacatttacaccaagacattatcaagaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactaaatccgcctcctgcctctaccaatcgccagtcaggaa
ggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaactccacaaccttccaccaa
actctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagtaaaccctgttccgac
tactgtctctccaatatcgtcaatcttctcgaagattggggaccctgcgctgaacatggagaacatcacatcaggattcc
taggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatgccgcagagtctagactcgtgg
tggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacc
aaccttctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgc
tatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctacttccaggatcttcaacc
accagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctgttgctgtacaaaacc
ttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagtgggcctcagccc
gtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttata
tggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtct
ttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggctatgtcattggatgtta
tgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcctgttaacaggcctattgatt
ggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcctgctttaaaaccc
ttatatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttctatgtaaacaatacctgaa
cctttaccccgttgcccggcaacggccaagtctgtgccaagtgtttgctgatgcaacccccactggctggggcttggtca
tgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctagccgcttgttttgct
cgcagccggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaatatacatcgtttccatggct
gctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacc
cctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacggggcgcacctctctttac
gcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccacc
gtga
>gnl|hbvcds|FJ904431_P_P-D Feature FT:CDS FJ904431_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B12). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgatagtattccttggactc
ataaggtgggaaaccttgcgggactttaktcttctacagttcctgtcattaaccctsattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
ccgaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagatacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcggaccgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgagtccacctttgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtggacaaaaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtatcacatcttgastccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcatatcatacagaaaatcaaagaatgttttagaaaacttcctgtaa
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904432_P_P-D Feature FT:CDS FJ904432_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B14). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctmgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcagtggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggaatcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctcaaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttctatg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacatcctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcagacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904433_P_C-D Feature FT:CDS FJ904433_P_C-D of [Viruses] Hepatitis B Virus genotype D (isolate B15). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctaaatctcgggaatstcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaacaaatgtgaacagtttgtaggcccacttacagccaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttactaaatatttgcccttggataagggtattaaaccatattatc
cagaacatttagttaatcattacttccaaacaagacactatttacacactctatggaaggcgggtatcttatataagaga
gaatcaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggac
ttcaatcccaacaaggacccctggccagacgccaacaaggtaggagcgggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcaaggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctctgagagacactcatcctcaagccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaccatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtccatacagcatctwgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaagagatggggttattccctacatttcatggggta
tgtcattggatgttggggatccttgccacaagatcatatcagacaaaaaatcaaagaatgttttagaaaactccctgtta
acaggcctattgattggaaagtatgtcaacgtattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgctttaatgcccttatatgcatgtattcaatataagcaggcttttactttttcgccaacttgcaaggcctttcagtg
taaacaatacatgaacctttaccccgatgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcctgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgttgttctctctcgcaaatatac
gtcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcctgggggtctctcgtccccttctctgcctgccgttccgaccgaccacgggg
cgcatctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904435_P_P-D Feature FT:CDS FJ904435_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B27). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacgttattaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattttaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatttagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgggtta
tgtcattggctgttggggatcattgccgcaagatcatatcatacacaaaatcaaagattgtttcagaaaactccctgtta
acaggcccattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcgtgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacgttcaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggactgacaactctgtagttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcctggggatctatcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904438_P_P-D Feature FT:CDS FJ904438_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B32). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctaatgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
gaaattgattatgcctgctaggttttatcctaattgtaccaaatatttgcccttggacaagggtatcaaaccctattatc
cagaacatgtagttaatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagccyacaccgctgtctccacctataagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcggtgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtgcaccaycttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctgcattttatgggtta
tgtcattggaagttggggatcattgccgcaagatcatatcagacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcccattgattggaaagtgtgtcaacgaattgtgggtcttcttggttttgctgcccctttcacacaatgtggttat
cctgcgttaatgcctttatatgcatgtattcaatctaagcaggcgtttactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggctataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgacaactctgtcgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904439_P_P-D Feature FT:CDS FJ904439_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B34). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactgctgttgttagatcaagaagcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccatcttttcct
aatatacatttacatcaagacattattaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggtt
aaaattgattatgcctgctaggttttatcctaagtttaccaaatatttgcccttggacaagggtatcaaaccctattatc
ccgaacacatagttaatcattacttccaaaccagacactatttacatactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccatcagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcacaccacccca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctactccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctccattttatgggtta
tgtcattggaagttggggatcattgccacaagatcatatcagacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggttttgctgcccctttcacacaatgtggttat
cctgcattaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggccgggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggcaataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccctcggcgctga
atcctgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgcggttccggccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904443_P_P-D Feature FT:CDS FJ904443_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B46). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatgcagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|FJ904445_P_P-D Feature FT:CDS FJ904445_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B62). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaacctttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcacaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cggaacacctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaagctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
aatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtccttaccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgtaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcgtggagaccaccgtga
>gnl|hbvcds|FJ904446_P_P-D Feature FT:CDS FJ904446_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B64a). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaacatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagccaaaaaggcagcctacacctctgtctccacctttgagagacactcatcctcaggccatgcagtggaacatc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctagaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccctaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgtgacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgcctcaagatcacatcagacagaaaattaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaagtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcgctga
atcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ167301_P_P-D Feature FT:CDS GQ167301_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM452). Complete genome. [Hepadnaviridae] (length=2505 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctgttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccagaccagagattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgcaagcaaatccgcctcctgcttctacca
atcgccagacgggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgcgcagtggaactcc
acaactttccaacaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgttgcccgtttgtccggtaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtc
tggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttcaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgcaccttttacacaatgtggttat
cctgctttaatgcccttgtacgcctgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctgggggttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatgggcatggagaccaccgtga
>gnl|hbvcds|GQ167302_P_P-D Feature FT:CDS GQ167302_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4521). Complete genome. [Hepadnaviridae] (length=2505 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctgttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagact
gcaattggttatgcctgctaggttttatccaaaggttaccaaatatttgccatgggataagggtattaaaccttattatc
cagaacatctagtttatcattacttccagaccagagattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagacgggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgtgcagtggaactcc
acaactttccaacaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcccacatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgcgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgttgcccgtttgtccggtaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtc
tggcctttagttatacggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttcaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgcaccttttacacaatgtggttat
cctgctttaatgcccttgtacgcctgcattcagtctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctgggcgttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatgggcatggagaccaccgtga
>gnl|hbvcds|GQ183448_P_P-D Feature FT:CDS GQ183448_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4629). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggattctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagaccatatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaatcttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaccctttcgggctctcctgccgatccatactgaggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaactatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183449_P_P-D Feature FT:CDS GQ183449_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4591). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcaacaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183450_P_P-D Feature FT:CDS GQ183450_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4589). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183451_P_P-D Feature FT:CDS GQ183451_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4588). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183452_P_P-D Feature FT:CDS GQ183452_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4590). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtccatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183453_P_P-D Feature FT:CDS GQ183453_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4574). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183454_P_P-D Feature FT:CDS GQ183454_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4582). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183455_P_P-D Feature FT:CDS GQ183455_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4573). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183456_P_P-D Feature FT:CDS GQ183456_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4572). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183457_P_P-D Feature FT:CDS GQ183457_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4583). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgataggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183458_P_P-D Feature FT:CDS GQ183458_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4587). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaaaatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gatacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183459_P_P-D Feature FT:CDS GQ183459_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4585). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183460_P_P-D Feature FT:CDS GQ183460_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4584). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcgtacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggctat
cctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtcggtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183461_P_P-D Feature FT:CDS GQ183461_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4586). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaaaatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183462_P_P-D Feature FT:CDS GQ183462_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4567). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183463_P_P-D Feature FT:CDS GQ183463_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4613). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
ataatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183464_P_P-D Feature FT:CDS GQ183464_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4703). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183465_P_P-D Feature FT:CDS GQ183465_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4614). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaaggaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183466_P_P-D Feature FT:CDS GQ183466_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4577). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183467_P_P-D Feature FT:CDS GQ183467_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4705). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtgtgctgcgcggcatcatattac
tcttcctcttgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttttctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183468_P_P-D Feature FT:CDS GQ183468_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4632). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaccataccaaag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctatgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183469_P_P-D Feature FT:CDS GQ183469_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4602). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggtaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctgatt
ccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcgtacagaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggctat
cctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183470_P_P-D Feature FT:CDS GQ183470_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4639). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatttagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgactggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgggtat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctatg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtggcaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183471_P_P-D Feature FT:CDS GQ183471_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4610). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacttctgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttactctttaaatttcatgggata
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttctgggttttgctgccccttttacgcaatgtgggtat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183472_P_P-D Feature FT:CDS GQ183472_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4691). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggat
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctcgcccatatcgtccatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggata
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttctgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183473_P_P-D Feature FT:CDS GQ183473_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4601). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaatcatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttattaccgctgttacc
atttttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183474_P_P-D Feature FT:CDS GQ183474_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacccgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgttg
acaggcctattgattggaaagtctgtcaacgtattgggggtcttttgggctttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183475_P_P-D Feature FT:CDS GQ183475_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4575). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaaaaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183476_P_P-D Feature FT:CDS GQ183476_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4603). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaatcttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacaacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183477_P_P-D Feature FT:CDS GQ183477_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4604). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaatatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtcttgactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttactcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183478_P_P-D Feature FT:CDS GQ183478_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4605). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcctgccaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcattctacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
actaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctgaatttcatgggcta
tgtcattggatgttatgggtcattaccacaagaacacattacacaaaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183479_P_P-D Feature FT:CDS GQ183479_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4607). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgcgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgggcta
cgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183480_P_P-D Feature FT:CDS GQ183480_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4609). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcgacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaatatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaataccgcag
agtcttgactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaccctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183481_P_P-D Feature FT:CDS GQ183481_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4569). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccgtggactc
ataaggtgggaaattttacggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcttg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183482_P_P-D Feature FT:CDS GQ183482_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4570). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttgcggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcttg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183483_P_P-D Feature FT:CDS GQ183483_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4566). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccctcttg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183484_P_P-D Feature FT:CDS GQ183484_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4598). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccgtggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggcgcagggcataatacaaaccttgccagcaaatccgcctcctgcatctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaacattccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgactttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggaagttatgggtcattgccacaaaatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggtctctttcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ183485_P_P-D Feature FT:CDS GQ183485_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4599). Non-functional genomic sequence. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagatt
gcaattgattatgcccgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaagccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggcctttttgggtggaaccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctccaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtcttgactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctgaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagaacacatcacacaaaaaatcaaagattgttttagaaaacttcctgtta
acaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ184322_P_P-D Feature FT:CDS GQ184322_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4522). Complete genome. [Hepadnaviridae] (length=2505 residues).
atgcccctatcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcgatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttatccttctactgttcctgtctttaaccctcattggaaaacaccctgttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatgtagttaatcattacttccagaccagagattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaccaaatccgcctcctgcttctacca
atcgccagacgggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgtgcagtggaactcc
acaactttccaacaaactctgcaagattccagagtgagaggcctgaatctccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtccctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtccggtaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtc
tggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggaagttatgggtcattgccacaagatcacatcacacaaaaaatcaaagactgtttcaggaaacttcctgtca
acaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgccccgtttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccacgggg
cgcacctctctttacgcagactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatgggcatggagaccaccgtga
>gnl|hbvcds|GQ205380_P_P-D Feature FT:CDS GQ205380_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1245). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttccc
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacattatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctctgagagacactcatcctcaggccatgcagtggacctcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtggttat
cctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205382_P_P-D Feature FT:CDS GQ205382_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1360d). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaacttttccc
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgccagctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttattatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggctcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggacatcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtacttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccagcttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataagacaaaaagatggggatattctctacacttcatgggtta
tgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgcccctttcacgcaatgtggttat
cctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaacttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205384_P_P-D Feature FT:CDS GQ205384_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1434d). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacggcgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaacttttcct
aatatacatttacaccaagacatcataaaaaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagacaagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaactcatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaaccctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggcggccatttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggacctcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactcctgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccggcttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggcatacatttaaatcctaataagacgaaaaggtggggttattctctacacttcatgggtta
tgtcattggttgttggggatcattaccacaagagcacattatacacaagctgaaagaatgttttagaaaactacctgtta
acaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcatgtattcaagcgaaacaggctttcactttctcgccaacttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttaggtctctgtcgtcctctcctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcgcctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205385_P_P-D Feature FT:CDS GQ205385_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1469). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttccc
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggacctcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
tcaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacgaaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgggtta
tgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtggttat
cctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205388_P_P-D Feature FT:CDS GQ205388_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1562). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttccc
aatatacatttacaccaagacatcatcaacaaatgtggacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaagcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggacctcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgggtta
tgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtggttat
cctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ205389_P_P-D Feature FT:CDS GQ205389_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1667). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttccc
aatatacatttacaccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagatt
gcaattgattatgcctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatc
cagaacatctagttaatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccgcttggatccagccttcagagcaaacaccagaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagcccccaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctacca
atcgccagtcaggaaggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaacagt
aaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacgaaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgggtta
tgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccctgtta
acagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacccaatgtggttat
cctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttctatg
taaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttagtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ377589_P_P-D Feature FT:CDS GQ377589_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate J145). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtcggcccactcacagtcaatgaaaaaagaagact
gcaattgattatgcctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccacctcctgcctctacca
atcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtctctgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcccgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggggcgaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ477452_P_P-D Feature FT:CDS GQ477452_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaatcatgcctgctaggttttatccaaaagttaccaaatatttgccattagataagggtatcaagccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaattcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccctgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctgatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggcaaagtctgtaccgcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gcagcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ477453_P_P-D Feature FT:CDS GQ477453_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P39). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagacttctgttgttagatgccgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctaaatctcgggactcccaatgttagtattccttggactc
acaaggtgggaaactttacagggctttattcttctacggtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagact
gcaattaatcatgcctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccytattatc
cagaacatctagtcaatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgatcaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggatacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgacagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaagccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattcctatggg
aatgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggccctttttacagctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggtcactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttttgtg
taaacagtatctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattatcgggacggacaactctgttgttctctcccgcaaatatac
atcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ477455_P_P-D Feature FT:CDS GQ477455_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P73). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2496 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaagtgggtaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cggaacatttagttaatcattacttccaagccagacattatttacacactctatggaaggcgggtatcttatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctaccccgctgactccacctttgggagacactcatcctctggcccagtggaagtccaca
actttccaccaaactctgcaagatcccagggtgaaaggcctgtatttccctgctggtggctccagttcaggaacagtaaa
ccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatca
catcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagt
ctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaacctc
caatcactcaccaacctcctgtcctcaaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctct
tcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaattcca
ggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcatgttg
ctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgggagt
gggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtttgg
ctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgttaccaat
tttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggttactctttaaatttcatgggctatgt
cattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgttaaca
ggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttatcct
gctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaagacctttctgtgcaa
acaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactggct
ggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactcctagcc
gcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatacatc
gtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatc
ccgcggacgacccttctcggggccgcttgggggtctttcgtccccttctccgtctgccgtttcgtccgaccacggggcgc
acctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgc
atggagaccaccgtga
>gnl|hbvcds|GQ477456_P_P-D Feature FT:CDS GQ477456_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P84). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaagatctaaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttaatattccttggactc
ataaggtgggaaactttacagggctttattcttctactgtacctgtcttcaaccctcattggaaaacaccctcttttcct
aatatacatttacgccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgaaaaacgaagact
gcaattaattatgcctgctaggttttatccaaaggctaccaaatatttgccattagataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagaga
gaaacaacacatagcgcctcattttatgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccgtgccagcaaatccgcctcctgcctctacca
atcgccagtcaggaaggcaacccaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaataaaactaaaagatggggttactctttaaatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ477457_P_P-D Feature FT:CDS GQ477457_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P118). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaagtgggtaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagact
gcaattaattatgcctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatc
cggaacatttagttaatcattacttccaagccagacattatttacacactctatggaaggcgggtatcttatataagaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctacca
atcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctctaatt
ccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgggcta
tgttattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaagacctttctgtg
taaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggccgcttgggggtctttcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ477458_P_P-D Feature FT:CDS GQ477458_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P126). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactc
ataaggtgggaaactttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagact
gcaattgattatgcctgctaggttttatccaaagggtaccaaatatttgccattggataagggcattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagaga
gaaacaacacatagcgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctacca
atcgccagtcaggaagacagcctacccctccaactctacctttgagacacactcatccccaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaaaatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcatcaaaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccctcctg
ttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggcttttagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattaccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtatgtcaacgtattgtgggtcttttgggttttgctgcccctttttcacaatgtggttat
cctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcataggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ477459_P_P-D Feature FT:CDS GQ477459_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P127). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagact
gcaattgattatgcctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggaatattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgca
cggaggccttttagggtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctacca
atcgccagtcagggaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccctcatg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgggcta
tgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcctgtta
acaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggtttcgctgccccttttacacaatgtggttat
cctgctttaatgcccttatatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaatttac
atcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccgtctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ922000_P_P-D Feature FT:CDS GQ922000_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3552). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagaactcaatctcgggaatcccaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgcacctgtctttaatcctcattggaaaacaccatcttttcct
catatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaaggagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataaaggtattaaaccctattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgtattatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagaagccaacaaggtaggagctggagcattcgggctgggtttcaccccaccaca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccaatcaggaaggcagccgactccactgtctccacctttgagagacactcatcctcaagccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcattttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattcgctaaattttatgggtta
tgtcattggaagttatgggtccttgccccaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcctgtca
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttctgta
taaacaatacctgaacctttaccccgttgctcggcaacggcccggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacatcgtcgggactgataactctgttgtcctctcccgcaaatatac
atcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtyccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggaaaccaccgtga
>gnl|hbvcds|GQ922001_P_P-D Feature FT:CDS GQ922001_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3654). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatgttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaaggagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgtgttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atccccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgtttcgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattcgctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcctatca
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattgtcgggactgataactctgttgtcctctcccgcaaatatac
atcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtcccctcctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ922002_P_P-D Feature FT:CDS GQ922002_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1B3624). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggaggggaactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatgttttcct
aatatacatttacaccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaaggagatt
gcaattgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgtgttatataagaga
gaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccacca
atcgccagtcaggaaggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctctcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattcgctaaattttatgggtta
tgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcctatca
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtggttat
cctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttttgtg
taaacaatacctgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaacccccactg
gctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagccggtctggagcaaacattgtcgggactgataactctgttgtcctctcccgcaaatatac
atcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctga
atcccgcggacgacccttctcggggtcgcttgggactctctcgtcccctcctccgtctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgt
cgcatggagaccaccgtga
>gnl|hbvcds|GQ922003_P_P-D Feature FT:CDS GQ922003_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3225). Complete genome. [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactc
acaaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcagtggaaaacaccctcttttccc
aatatacatttacaccaagatattattaaaaaatgtgaacagtttgtaggcccgctaacagtcaatgaaaaaagacggtt
gaaattgattatgcctgctaggttttatcctaattttactaaatacttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagaga
gtatcaacacatagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcaaggcataatacaaactttgccagcaaatccgcctcctgcctctaccg
atcgccagtcaggacggcagcctaccccgctgtctccacctctgagagtcacttatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagt
aaaccctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaaca
tcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccgggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttattctcttaatttcatgggcta
tgtcattggttgttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgtttcagaaaactccctgtta
acaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggtttgctgcccctttcacacaatgtggttat
cctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggtcaggtctgtgccaagtgtttgctgatgcaacccccactg
gttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggatcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacrtcctttgtttacgtcccctcagcgctga
atcccgcggacgacccrtctcggggccgcttgggcccctgtcgtcctcttctctgcctgccgttccgaccgaccacgggg
cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcatgt
cgcatggaraccaccgtga
>gnl|hbvcds|GQ922004_P_P-D Feature FT:CDS GQ922004_P_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3284). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2499 residues).
atgcccctatcctatccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactc
acaaggtgggaaattttacggggctttattcttctactgtacctgtctttaaccctcagtggaaaacaccctcttttcct
aatatacatttacatcaagatattattaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgaaaaacgacggtt
gaaattgattatgcctgctaggttttatcctaattttactaaatacttgcccttggataagggtattaaaccttattatc
cagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcaggtgttttatataagaga
gtatcaacacatagcgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttcca
ccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggac
ttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgca
cggaggccttttggggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctcaacca
atcgacagtcaggacggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaactcc
acaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctgtggnnnnnnnnnnnnnnnnnnn
aaaccctgttccgactactgcctctcacacatcgttaatcttctcgaggattggggaccttgtgcggaacatggagaaca
tcacatcaggattcctaggacccctgctcgygttacaggcggggtttttcttgttaacaagaatcctcacaataccgaag
agtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaac
ctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcc
tcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaatt
ccaggatcatcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccctcctg
ttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatggg
agtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtt
tggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgttacc
aattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttattctcttaatttcatgggcta
tgtcattggttgttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgtttcagaaaacttccnnnnn
nnnnnnctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgcccctttcacacaatgtggttat
cctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtg
taaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaacccccactg
gttgggacttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactccta
gccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaatatac
atcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcgctga